Multiplex PCR (polymerase chain reaction) primer and probe combination for detecting DNA / mRNA (deoxyribonucleic acid / messenger ribonucleic acid) in E6 / E7 regions of seven high-risk human papilloma viruses, detection method and kit applying combination

Abstract

The invention discloses a multiplex PCR (Polymerase Chain Reaction) primer and probe combination for detecting DNA / mRNA (Deoxyribonucleic Acid / Messenger Ribonucleic Acid) in E6 / E7 regions of seven high-risk human papilloma viruses, a detection method and a kit applying the combination, and relates to the technical field of pathogen gene detection. According to the technical scheme, the kit is characterized by comprising the following components: component 1: a primer and a probe for detecting DNA / mRNA in an HPV 16E6 / E7 region; component 2: a primer and a probe for detecting DNA / mRNA in an HPV 18E6 / E7 region; component 3: a primer and a probe for detecting DNA / mRNA in an HPV 31E6 / E7 region; component 4: a primer and a probe for detecting DNA / mRNA in an HPV 33 / 52 / 58E6 / E7 region; component 5: a primer and a probe for detecting DNA / mRNA in an HPV 45E6 / E7 region; and the component 6 comprises a DNA / mRNA (deoxyribonucleic acid / messenger ribonucleic acid) primer and a probe for detecting an internal reference beta-globin. The invention aims to provide a multiplex PCR (Polymerase Chain Reaction) primer and probe combination for detecting DNA (Deoxyribonucleic Acid) / mRNA (Messenger Ribonucleic Acid) in E6 / E7 regions of seven high-risk human papilloma viruses, a detection method and a kit applying the combination.

Description

Technical Field

[0001] The present invention relates to pathogen gene detection technology, and more specifically, to a multiplex PCR primer and probe combination for detecting DNA / mRNA in the E6 / E7 region of seven high-risk human papillomaviruses, a detection method, and a kit using the combination. Background Art

[0002] Cervical cancer is one of the most common gynecological malignancies. According to the 2022 National Cancer Report released by the National Cancer Center, there were 119,000 new cases of cervical cancer in my country in 2016, with an incidence rate of 11.34 / 100,000, ranking fifth in the incidence rate of female malignant tumors and second in the incidence rate of gynecological malignant tumors; there were 37,000 deaths, with a mortality rate of 3.36 / 100,000, ranking seventh in the mortality rate of female malignant tumors and second in the mortality rate of gynecological malignant tumors. The incidence and mortality rates of cervical cancer are higher in rural areas than in urban areas, and the patient population tends to be younger. According to the latest statistical data on the incidence and mortality rates of cervical cancer in China, the incidence and mortality rates of cervical cancer have increased to varying degrees.

[0003] HPV testing is widely used in assisting the diagnosis of cervical cancer. Among them, the US FDA has approved five cervical cancer-related high-risk HPV testing products from four companies, four of which are for HPV DNA testing, including Hybrid Capture 2, a product of Qiagen that uses the second-generation hybrid capture method, Cervista HPV, a product of Hologic that uses the enzyme signal amplification method, and Cobas HPV and Onclarity HPV Assay, products of Roche and BD that use the real-time fluorescence quantitative polymerase chain reaction method. There is only one test for mRNA, namely Aptima HPV, a product of Hologic that uses transcription-mediated isothermal nucleic acid amplification technology; there is no reverse transcription qPCR kit for HPV E6 and E7 mRNA. Among the domestic kits, there are methods such as sanger sequencing and second-generation sequencing for human gene integration of viral DNA, but their shortcomings such as long experimental time and high requirements for experimental instruments make them unsuitable for grassroots testing. Cape's high-risk human papillomavirus E6 / E7 region mRNA detection kit based on RT-qPCR, but there is still a lack of methods for grassroots testing.

[0004] Therefore, a new technical solution is urgently needed to solve the above technical problems. Summary of the invention

[0005] In view of the shortcomings of the prior art, the purpose of the present invention is to provide a multiplex PCR primer and probe combination for detecting DNA / mRNA in the E6 / E7 region of seven high-risk human papillomaviruses, a detection method, and a kit using the combination.

[0006] The above technical objectives of the present invention are achieved through the following technical solutions: a multiplex PCR primer and probe combination for detecting DNA / mRNA of the E6 / E7 region of seven high-risk human papillomaviruses, characterized in that it includes the following components:

[0007] Component 1: Primers and probes for detecting HPV 16 E6 / E7 region DNA / mRNA;

[0008] Component 2: Primers and probes for detecting HPV 18 E6 / E7 region DNA / mRNA;

[0009] Component 3: Primers and probes for detecting HPV 31E6 / E7 region DNA / mRNA;

[0010] Component 4: Primers and probes for detecting DNA / mRNA of the HPV 33 / 52 / 58E6 / E7 region;

[0011] Component 5: primers and probes for detecting HPV 45E6 / E7 region DNA / mRNA;

[0012] Component 6: DNA / mRNA primers and probes for detection of the internal reference β-globin.

[0013] The present invention is further configured as follows: Component 1 includes an upstream primer HPV16-F sequence: AATGTTTTCAGGACCCACAGG; a downstream primer HPV16-R sequence: GTTGCTTGCAGTACACACATTC; a probe HPV16-P sequence, the 5' end of the probe is labeled with a FAM fluorescent group, and the 3' end is labeled with an MGB quenching fluorescent group, and the HPV16-P sequence is: ACCACAGTTATGCACAGAGCTGCA;

[0014] The component 2 includes an upstream primer HPV18-F sequence: ACCCTACAAGCTACCTGATCT; a downstream primer HPV18-R sequence: ACCTCTGTAAGTTCCAATACTGTC; a probe HPV18-P sequence, the 5' end of the probe is labeled with a VIC fluorescent group, and the 3' end is labeled with an MGB quenching fluorescent group, and the HPV18-P sequence is: ACGGAACTGAACACTTCACTGCAAGA;

[0015] The component 3 includes an upstream primer HPV58-F sequence: CGTGTCAAAGACCGTTGTGT; a downstream primer HPV58-R sequence: CGAGGTCTTCTCCAACATGC; a probe HPV58-P sequence, the 5' end of the probe is labeled with a CY5 fluorescent group, and the 3' end is labeled with a BHQ3 quenching fluorescent group, and the HPV58-P sequence is: TGCAACGTCCTGTCCACCTTCCTCC;

[0016] The component 4 includes a first upstream primer HPV33 / 52 / 58-F1 sequence: CGTGTCAAAGACCGTTGTGT; a second upstream primer HPV33 / 52 / 58-F2 sequence: TGTCAAAgACCtTTGTGTCC; a downstream primer HPV33 / 52 / 58-R sequence: GTCGGGaTCTCCAACAC; a probe HPV33 / 52 / 58-P sequence, the 5' end of the probe is labeled with a CY5 fluorescent group, and the 3' end is labeled with a BHQ3 quenching fluorescent group, and the HPV33 / 52 / 58-P sequence is: CAGCGCCCTGTCCAACGACCC;

[0017] The component 5 includes an upstream primer HPV45-F sequence: GATGAAgCAGATGGAGTTA; a downstream primer HPV45-F sequence: GCAACCACGGACACACAAAGGA; the HPV45-F sequence, the 5' end of the probe is labeled with a CY5 fluorescent group, and the 3' end is labeled with a BHQ3 quenching fluorescent group, and the HPV58-P sequence is: GAACCACAGCGTCACAA;

[0018] The component 6 includes an upstream primer β-globin-F sequence: GACTCTCTCTGCCTATTGGTCTATT; a downstream primer β-globin-R sequence: CCCATAACAGCATCAGGAGTG; a probe β-globin-P sequence, wherein the 5' end of the probe is labeled with a ROX fluorescent group and the 3' end is labeled with a MGB quenching fluorescent group, and the β-globin-P sequence is: CAGATCCCCAAAGGACTCAAAGAACC.

[0019] A method for detecting DNA / mRNA in the E6 / E7 region of 7 high-risk human papillomaviruses based on a POCT detection platform comprises the following steps:

[0020] S1. Sample collection: sampling by cervical swab;

[0021] S2. Sample processing: Mix the cervical swab and sample processing solution thoroughly in tube A;

[0022] S3. Nucleic acid release agent treatment: Take out 100ul of the mixed solution from tube A and mix it with 100ul of nucleic acid release agent in tube B and shake well;

[0023] S4. Control substance detection: Dissolve the positive control substance with 60 μL enzyme-free water, take 25 μL of the solution and transfer it to the corresponding detection tubes C1 and C2 to dissolve the lyophilized reagent and transfer it to the corresponding reaction tubes for amplification; directly dissolve the lyophilized reagent with 25 μL blank control solution and transfer it to the corresponding reaction tubes for amplification and quality control;

[0024] S5. Sample detection: Using the sample obtained in step S3 as a template, take 25 μL of each and directly put it into the freeze-dried reagent of the C1 and C2 detection tubes of the present invention for dissolution, transfer the above solutions to the corresponding reaction tubes for amplification, and judge the results by the Ct value.

[0025] The present invention is further configured as follows: the specific operation flow of step S5 is as follows: 2 equal volumes of the sample to be tested are taken and respectively tested in C1 and C2 reaction tubes, wherein the reaction systems of C1 and C2 reaction tubes are the same, C1 tube adopts a qPCR reaction program, and C2 tube adopts a RT-qPCR reaction program, the CTA1 value of the target obtained by the detection of C1 tube can reflect the content of HPV DNA, and the CTA2 value of the internal standard can reflect the content of cells in C1 tube; the CTB1 value of the target obtained by the detection of C2 tube can reflect the total content of HPV DNA and mDNA, and the CTB2 value of the internal standard can reflect the content of cells in C2 tube, ΔCT=(CTA1-CTB1)-(CTA2-CTB2), and the ΔCT value can reflect the content of HPV mRNA. Specifically, the 7 high-risk HPVs are HPV16, HPV18, HPV31, HPV 33, HPV45, HPV52, and HPV58, and the reaction program of the QPCR is shown in Table 1:

[0026] Table 1

[0027]

[0028] The reaction procedure of the QPCR is shown in Table 2:

[0029] Table 2

[0030]

[0031] Result judgment:

[0032] The sample quality control is qualified if the two internal standards (ROX) in the sample show a typical S-shaped amplification curve and the Ct value is ≤37. Otherwise, resampling or amplification is required. The determination of the target channel is based on the following Ct value results (Table 3).

[0033] Table 3 Results

[0034]

[0035] Specifically, the reaction reagents used for amplification in step S5 are composed as follows (Table 4-5):

[0036] Reagent C1 tube composition (Table 4)

[0037]

[0038]

[0039] Reagent C2 tube composition (Table 5)

[0040]

[0041] Specifically, the reaction conditions used for amplification in tube C1 in step S5 are shown in Table 6:

[0042] Table 6 Reaction procedure

[0043]

[0044] Specifically, the reaction conditions used for amplification in tube C2 in step S5 are shown in Table 7:

[0045] Table 7 Reaction procedure

[0046]

[0047] The present invention is further configured as follows: the reaction system of tube A and reaction tube B comprises: lyophilized reagent C1, lyophilized reagent C2, lyophilized protective agent, HPV16 / 18 positive cell control and negative cell control, and the lyophilized reagents C1 and C2 comprise the same components, specifically comprising: 5x Fast Direct RT Premix Buffer (dUTP) (Mg2+free) (DG), 50x Fast Direct Part Ampli (DG), 50x Fast Direct Part RTase (DG), 50x MgCl2, 4x lyophilized protective agent, 25x Primer-Probe Mix (comprising primers and probes of HPV16, HPV18, HPV 31, HPV 33, HPV45, HPV52, and HPV58).

[0048] A kit that can be used to detect 7 types of high-risk HPV E6 / E7 region DNA / mRNA, the kit containing the above-mentioned primer and probe combination, and the 7 types of high-risk HPV DNA / mRNA detected by the kit specifically include: HPV16, HPV18, HPV 31, HPV 33, HPV45, HPV52, and HPV58.

[0049] The present invention is further configured as follows: the kit also includes reagents required for qPCR and RT-qPCR reactions, specifically including reaction premix, enzyme and enzyme-free water.

[0050] The present invention is further configured as follows: the liquid reagent in the kit is freeze-dried in situ to form a freeze-dried powder through a freeze-drying procedure, and the freeze-drying procedure includes the following;

[0051] S1: pre-freeze;

[0052] S1.1: Temperature: 4℃; Duration: 30min; State: Hold; Pressure: 1atm;

[0053] S1.2: Temperature: -50℃; Duration: 1℃ / min; State: Cooling; Pressure: 1atm;

[0054] S1.3: Temperature: -50℃; Duration: 180min; State: Hold; Pressure: 1atm;

[0055] S2: one sublimation;

[0056] S2.1: Temperature: -40℃; Duration: 1℃ / min; State: Heating; Pressure: Extreme vacuum;

[0057] S2.2: Temperature: -40℃; Duration: 720min; State: Hold; Pressure: Extreme vacuum;

[0058] S3: secondary sublimation;

[0059] S3.1: Temperature: 25℃; Duration: 1℃ / min; State: Heating; Pressure: Ultimate vacuum;

[0060] S3.2: Temperature: 25°C; Duration: 300 min; State: Hold; Pressure: Extreme vacuum.

[0061] The present invention is further configured as follows: the kit also contains HPV16 and HPV18, an internal standard positive control substance and a blank control substance, wherein the HPV16 and HPV18 and the internal standard positive control substance are positive control cell lyophilized powder obtained by the HeLa and Siha cell mixture through the above-mentioned lyophilization procedure; the blank control substance is enzyme-free water.

[0062] The present invention has the following beneficial effects: The present invention provides primers and probe combinations for detecting the above 7 types of HPV E6 / E7 region DNA / mRNA for 7 high-risk HPV types, namely HPV16, HPV18, HPV31, HPV33, HPV 45, HPV 52, and HPV58, and on this basis provides a kit that can be used for a POCT detection platform to quickly and conveniently detect the 7 types of HPV E6 / E7 region DNA / mRNA. The kit described in the present invention is based on a multiplex fluorescent PCR method and molecular POCT, and the reagent is freeze-dried in situ by a freeze-drying process. It also has good stability when stored at room temperature, and has high operability and convenience. It is not only conducive to the transportation and preservation of the detection reagent, but also improves the detection sensitivity by increasing the input ratio of the detection sample. The kit described in the invention can directly treat the swab sample with a nucleic acid release agent, eliminating the complicated nucleic acid extraction process, significantly improving the detection efficiency, and shortening the detection flow time to 30 minutes; at the same time, due to the optimization of the release agent process, the direct amplification effect of clinical samples is significantly improved. The present invention can simultaneously complete the detection of HPV DNA and mRNA in one test, thereby improving the detection efficiency and reducing the inconvenience caused to patients by multiple tests. In addition, the present invention uses an endogenous internal reference, that is, by using an internal reference β-globin, to effectively control the quality of sample collection and sample extraction-free direct amplification. Therefore, the kit of the present invention has the advantages of being able to be transported and stored at room temperature, fast detection, low cost, good specificity, high sensitivity, and high detection efficiency, and can be used for cervical cancer screening, diversion, and prognosis judgment, etc. BRIEF DESCRIPTION OF THE DRAWINGS

[0063] Figure 1 The following is the operating procedure of the kit of the present invention;

[0064] Figure 2 It is the amplification curve of the kit of the present invention for detecting HPV68 type DNA / mRNA positive clinical samples;

[0065] Figure 3 It is the amplification curve of the kit of the present invention for detecting HPV6 type DNA positive and mRNA negative clinical samples;

[0066] Figure 4 It is the amplification curve of the kit of the present invention for detecting HPV11 type DNA positive and mRNA negative clinical samples;

[0067] Figure 5 It is the amplification curve of the kit of the present invention for detecting HPV35 type DNA positive and mRNA negative clinical samples;

[0068] Figure 6 It is the amplification curve of the kit of the present invention for detecting HPV68 type DNA positive and mRNA negative clinical samples;

[0069] Figure 7 It is the amplification curve of the kit of the present invention for detecting HPV16 type DNA positive and mRNA negative clinical samples;

[0070] Figure 8 It is the amplification curve of the kit of the present invention for detecting HPV18 type DNA positive and mRNA negative clinical samples;

[0071] Fig. 9 It is the amplification curve of the kit of the present invention for detecting HPV31 type DNA positive mRNA negative clinical samples;

[0072] Fig.10 It is the amplification curve of the kit of the present invention for detecting HPV33 type DNA positive mRNA negative clinical samples;

[0073] Fig.11 The amplification curve of the kit of the present invention for detecting HPV45 type DNA positive mRNA negative clinical samples

[0074] Fig.12 It is the amplification curve of the kit of the present invention for detecting HPV52 type DNA positive mRNA negative clinical samples;

[0075] Fig.13 It is the amplification curve of the kit of the present invention for detecting HPV58 type DNA positive and mRNA negative clinical samples;

[0076] Fig.14 It is the amplification curve of the kit of the present invention for detecting HPV16 type DNA / mRNA positive clinical samples;

[0077] Fig.15 This is the amplification curve of the kit of the present invention for detecting HPV58 type DNA / mRNA positive clinical samples. DETAILED DESCRIPTION

[0078] The present invention is further described in detail below in conjunction with the accompanying drawings.

[0079] The same parts are denoted by the same reference numerals. It should be noted that the words "front", "rear", "left", "right", "upper" and "lower" used in the following description refer to directions in the drawings, and the words "bottom" and "top", "inner" and "outer" refer to directions toward or away from the geometric center of a specific component, respectively. Specific embodiment 1:

[0081] A multiplex PCR primer and probe combination for detecting DNA / mRNA of the E6 / E7 region of 7 high-risk human papillomaviruses, namely, DNA / mRNA of the E6 / E7 region of HPV16, HPV18, HPV31, HPV33, HPV 45, HPV 52, and HPV58, and multiple sets of primers and probes are designed. At the same time, in order to evaluate factors such as sample collection and direct amplification of samples without extraction, the present invention selects β-globin, RNase P, and RPGD8 as candidate internal references, and designs corresponding primers and probes. On the basis of the primers and probes obtained by design, the sequences and combinations of the primers and probes are adjusted in combination with the test results. After continuous adjustment, detection, readjustment, and re-detection and adjustment, a primer and probe combination that can detect HPV16, HPV18, HPV31, HPV33, HPV 45, HPV 52, and HPV58 types through a 2-tube reaction is obtained, which also contains primers and probes for detecting β-globin.

[0082] The primer and probe combinations for 7 high-risk HPV types and the internal standard obtained in the present invention are shown in Table 8 below. To avoid redundancy, only the final primer and probe combinations are listed in the specification.

[0083] Table 8 Primer probe sequences

[0084] Specific embodiment 2:

[0086] A detection kit for 7 high-risk HPV types that can be applied to a POCT detection platform. Based on the primer and probe combination described in Example 1, the present invention establishes a method for detecting the 7 high-risk HPV types using the primer and probe combination, and also establishes a kit for detecting the 7 high-risk HPV types.

[0087] 1. Preparation of primer and probe combinations

[0088] The present invention commissioned Beijing Qingke Biotechnology Co., Ltd. to synthesize the primers and probes shown in Table 8, and at the same time, the 5' end of the probe for detecting HPV16 was labeled with the fluorescent gene FAM, and the 3' end was labeled with the quenching fluorescent group MGB; the 5' end of the probe for HPV18 was labeled with the fluorescent gene VIC, and the 3' end was labeled with the quenching fluorescent group MGB; the 5' end of the probe for HPV31, HPV33, HPV 45, HPV 52, and HPV58 was labeled with the fluorescent gene CY5, and the 3' end was labeled with the quenching fluorescent group BHQ3; the 5' end of the probe for detecting the internal standard β-globin was labeled with the fluorescent gene ROX, and the 3' end was labeled with the quenching fluorescent group MGB.

[0089] 2. Obtaining HPV reference materials

[0090] The positive control and blank control reagents of the present invention were purchased from Shanghai Zhongqiao Xinzhou Biotechnology Co., Ltd. and Invitrogen, respectively. Specifically, the positive control was a mixture of Hela cells (Cat. No.: ZQ0068) and Siha cells (Cat. No.: ZQ0129); the blank control was μLtraPure TM DNase / RNase-free distilled water (10977015).

[0091] 3. Establishment of the method for detecting the seven types of HPV DNA / mRNA

[0092] The method for detecting the seven types of HPV DNA / mRNA established by the present invention comprises the following steps:

[0093] S1. Sample collection: sampling by cervical swab;

[0094] S2. Sample processing: Mix the cervical swab and sample processing solution thoroughly in tube A;

[0095] S3. Treatment with nucleic acid releaser: Take out 100ul of the mixed solution from tube A and mix it with 100ul of nucleic acid releaser in tube B, and shake it thoroughly. The specific nucleic acid releaser is: the releaser model (CNA02022-10) produced by Suzhou Cretaceous Biotechnology Co., Ltd.

[0096] S4. Control substance detection: Dissolve the positive control substance with 60 μL enzyme-free water, transfer 25 ul of the solution to the corresponding detection tubes C1 and C2 to dissolve the lyophilized reagent and transfer to the corresponding reaction tubes for amplification; use 25 μL of blank control substance solution to directly dissolve the lyophilized reagent and transfer to the corresponding reaction tubes for amplification and quality control.

[0097] S5. Sample detection: Using the sample obtained in step S3 as a template, take 25 μL of each and directly put it into the freeze-dried reagent of the C1 and C2 detection tubes of the present invention for dissolution, transfer the above solution to the corresponding reaction tube for amplification, and judge the result by the Ct value;

[0098] Result judgment:

[0099] If the amplification curve of the internal standard (ROX) in the two tubes of samples does not show a typical S-shaped amplification curve or the Ct value is greater than 37, it means that the sample extraction is unqualified and resampling is required;

[0100] If the internal standard β-globin (ROX) in both tubes of samples shows a typical S-shaped amplification curve and the Ct value is ≤37, it means that the sample extraction is qualified.

[0101] The target channel is determined based on the Ct value in Table 1.

[0102] The present invention finds that the amplification reagent, positive control and negative control are freeze-dried powders obtained by freeze-drying the liquid amplification reagent and the positive and negative control products. Specifically, the freeze-drying procedure includes the following:

[0103] S1: pre-freeze;

[0104] S1.1: Temperature: 4℃; Duration: 30min; State: Hold; Pressure: 1atm;

[0105] S1.2: Temperature: -50℃; Duration: 1℃ / min; State: Cooling; Pressure: 1atm;

[0106] S1.3: Temperature: -50℃; Duration: 180min; State: Hold; Pressure: 1atm;

[0107] S2: one sublimation;

[0108] S2.1: Temperature: -40℃; Duration: 1℃ / min; State: Heating; Pressure: Extreme vacuum;

[0109] S2.2: Temperature: -40℃; Duration: 720min; State: Hold; Pressure: Extreme vacuum;

[0110] S3: secondary sublimation;

[0111] S3.1: Temperature: 25℃; Duration: 1℃ / min; State: Heating; Pressure: Ultimate vacuum;

[0112] S3.2: Temperature: 25°C; Duration: 300 min; State: Hold; Pressure: Extreme vacuum.

[0113] The freeze-drying procedure is shown in Table 9;

[0114] Table 9 Freeze-drying procedure

[0115]

[0116]

[0117] The liquid amplification reagent includes: reaction premix, enzyme; 1 μL each of the upstream and downstream primers (final concentration 0.2 μM) and probe (final concentration 0.1 μM), and enzyme-free water is added to make up the volume to 25 μL.

[0118] The positive control is shown in Table 10;

[0119] Table 10 Positive quality control group composition

[0120] Reference substance name Part Number Target concentration HeLa cells ZQ0068 <![CDATA[10 6 cells / ml]]> Siha cells ZQ0129 <![CDATA[10 6 cells / ml]]>

[0121] The reaction procedures used in steps S3 and S4 are shown in Table 5.

[0122] 4. Detection kits for 7 types of HPV DNA / mRNA that can be applied to POCT detection platforms

[0123] Based on the preparation of the primer and probe combination, the reference substance and the detection method described in this example, the present invention also constructs a detection kit for the seven types of HPV DNA / mRNA that can be applied to the POCT detection platform, and the kit contains the primer and probe combination (as shown in Table 8) and the lyophilized reagents required for qPCR and RT-qPCR reactions (as shown in Tables 4-5). The reagents required for the qPCR and RT-qPCR reactions are obtained by lyophilizing the liquid reagents according to the lyophilization procedure in Table 7.

[0124] The freeze-dried reagents required for the qPCR and RT-qPCR reactions include the primer and probe combination, a reaction premix and an enzyme, wherein the reaction premix contains a reverse transcription buffer, a PCR reaction buffer and dNTPs.

[0125] The positive control substances were two kinds of cells (shown in Table 10), and the negative control substance was sterile water. Specific embodiment 3:

[0127] Analysis of the detection performance of the kit: The present invention tested the detection specificity of the detection kit for 7 types of HPV DNA / mRNA that can be applied to the POCT detection platform described in Example 2.

[0128] Specificity test:

[0129] (1) HPV types outside the test kit detection range

[0130] The present invention selected 1 HPV68 DNA / mRNA positive clinical sample and 4 DNA positive mRNA negative samples, wherein the corresponding DNA positive types were: HPV6, HPV11, HPV35 and HPV68, and the samples were tested using the method described in Example 2. The results are as follows: Figure 2-6 As shown by Figure 2-6 It can be seen that the present invention has negative detection results for samples with positive HPV type DNA / mRNA outside the detection range of the kit, and negative detection results for samples with positive HPV type DNA but negative mRNA outside the detection range of the kit, indicating that its detection specificity is good.

[0131] (2) HPV types within the test kit detection range

[0132] The present invention selected 7 clinical samples with positive DNA and negative mRNA of HPV16, HPV18, HPV31, HPV33, HPV45, HPV52, and HPV58; and 1 clinical sample with positive DNA / mRNA of HPV16 and HPV58. After the sample was processed, the method described in Example 2 was used for detection, and the detection results of each channel were observed. The clinical samples with positive DNA and negative mRNA of HPV16, HPV18, HPV31, HPV33, HPV45, HPV52, and HPV58 were tested by the method described in Example 2. Figures 7 to 13 .Depend on Figures 7 to 13 As shown in the test results, both C1 and C2 tubes generate ROX (internal standard) channel signals and target channel signals, and ΔCT of the two tubes = (CTA1-CTB1)-(CTA2-CTB2) < 3, which indicates that the above samples are DNA positive and mRNA negative, which is consistent with the clinical test results; the HPV16 and HPV58 DNA / mRNA positive clinical samples were tested by the method described in Example 2, and the results are as follows Figures 14-15 .Depend on Fig.14 The test results show that both C1 and C2 tubes produce ROX (internal standard) channel signals and FAM (target channel) signals, and the ΔCT of the two tubes is (CTA1-CTB1)-(CTA2-CTB2)=3.3, which indicates that the sample is HPV16 type DNA / mRNA positive, which is consistent with the clinical test results. Fig.15 From the test results shown, it can be seen that both C1 and C2 tubes generate ROX (internal standard) channel signals and CY5 (target channel) signals, and the △CT of the two tubes is (CTA1-CTB1)-(CTA2-CTB2)=9.97, which indicates that the sample belongs to a HPV31 / 33 / 45 / 52 / 58 type DNA / mRNA positive clinical sample, which is consistent with the clinical test results; indicating that the kit described in the present invention has good specificity.

[0133] The specific embodiments are merely explanations of the present invention and are not limitations of the present invention. After reading this specification, those skilled in the art may make modifications to the embodiments without any creative contribution as needed. However, such modifications are protected by the patent law as long as they are within the scope of the claims of the present invention.

Claims

1. A multiplex PCR primer and probe combination for detecting DNA / mRNA of the E6 / E7 region of seven high-risk human papillomaviruses, characterized in that: The components include: Component 1: Primers and probes for detecting HPV 16 E6 / E7 region DNA / mRNA; Component 2: Primers and probes for detecting HPV 18 E6 / E7 region DNA / mRNA; Component 3: Primers and probes for detecting HPV 31E6 / E7 region DNA / mRNA; Component 4: Primers and probes for detecting DNA / mRNA of the HPV 33 / 52 / 58E6 / E7 region; Component 5: primers and probes for detecting HPV 45E6 / E7 region DNA / mRNA; Component 6: DNA / mRNA primers and probes for detection of the internal reference β-globin.

2. A multiplex PCR primer and probe combination for detecting DNA / mRNA of the E6 / E7 region of seven high-risk human papillomaviruses, characterized in that: The component 1 includes an upstream primer HPV16-F sequence: AATGTTTTCAGGACCCACAGG; a downstream primer HPV16-R sequence: GTTGCTTGCAGTACACACATTC; a probe HPV16-P sequence, the 5' end of the probe is labeled with a FAM fluorescent group, and the 3' end is labeled with an MGB quenching fluorescent group, and the HPV16-P sequence is: ACCACAGTTATGCACAGAGCTGCA; The component 2 includes an upstream primer HPV18-F sequence: ACCCTACAAGCTACCTGATCT; a downstream primer HPV18-R sequence: ACCTCTGTAAGTTCCAATACTGTC; a probe HPV18-P sequence, the 5' end of the probe is labeled with a VIC fluorescent group, and the 3' end is labeled with an MGB quenching fluorescent group, and the HPV18-P sequence is: ACGGAACTGAACACTTCACTGCAAGA; The component 3 includes an upstream primer HPV58-F sequence: CGTGTCAAAGACCGTTGTGT; a downstream primer HPV58-R sequence: CGAGGTCTTCTCCAACATGC; a probe HPV58-P sequence, the 5' end of the probe is labeled with a CY5 fluorescent group, and the 3' end is labeled with a BHQ3 quenching fluorescent group, and the HPV58-P sequence is: TGCAACGTCCTGTCCACCTTCCTCC; The component 4 includes a first upstream primer HPV33 / 52 / 58-F1 sequence: CGTGTCAAAGACCGTTGTGT; a second upstream primer HPV33 / 52 / 58-F2 sequence: TGTCAAAgACCtTTGTGTCC; a downstream primer HPV33 / 52 / 58-R sequence: GTCGGGaTCTCCAACAC; a probe HPV33 / 52 / 58-P sequence, the 5' end of the probe is labeled with a CY5 fluorescent group, and the 3' end is labeled with a BHQ3 quenching fluorescent group, and the HPV33 / 52 / 58-P sequence is: CAGCGCCCTGTCCAACGACCC; The component 5 includes an upstream primer HPV45-F sequence: GATGAAgCAGATGGAGTTA; a downstream primer HPV45-F sequence: GCAACCACGGACACACAAAGGA; a probe HPV45-P sequence, the 5' end of the probe is labeled with a CY5 fluorescent group, and the 3' end is labeled with a BHQ3 quenching fluorescent group, and the HPV45-F sequence is: GAACCACAGCGTCACAA; The component 6 includes an upstream primer β-globin-F sequence: GACTCTCTCTGCCTATTGGTCTATT; a downstream primer β-globin-R sequence: CCCATAACAGCATCAGGAGTG; a probe β-globin-P sequence, wherein the 5' end of the probe is labeled with a ROX fluorescent group and the 3' end is labeled with a MGB quenching fluorescent group, and the β-globin-P sequence is: CAGATCCCCAAAGGACTCAAAGAACC.

3. A method for detecting DNA / mRNA in the E6 / E7 region of seven high-risk human papillomaviruses based on a POCT detection platform, characterized in that: The steps include: S1. Sample collection: sampling by cervical swab; S2. Sample processing: Mix the cervical swab and sample processing solution thoroughly in tube A; S3. Nucleic acid release agent treatment: Take out 100 μL of the mixed solution from tube A and mix it with 100 μL of nucleic acid release agent in tube B and shake well; S4. Control substance detection: Dissolve the positive control substance with 60 μL of enzyme-free water, take 25 μL of the solution and transfer it to the corresponding detection tubes C1 and C2 to dissolve the lyophilized reagent and transfer it to the corresponding reaction tubes for amplification; use 25 μL of blank control substance solution to directly dissolve the lyophilized reagent and transfer it to the corresponding reaction tubes for amplification and quality control; S5. Sample detection: Using the sample obtained in step S3 as a template, take 25 μL of each and directly put it into the freeze-dried reagent of the C1 and C2 detection tubes of the present invention for dissolution, transfer the above solutions to the corresponding reaction tubes for amplification, and judge the results by the Ct value.

4. A method for detecting DNA / mRNA in the E6 / E7 region of seven high-risk human papillomaviruses based on a POCT detection platform according to claim 3, characterized in that: The specific operation flow of step S5 is as follows: take 2 equal volumes of the sample to be tested and respectively test them in C1 tube and C2 reaction tube, wherein the reaction systems of C1 and C2 reaction tubes are the same, C1 tube adopts qPCR reaction program, and C2 tube adopts RT-qPCR reaction program, the CTA1 value of the target obtained by the detection of C1 tube can reflect the content of HPV DNA, and the CTA2 value of the internal standard can reflect the content of cells in C1 tube; the CTB1 value of the target obtained by the detection of C2 tube can reflect the total content of HPV DNA and mDNA, and the CTB2 value of the internal standard can reflect the content of cells in C2 tube, △CT = (CTA1-CTB1)-(CTA2-CTB2).

5. A method for detecting DNA / mRNA in the E6 / E7 region of seven high-risk human papillomaviruses based on a POCT detection platform according to claim 4, characterized in that: The reaction system of tube A and tube B includes: freeze-dried reagent C1, freeze-dried reagent C2, freeze-dried protective agent, HPV16 / 18 positive cell control and negative cell control.

6. A method for detecting DNA / mRNA in the E6 / E7 region of seven high-risk human papillomaviruses based on a POCT detection platform according to claim 5, characterized in that: The preparation procedures of the lyophilized reagent A and the lyophilized reagent B are as follows: S1: pre-freeze; S1.1: Temperature: 4°C; Duration: 30min; State: Hold; Pressure: 1atm; S1.2: Temperature: -50℃; Duration: 1℃ / min; Status: Cooling; Pressure: 1atm; S1.3: Temperature: -50°C; Duration: 180min; Status: Hold; Pressure: 1atm; S2: one sublimation; S2.1: Temperature: -40°C; Duration: 1℃ / min; Status: Heating; Pressure: Ultimate vacuum; S2.2: Temperature: -40°C; Duration: 720min; Status: Hold; Pressure: Ultimate vacuum; S3: secondary sublimation; S3.1: Temperature: 25°C; Duration: 1℃ / min; Status: Heating; Pressure: Ultimate vacuum; S3.2: Temperature: 25℃; Duration: 300min; Status: Hold; Pressure: Ultimate vacuum.

7. A kit for detecting DNA / mRNA of seven high-risk HPV E6 / E7 regions, characterized in that: The kit contains the primer and probe combination as described in claim 1, and the seven high-risk HPV DNA / mRNA detected by the kit specifically include: HPV16, HPV18, HPV 31, HPV 33, HPV45, HPV52, and HPV58.

Images