Primer and Taqman probe combination for detecting pathogenic tick-borne virus and detection method

Abstract

The invention discloses a primer and Taqman probe combination for detecting pathogenic tick-borne viruses and a detection method, and the primer and Taqman probe combination for detecting the pathogenic tick-borne viruses comprises the following steps: (1) detecting six viruses such as an Alongshan virus (ALSV), a forest encephalitis virus (TBEV), a severe fever with thrombocytopenia syndrome virus (SFTSV), a Songling virus (SGLV), a BJNV and a Yezo virus (Yezo virus, YEZV) and the like, and (2) detecting the six viruses such as the Alongshan virus, the TBEV, the SFTSV, the Songling virus, the SGLV, the BJNV and the Yezo virus. Each primer pair comprises an upstream primer F, a downstream primer R and a Taqman probe. According to the application, common pathogenic virus ALSV, TBEV, SFTSV, SGLV, BJNV and YEZV virus seeds in northeast China are respectively detected by using Taqman probe detection through fluorescent quantitative PCR, a rapid and accurate virus diagnosis and detection method is developed, and viral tick-borne diseases are scientifically prevented and treated.

Description

Technical Field

[0001] The invention relates to the field of biotechnology, and in particular to a primer and Taqman probe combination for detecting pathogenic tick-borne viruses and a detection method. Background Art

[0002] Northeast my country has a vast territory and a high forest coverage rate, which provides an ideal living environment for ticks. Ticks are external blood-sucking arthropods that can transmit hundreds of pathogens including viruses, bacteria and parasites. They are vector hosts of many pathogens, posing a serious threat to national biosecurity and people's life and health. Among the many tick-borne diseases, viral tick-borne diseases are the most serious and can cause hemorrhagic fever, encephalitis and other diseases in patients bitten by ticks. At present, the known pathogenic tick-borne viruses in Northeast China include Alongshan virus (ALSV), Tick-borne encephalitis virus (TBEV), Severe fever with thrombocytopenia syndrome virus (SFTSV), Songling virus (SGLV), Beiji nairovirus (BJNV) and Yezo virus (YEZV). Except for TBEV and SFTSV, the other four viruses are new pathogens and lack effective rapid detection methods.

[0003] Currently, there is an urgent need for an effective detection method that can simultaneously detect these six tick-borne viruses prevalent in Northeast China. Summary of the invention

[0004] The technical problem to be solved by the present invention is to provide a primer and Taqman probe combination and a detection method for detecting pathogenic tick-borne viruses, which provides a basis for scientifically preventing and controlling tick-borne virus-related diseases.

[0005] The technical problem to be solved by the present invention is achieved through the following technical solutions:

[0006] A primer and Taqman probe combination for detecting pathogenic tick-borne viruses, the primer and Taqman probe combination comprising:

[0007] (1) Primer pair for detecting ALSV virus: upstream primer F: GCTTGTGGTCATCATYATG (SEQ ID NO.1); downstream primer R: CTCTGCCACATRCTGAWG (SEQ ID NO.2); Taqman probe: CTCTCGTCRGCYATACCRCCA (SEQ ID NO.3);

[0008] (2) Primer pair for detecting TBEV virus: upstream primer F: CGTGTCATAGAYGGRMGA (SEQ ID NO. 4); downstream primer R: CACTGYCCAGAGTATATGTA (SEQ ID NO. 5); Taqman probe: CTGTTCTTCCTTCYTGTCTTCCGA (SEQ ID NO. 6);

[0009] (3) Primer pair for detecting SFTSV virus: upstream primer F: GAGTCTAGGTCATCTGATC (SEQ ID NO.7); downstream primer R: CYGTCTCTGTCTTTATGTAAG (SEQ ID NO.8); Taqman probe: AGCAATGACAGAYGCCTTCCA (SEQ ID NO.9);

[0010] (4) Primer pair for detecting SGLV virus: upstream primer F: AGATTGTGCATGCTGCRTC (SEQ ID NO.10); downstream primer R: GTTTGTAAGATGCTTTCTTT (SEQ ID NO.11); Taqman probe: YCAAYGATGATGGTTTGACCAACCAACA (SEQ ID NO.12);

[0011] (5) Primer pair for detecting BJNV virus: upstream primer F: TCACCAGTTCCTACTACG (SEQ ID NO.13); downstream primer R: GGACAACCTCAACATTCA (SEQ ID NO.14); Taqman probe: ACACTCACAACCTGTCHGGCA (SEQ ID NO.15);

[0012] (6) Primer pair for detecting YEZV virus: upstream primer F: GACTGGATCYTGACTAAATG (SEQ ID NO.16); downstream primer R: RACTGATATGCCTCCTAG (SEQ ID NO.17); Taqman probe: ACGGAMTATGCCAGGACAACA (SEQ ID NO.18);

[0013] Among them, Y represents the base C or T; R represents the base A or G, W represents the base A or T, and M represents the base A or C.

[0014] Preferably, in the above technical solution, the 5' end of the probe of the ALSV virus, the TBEV virus, the SFTSV virus, the SGLV virus, the BJNV virus and the YEZV virus is labeled with a FAM fluorescent group, and the 3' end is labeled with a BHQ1 quenching group.

[0015] A kit for detecting pathogenic tick-borne viruses for non-disease diagnosis purposes, the kit comprising the above-mentioned primer and Taqman probe combination.

[0016] The use of primer and Taqman probe combinations or kits in the detection of pathogenic tick-borne viruses for non-disease diagnosis purposes.

[0017] A method for detecting pathogenic tick-borne viruses for non-disease diagnosis purposes, comprising the following steps:

[0018] (1) Preparation of primers and Taqman probes: Based on the conserved gene-related sequences of ALSV, TBEV, SFTSV, SGLV, BJNV and YEZV, a primer and Taqman probe combination as described in any one of claims 1 to 2 is designed;

[0019] (2) Sample preparation: extracting total RNA from the virus sample to be tested;

[0020] (3) RNA reverse transcription: reverse transcription of the extracted RNA into cDNA;

[0021] (4) Fluorescence quantitative RT-PCR reaction: using the specific primers and Taqman probes of step (1) to perform PCR amplification and monitor the fluorescence signal in real time;

[0022] (5) Result analysis and judgment: Determine whether the sample contains the target virus based on the Ct value of the fluorescent signal. If there is no Ct value or the Ct value is greater than 40, it is negative. If the Ct value is 37-40, it is a suspected positive sample and needs to be tested again. If the Ct value is less than 37, the nucleic acid result is positive.

[0023] Preferably, in the above technical solution, step (3) comprises:

[0024] (a) Setting of PCR amplification conditions;

[0025] (b) Execution of agarose gel electrophoresis;

[0026] (c) purification and recovery of target gene fragments;

[0027] (d) ligation and transformation of gene fragments and vectors;

[0028] (e) Calculation of the copy number of the standard;

[0029] (f) Establishment of standard curve of TaqMan fluorescence quantitative RT-PCR method.

[0030] Preferably, in the above technical solution, in step (a), the PCR amplification conditions are: the initial denaturation step is performed at 94°C for 4 minutes; the cycle includes denaturation at 94°C for 60 seconds, annealing at 55°C for 30 seconds, and extension at 72°C for 60 seconds, for a total of 30 cycles; and finally extension is performed at 72°C for 5 minutes.

[0031] Preferably, in the above technical solution, in step (a), in a 25 μL PCR reaction system, the substances are composed of: 1 μL upstream primer, 1 μL downstream primer; 2 μL cDNA template; 8.5 μL RNase-Free H2O, 12.5 μL 2xTaq mix.

[0032] Preferably, in the above technical solution, in step (f), the establishment of the standard curve of the TaqMan fluorescent quantitative RT-PCR method includes: performing a 10-fold gradient dilution of the plasmid standard; performing TaqMan fluorescent quantitative PCR amplification using the diluted standard as a template; and drawing a standard curve with the logarithm of the starting template concentration as the horizontal axis and the Ct value as the vertical axis.

[0033] The above technical solution of the present invention has the following beneficial effects:

[0034] This application uses fluorescent quantitative PCR and Taqman probes to detect the common pathogenic viruses ALSV, TBEV, SFTSV, SGLV, BJNV and YEZV strains in Northeast China, develops a rapid and accurate method for diagnosing and detecting viruses, and scientifically prevents and treats tick-borne virus-related diseases. BRIEF DESCRIPTION OF THE DRAWINGS

[0035] The accompanying drawings, which are incorporated in and constitute a part of the specification, illustrate embodiments of the invention and, together with the description, serve to explain the principles of the invention.

[0036] Figure 1 Are the target gene amplification results, including: M.DL 2000Marker; A.ALSV; B.SFTSV; C.TBEV; D.SGLV; E.BJNV; F.YEZV.

[0037] Figure 2 This is a Taqman probe fluorescence quantitative PCR amplification curve, where: A. ALSV; B. TBEV; C. SFTSV; D. BJNV; E. YEZV; F. SGLV.

[0038] Figure 3It is the specific test result of Taqman probe fluorescence quantitative PCR method, where: 1 represents the standard positive plasmid of six viruses AF; 2-6 represent the other five viruses except the positive plasmid; 7 represents the negative control.

[0039] Figure 4 It is a Taqman probe fluorescence quantitative PCR method for clinical sample detection. DETAILED DESCRIPTION

[0040] Various exemplary embodiments of the present invention will now be described in detail with reference to the accompanying drawings. It should be noted that the relative arrangement of components and steps, numerical expressions and numerical values ​​set forth in these embodiments do not limit the scope of the present invention unless otherwise specifically stated.

[0041] Unless otherwise specified, the reagents used in this application are all commercially available or obtained through commercial channels, or can be prepared by referring to existing chemical methods.

[0042] The six viruses involved in this application are as follows: Alongshan virus (ALSV), forest encephalitis virus (TBEV), fever with thrombocytopenia syndrome virus (SFTSV), Songling virus (SGLV), Arctic Nairo virus (BJNV), Yezo virus (YEZV). The above viruses are all tick-borne viruses prevalent in Northeast China.

[0043] Example 1 Primer design and synthesis

[0044] According to the conserved gene-related sequences of ALSV, TBEV, SFTSV, SGLV, BJNV and YEZV in Northeast China published on NCBI, after using the Alignment homology analysis in MEGA-X software, the conserved segments were selected and specific primers and probes were designed by Beacon Designer 8 program, probes 5'-FAM, 3'-BHQ1, and specific analysis and verification were performed by Blast on the NCBI website. The primer and probe sequences were synthesized by Jiangsu Jinweizhi Biotechnology Co., Ltd., as shown in Table 1 below. Specifically:

[0045] (1) Primer pairs for detecting ALSV:

[0046] Upstream primer F: GCTTGTGGTCATCATYATG (SEQ ID NO. 1);

[0047] Downstream primer R: CTCTGCCACATRCTGAWG (SEQ ID NO. 2);

[0048] Probe: CTCTCGTCRGCYATACCRCCA (SEQ ID NO. 3);

[0049] (2) Primer pairs for detecting TBEV:

[0050] Upstream primer F: CGTGTCATAGAYGGRMGA (SEQ ID NO. 4);

[0051] Downstream primer R: CACTGYCCAGAGTATATGTA (SEQ ID NO. 5);

[0052] Probe: CTGTTCTTCCTTCYTGTCTTCCGA (SEQ ID NO. 6);

[0053] (3) Primer pairs for detecting SFTSV:

[0054] Upstream primer F: GAGTCTAGGTCATCTGATC (SEQ ID NO. 7);

[0055] Downstream primer R: CYGTCTCTGTCTTTATGTAAG (SEQ ID NO. 8);

[0056] Probe: AGCAATGACAGAYGCCTTCCA (SEQ ID NO. 9);

[0057] (4) Primer pair for detecting SGLV:

[0058] Upstream primer F: AGATTGTGCATGCTGCRTC (SEQ ID NO. 10);

[0059] Downstream primer R: GTTTGTAAGATGCTTTCTTT (SEQ ID NO. 11);

[0060] Probe: YCAAYGATGATGGTTTGACCAACCAACA (SEQ ID NO. 12); wherein Y is a degenerate base, representing base C or A, and R is a degenerate base, representing base A or G;

[0061] (5) Primer pairs for detecting BJNV:

[0062] Upstream primer F: TCACCAGTTCCTACTACG (SEQ ID NO. 13);

[0063] Downstream primer R: GGACAACCTCAACATTCA (SEQ ID NO. 14);

[0064] Probe: ACACTCACAACCTGTCHGGCA (SEQ ID NO. 15);

[0065] (6) Primer pairs for detecting YEZV:

[0066] Upstream primer F: GACTGGATCYTGACTAAATG (SEQ ID NO. 16);

[0067] Downstream primer R: RACTGATATGCCTCCTAG (SEQ ID NO. 17); probe: ACGGAMTATGCCAGGACAACA (SEQ ID NO. 18).

[0068] Table 1. Primers and probes for qPCR.

[0069]

[0070]

[0071]

[0072]

[0073]

[0074]

[0075]

[0076] Example 2 Viral RNA Extraction

[0077] Extract total viral RNA according to the instructions of Tiangen Virus RNA Extraction Kit. Take 200μL of purified ALSV, TBEV, SFTSV, SGLV, BJNV and YEZV virus solution and put it into a sterile 1.5mL centrifuge tube, then add 20μL Proteinase K and 200μL Binding Buffer solution, vortex mix for 20s, and incubate in a 56℃ water bath for 15min; add 250μL of anhydrous ethanol, vortex mix for 15s, and let stand at room temperature for 5min; transfer the solution and precipitate to the centrifuge column, centrifuge at 12000×g for 60s, discard the effluent, add 500μL Wash Buffer to the centrifuge column, centrifuge at 12000×g for 1min, and discard the effluent. Repeat this operation once; transfer the centrifuge column to a new RNase-free 1.5 mL centrifuge tube, add 50 μL of RNase-free triple distilled water to the middle of the centrifuge column, and place it at room temperature for 60 seconds; centrifuge at 12000×g for 60 seconds at room temperature, and then elute the RNA. After the RNA concentration is qualified, store it at -80℃.

[0078] Example 3 Reverse transcription of viral RNA into cDNA

[0079] The cDNA chain was synthesized according to the instructions of the TaKaRa reverse transcription kit. The system is shown in Table 2. After the preparation of solution I, incubate at 42°C in a water bath for 2 minutes, add solution II, perform reverse transcription at 37°C for 25 minutes, inactivate at 85°C for 5 seconds, and store at -20°C for later use.

[0080] Tab.2 The reaction system of RT-PCR

[0081]

[0082] Example 4 Preparation of Tick-borne Virus Fluorescence Quantitative RT-PCR Standards

[0083] (I) Amplification conditions and procedures of PCR method:

[0084] In order to obtain the conserved gene fragments of ALSV, TBEV, SFTSV, SGLV, BJNV and YEZV, PCR amplification was performed according to the reaction system in Table 3 and the primers in Table 4.

[0085] The reaction conditions were as follows: 94°C for 4 min; 94°C for 60 s, 55°C for 30 s, 72°C for 60 s, 30 cycles; 72°C for 5 min, and stored at 4°C.

[0086] Tab.3PCR reaction system

[0087]

[0088] Table 4. PCR primers Table 1. Primers for PCR

[0089]

[0090] (ii) Agarose gel electrophoresis:

[0091] Weigh 0.30g agarose, add 30mL TAE buffer, heat in a microwave and shake from time to time until the agarose is completely melted to prepare 0.8% agarose gel. Cool to about 60°C at room temperature, add 3μL of GelStain nucleic acid dye, mix thoroughly, and slowly pour into the gel plate with a comb. The gel thickness is about 3-5mm. After the gel is completely solidified, gently pull out the comb, take out the gel block, put it into the electrophoresis tank, add TAE electrophoresis buffer to the tank to exceed the gel surface, and remove the bubbles in the sample well. Then, use a micropipette to draw 4μL of liquid from the PCR product, mix it with 5× Loading Buffer, carefully put it into the sample well, and cover the electrophoresis tank lid. Adjust the voltage to 120V and electrophoresis for 20-30min. Then take out the gel and place it in the gel imaging system to observe the results.

[0092] (III) Purification and recovery of target gene fragments:

[0093] The PCR product was electrophoresed on a 0.8% agarose gel. The position of the target gene 3CA was determined according to the expected molecular weight. After 30 minutes of electrophoresis at a voltage of 100V, the gel was taken out and placed under ultraviolet light. The gel blocks containing the target gene (3CA) were cut out with a clean surgical blade, chopped and placed in a 2mL EP tube, and the target gene was recovered and purified using the Tiangen gel recovery kit. 3 times the volume of the gel was added to the EP tube. After fully mixing, it was heated at 50°C until the gel block was completely melted. The above mixture was transferred to the DNA preparation tube. After centrifugation at a speed of 12000×g for 60S, the filtrate was discarded, 500μL Buffer W1 solution was added, the filtrate was discarded after centrifugation, and 700μL Buffer W1 was added. After centrifugation at 12000×g for 30S, the filtrate was discarded. After washing with Buffer W1 solution, an appropriate amount of RNase-free water was added to the prepared membrane and allowed to stand at room temperature for 1min. Then, the mixture was centrifuged at 12000×g for 60 seconds to elute the target gene fragment.

[0094] (IV) Ligation and transformation of gene fragment 3CA and vector pMD18-T:

[0095] The recovered gene fragments were added to the components according to Table 5 using T4 ligase to carry out ligation reaction. The reaction conditions were 16° C. for 2 h.

[0096] Transform the above ligation products into Trans-T1 competent cell culture, add 5 μL of ligation products to 50 μL competent cells melted in an ice bath, ice bath for 30 minutes, heat shock at 42°C for 30 seconds, ice bath for 2 minutes, take a new 1.5 mL centrifuge tube, add 500 μL of non-resistant LB liquid culture medium to the tube, put it in a 37°C shaker, 200 rpm, centrifuge at 4000 rpm for 3 minutes after 1 hour, retain 200 μL of supernatant, blow and mix, take 100 μL and spread it on LB solid culture medium containing ampicillin resistance, invert and place it in a 37°C incubator for 12 hours. Pick a single colony in 5 mL of LB liquid culture medium containing ampicillin resistance, shake and culture at 200 rpm at 37°C for 12-16 hours, and perform bacterial liquid PCR identification, reaction system: Premix Taq TM 12.5μL, ddH2O8.5μL, M13-F / M13-R 1μL each, bacterial solution 2μL, total system 25μL. Reaction conditions: 94℃ pre-denaturation 5min, 94℃ denaturation 30s, 48-52℃ (set 5 annealing temperatures for gradient PCR) 30s, 72℃ extension 30s (30 cycles), 72℃ extension 5min, 4℃ end reaction.

[0097] After bacterial liquid PCR identification, positive samples were selected and plasmid DNA was extracted using a plasmid extraction kit. The plasmid extraction steps are as follows:

[0098] (1) Preparation: Add RNase A to Buffer S1 and add anhydrous ethanol to Buffer W2.

[0099] (2) Take 4 mL of bacterial culture cultured overnight in LB medium, centrifuge at 12000 rpm for 1 min, and discard the supernatant.

[0100] (3) Add 250 μL of Buffer S1 and use a vortex oscillator to evenly suspend the bacterial precipitate until the bacterial mass is completely dissolved.

[0101] (4) Add 250 μL of Buffer S2 and gently invert the tube 4-6 times to mix until a clear solution is formed. This step should be completed within 5 minutes.

[0102] (5) Add 350 μL of Buffer S3, mix gently and thoroughly by inverting up and down 6-8 times, and centrifuge at 12,000 rpm for 10 min.

[0103] (6) The supernatant in step 5 was aspirated and transferred to an adsorption column. The mixture was centrifuged at 12,000 rpm for 1 min and the filtrate was discarded.

[0104] (7) Place the adsorption column back into the centrifuge tube, add 500 μL Buffer W1, centrifuge at 12,000 rpm for 1 min, and discard the filtrate.

[0105] (8) Place the adsorption column back into the centrifuge tube, add 700 μL of Buffer W2, centrifuge at 12,000 rpm for 1 min, and discard the filtrate.

[0106] (9) Repeat step (8).

[0107] (10) Place the adsorption column back into a 2 ml centrifuge tube and centrifuge at 12,000 rpm for 1 min.

[0108] (11) The adsorption column was transferred to a new 1.5 mL centrifuge tube, and 60 μL of 65°C preheated Eluent was added to the center of the adsorption column membrane. The tube was allowed to stand at room temperature for 1 min and then centrifuged at 12,000 rpm for 1 min.

[0109] (V) Calculation of the number of copies of the standard

[0110] The collected plasmids were measured for concentration and purity using a NanoDrop2000 ultra-micro spectrophotometer and sent to Shanghai Shenggong Biotechnology Technology Service Co., Ltd. for sequencing. The correct recombinant plasmid was selected based on the sequence analysis results, and the formula for calculating the copy number of the positive recombinant plasmid was as follows:

[0111] Y (copies / μL) = plasmid concentration (ng / μL) × 6.02 × 10 14 / (plasmid length × 660)

[0112] (VI) Establishment of standard curve for TaqMan fluorescence quantitative RT-PCR method:

[0113] The plasmid standard was diluted 10-fold in sequence to 1×10 1 Copy ~ 1×10 8 8 concentrations of copies / μL, 8 dilutions of standard samples were used as templates, and the reaction system was as follows: Premix Ex Taq (Probe qPCR) 12.5μL, ddH2O 7.4μL, upstream / downstream primers 0.4μL each (10μM), probe 0.8μL (10μM), cDNA template 1μL, total system 20μL; reaction conditions: pre-denaturation at 95℃ for 30s; denaturation at 95℃ for 5s, annealing at 60℃ for 30s, and TaqMan fluorescence quantitative PCR amplification for 50 cycles, 3 replicates were set for each dilution, a negative control was set, and the logarithm of the starting template concentration was used as the horizontal axis, and the cycle threshold value (Ct value) of fluorescence was used as the vertical axis to draw a standard curve.

[0114] If there is no Ct value or the Ct value is greater than 40, it is negative. If the Ct value is 37-40, it is a suspected positive sample and needs to be tested again. If the Ct value is less than 37, the nucleic acid result is positive.

[0115] (VII) Specificity test of TaqMan fluorescent quantitative RT-PCR method:

[0116] Real-time fluorescence quantitative PCR was performed using ALSV, TBEV, SFTSV, SGLV, BJNV and YEZV standard plasmids as positive control templates, cDNAs of the other five viruses as detection templates, and water as a negative control according to the above reaction conditions to verify the specificity of the method.

[0117] (VIII) Sensitivity test of TaqMan fluorescent quantitative RT-PCR method:

[0118] The positive plasmid standard was serially diluted to 1.0×10n copies / μL. 8 , 1.0×10 7 , 1.0×10 6 , 1.0×10 5 , 1.0×10 4 , 1.0×10 3 , 1.0×10 2 , 1.0×10 1 Plasmids with 8 different copy numbers / μL were used as templates for real-time fluorescence quantitative RT-PCR detection to determine the lowest copy number for the detection.

[0119] (IX) Repeatability test of fluorescence quantitative RT-PCR detection method:

[0120] To evaluate the stability and repeatability of the detection method, a standard plasmid 10 3 Up to 10 6 The copies / μL were used as templates, and the intra-batch and inter-batch tests were repeated 5 times. The coefficient of variation was calculated based on the Ct value to test the stability and repeatability of the detection method.

[0121] (10) Clinical sample testing:

[0122] Total RNA was extracted from 20 clinical suspected samples stored in the laboratory, and cDNA was reverse transcribed. The Taqman probe real-time quantitative RT-PCR method and the common semi-nested PCR method established in this experiment were used for detection, and the results were compared to determine the practicality of this method.

[0123] result:

[0124] (1) RT-PCR amplification results of target genes of tick-borne viruses

[0125] Using the reverse transcribed cDNA of ALSV, TBEV, SFTSV, SGLV, BJNV and YEZV as templates, PCR amplification was performed using the designed specific primers. The products were subjected to 0.8% agarose gel electrophoresis, and target bands of corresponding sizes were observed, which were consistent with the theoretical values. Figure 1 AF diagram shown.

[0126] (2) Identification results of standard plasmid pMD 18T-tick-borne virus gene

[0127] The pMD18-T vector connected with ALSV, TBEV, SFTSV, SGLV, BJNV and YEZV gene fragments was prepared and the plasmid was extracted, and double restriction enzyme digestion and sequencing were performed. The sequencing results were compared by BLAST, showing that the homology of the target genes of ALSV, TBEV, SFTSV, SGLV, BJNV and YEZV with the sequences on GeneBank was more than 99%, indicating that the required gene fragments were successfully obtained.

[0128] (3) Calculation results of standard plasmid copy number

[0129] The concentration of the standard pMD18T-gene plasmid connected with ALSV, TBEV, SFTSV, SGLV, BJNV and YEZV gene fragments was measured by Eppendrof nucleic acid-protein analyzer. The TBEV value was 59.41 ng / μL and the copy number was 1.79×10 10 The ALSV value was 84.1 ng / μL, and the copy number was 2.58×10 10 The SFTSV value was 126.3 ng / μL, and the copy number was 3.8×10 10 The copy number / μL, SGLV value was 77.94ng / μL, and the copy number was 2.18×10 10 The copy number / μL, the YEZV value was 122.59 ng / μL, and the copy number was 3.71×10 10 The copy number / μL, BJNV value was 127.51ng / μL, and the copy number was 3.98×10 10 Copy number / μL, dilute the plasmid to 1×10 9 Up to 1×10 0 The number of copies / μL was 10 gradients, used as standard positive templates, and stored at -20°C for future use.

[0130] (4) Results of drawing the standard curve of Taqman probe fluorescence quantitative RT-PCR

[0131] Select 2.58×10 1 to 2.58×10 8The ALSV positive recombinant plasmid with different copy number / μL concentration gradient was used as template for fluorescence quantitative PCR reaction, and the standard curve was generated. Figure 2 Figure A. The correlation coefficient R corresponding to the standard curve 2 The value is 0.997, the slope value is -4.11, the intercept value is 49.41, and the standard curve regression equation is Y=-4.11X+49.41.

[0132] Select 3.98×10 1 to 3.98×10 8 The BJNV positive recombinant plasmid with a concentration gradient of copy number / μL was used as a template for fluorescence quantitative PCR reaction, and the standard curve generated was shown in Figure 2 Figure B. The correlation coefficient R corresponding to the standard curve 2 The value is 0.997, the slope value is -3.85, the intercept value is 43.98, and the standard curve regression equation is Y=-3.85X+43.98.

[0133] Select 3.8×10 1 to 3.8×10 8 The SFTSV positive recombinant plasmid with different copy number / μL concentration gradient was used as template for fluorescence quantitative PCR reaction, and the standard curve was generated. Figure 2 Figure C. The correlation coefficient R2 value corresponding to the standard curve is 0.999, the slope value is -3.38, the intercept value is 34.12, and the standard curve regression equation is Y = -3.38X + 34.12.

[0134] Select 2.81×10 1 to 2.81×10 8 The SGLV positive recombinant plasmid with different copy number / μL concentration gradient was used as template for fluorescence quantitative PCR reaction, and the standard curve was generated. Figure 2 Figure D. The correlation coefficient R2 value corresponding to the standard curve is 0.998, the slope value is -3.54, the intercept value is 38.4, and the standard curve regression equation is Y = -3.54X + 38.4.

[0135] Select 3.71×10 1 to 3.71×10 8 The YEZV positive recombinant plasmid with different copy number / μL concentration gradient was used as template for fluorescence quantitative PCR reaction, and the standard curve generated was shown in Figure 2Figure E. The correlation coefficient R2 value corresponding to the standard curve is 0.997, the slope value is -3.69, the intercept value is 40.84, and the standard curve regression equation is Y = -3.69X + 40.84.

[0136] Select 1.79×10 1 to 1.79×10 8 The TBEV positive recombinant plasmid with different copy number / μL concentration gradient was used as template for fluorescence quantitative PCR reaction, and the standard curve was generated. Figure 2 Figure F. The correlation coefficient R2 value corresponding to the standard curve is 0.990, the slope value is -4.18, the intercept value is 38.87, and the standard curve regression equation is Y = -4.18X + 38.87.

[0137] (5) Results of fluorescence quantitative RT-PCR reaction sensitivity test

[0138] The recombinant plasmid was transferred into the PCR product according to the copy number gradient from 1×10 1 Up to 1×10 9 Nine standard plasmids were prepared based on the number of copies / μL, and fluorescent real-time quantitative PCR reaction was carried out with the standard plasmids as templates. The results of fluorescent real-time quantitative PCR showed that the minimum detection amount of TBEV plasmid of the detection method established by Taqman probe fluorescent quantitative technology was 17.9 copies / μL, the minimum detection amount of ALSV plasmid was 25.8 copies / μL, the minimum detection amount of SFTSV plasmid was 38 copies / μL, the minimum detection amount of SGLV plasmid was 28.1 copies / μL, the minimum detection amount of YEZV plasmid was 37.1 copies / μL, and the minimum detection amount of BJNV plasmid was 39.8 copies / μL. Therefore, this method has high sensitivity.

[0139] (6) Results of fluorescence quantitative RT-PCR reaction specificity test

[0140] The cDNA samples of five other viruses were detected by the established Taqman probe fluorescent quantitative RT-PCR method, such as Figure 3 The results showed that the detection method could only specifically amplify the standard positive plasmid, while the identification samples were all negative and the negative control had no specific amplification curve, indicating that the established Taqman probe fluorescent quantitative RT-PCR method had good specificity.

[0141] (7) Clinical sample test results

[0142] Clinical samples were obtained from samples stored in the laboratory. The virus positive rate was detected by comparing the probe method qRT-PCR (real-time fluorescence quantitative PCR) established in this study with the virus detection method published in existing articles. Figure 4 As shown: The probe method qRT-PCR detected ALSV in 5 positive samples and 10 negative samples, which was consistent with the results of the semi-nested PCR method (such as Figure 4 The probe-based qRT-PCR method detected 4 TBEV-positive samples and 10 TBEV-negative samples, which was consistent with the results of the semi-nested PCR method (Fig. Figure 4 qRT-PCR detected 2 positive samples and 9 negative samples of SFTSV by probe method, and 1 positive sample and 10 negative samples by semi-nested PCR (Fig. Figure 4 qRT-PCR with probe method detected 5 positive samples and 12 negative samples of BJNV, and semi-nested PCR method detected 2 positive samples and 15 negative samples (Fig. Figure 4 D of Figure 1); the probe-based qRT-PCR test for YEZV was 5 samples positive and 2 samples negative, and the probe-based qRT-PCR test established in other articles was 4 samples positive and 3 samples negative (e.g. Figure 4 5 samples were positive and 8 samples were negative for SGLV by probe-based qRT-PCR, and 10 samples were positive and 3 samples were negative by dye-based qRT-PCR (Fig. Figure 4 (Figure F). This shows that the established probe-based qRT-PCR detection method has a good detection effect, is more sensitive than the semi-nested PCR method, and has better specificity than the SYBR qRT-PCR method, and can be used for the detection of clinical samples.

[0143] Although the present invention has been disclosed as above by the embodiments, it is not intended to limit the present invention. Any person skilled in the art may make various choices and modifications without departing from the spirit and scope of the present invention. Therefore, the protection scope of the present invention is limited by the claims and their equivalents.

Claims

1. A primer and Taqman probe combination for detecting pathogenic tick-borne viruses, characterized in that: The primer and Taqman probe combination includes: (1) Primer pair for detecting ALSV: upstream primer F: GCTTGTGGTCATCATYATG (SEQ ID NO.1); downstream primer R: CTCTGCCACATRCTGAWG (SEQ ID NO.2); Taqman probe: CTCTCGTCRGCYATACCRCCA (SEQ ID NO.3); (2) Primer pair for detecting TBEV: upstream primer F: CGTGTCATAGAYGGRMGA (SEQ ID NO. 4); downstream primer R: CACTGYCCAGAGTATATGTA (SEQ ID NO. 5); Taqman probe: CTGTTCTTCCTTCYTGTCTTCCGA (SEQ ID NO. 6); (3) Primer pair for detecting SFTSV: upstream primer F: GAGTCTAGGTCATCTGATC (SEQ ID NO.7); downstream primer R: CYGTCTCTGTCTTTATGTAAG (SEQ ID NO.8); Taqman probe: AGCAATGACAGAYGCCTTCCA (SEQ ID NO.9); (4) Primer pair for detecting SGLV: upstream primer F: AGATTGTGCATGCTGCRTC (SEQ ID NO. 10); downstream primer R: GTTTGTAAGATGCTTTCTTT (SEQ ID NO. 11); Taqman probe: YCAAYGATGATGGTTTGACCAACCAACA (SEQ ID NO. 12); (5) Primer pair for detecting BJNV: upstream primer F: TCACCAGTTCCTACTACG (SEQ ID NO. 13); downstream primer R: GGACAACCTCAACATTCA (SEQ ID NO. 14); Taqman probe: ACACTCACAACCTGTCHGGCA (SEQ ID NO. 15); (6) Primer pair for detecting YEZV: upstream primer F: GACTGGATCYTGACTAAATG (SEQ ID NO. 16); downstream primer R: RACTGATATGCCTCCTAG (SEQ ID NO. 17); Taqman probe: ACGGAMTATGCCAGGACAACA (SEQ ID NO. 18); Among them, Y represents the base C or T; R represents the base A or G, W represents the base A or T, and M represents the base A or C.

2. The primer and Taqman probe combination for detecting pathogenic tick-borne viruses according to claim 1, characterized in that: The 5' end of the probes of the ALSV virus, the TBEV virus, the SFTSV virus, the SGLV virus, the BJNV virus and the YEZV virus are labeled with a FAM fluorescent group, and the 3' end is labeled with a BHQ1 quenching group.

3. A kit for detecting pathogenic tick-borne viruses for non-disease diagnosis purposes, characterized in that: The kit comprises the primer and Taqman probe combination described in any one of claims 1-2.

4. Use of the primer and Taqman probe combination for detecting pathogenic tick-borne viruses according to any one of claims 1-2 or the kit according to claim 3 in detecting pathogenic tick-borne viruses for non-disease diagnosis purposes.

5. A method for detecting pathogenic tick-borne viruses for non-disease diagnosis purposes, characterized in that: The following steps are involved: (1) Preparation of primers and Taqman probes: Based on the conserved gene-related sequences of ALSV, TBEV, SFTSV, SGLV, BJNV and YEZV, a primer and Taqman probe combination as described in any one of claims 1 to 2 is designed; (2) Sample preparation: extracting total RNA from the virus sample to be tested; (3) RNA reverse transcription: reverse transcription of the extracted RNA into cDNA; (4) Fluorescence quantitative RT-PCR reaction: using the specific primers and Taqman probes of step (1) to perform PCR amplification and monitor the fluorescence signal in real time; (5) Result analysis and judgment: Determine whether the sample contains the target virus based on the Ct value of the fluorescent signal. If there is no Ct value or the Ct value is greater than 40, it is normal. If the Ct value is 37-40, it is a suspected positive sample and needs to be tested again. If the Ct value is less than 37, the nucleic acid result is positive.

6. The method for detecting pathogenic tick-borne viruses for non-disease diagnosis purposes according to claim 5, characterized in that: Step (3) includes: (a) Setting of PCR amplification conditions; (b) Execution of agarose gel electrophoresis; (c) purification and recovery of target gene fragments; (d) ligation and transformation of gene fragments and vectors; (e) Calculation of the copy number of the standard; (f) Establishment of standard curve of TaqMan fluorescence quantitative RT-PCR method.

7. The method for detecting pathogenic tick-borne viruses for non-disease diagnosis purposes according to claim 6, characterized in that: In step (a), the PCR amplification conditions are as follows: an initial denaturation step at 94°C for 4 min; a cycle comprising denaturation at 94°C for 60 s, annealing at 55°C for 30 s, and extension at 72°C for 60 s, for a total of 30 cycles; and a final extension at 72°C for 5 min.

8. The method for detecting pathogenic tick-borne viruses for non-disease diagnosis purposes according to claim 6, characterized in that: In step (a), in a 25 μL PCR reaction system, the substances are composed of: 1 μL upstream primer, 1 μL downstream primer; 2 μL cDNA template; 8.5 μL RNase-Free H2O, and 12.5 μL 2xTaq mix.

9. The method for detecting pathogenic tick-borne viruses for non-disease diagnosis purposes according to claim 6, characterized in that: In step (f), the establishment of the standard curve of the TaqMan fluorescent quantitative RT-PCR method includes: performing a 10-fold gradient dilution of the plasmid standard; performing TaqMan fluorescent quantitative PCR amplification using the diluted standard as a template; and drawing a standard curve with the logarithm of the initial template concentration as the horizontal axis and the Ct value as the vertical axis.

Images