189 results about "Encephalitis Viruses" patented technology

The present invention provides a rapid and sensitive method for the detection of a West Nile virus (WNV), Japanese encephalitis virus (JEV), St. Louis encephalitis virus (SLEV) and Dengue virus (DENV) and antibodies directed against thereof involving contacting a biological specimen suspected of being infected with WNV, JE, SLE or DEN with a substantially purified and isolated WNV E glycoprotein or subfragment thereof having a native conformation wherein the E glycoprotein or subfragment thereof has a reactivity with antibodies against WNV and a cross-reactivity with antibodies against JEV, SLEV and DENV. The instant invention further provides a rapid, sensitive, and consistent method for the specific detection of WNV by employing diagnostic assays having the antigen NS5 which is specifically reactive with anti-WNV antibodies but not cross-reactive with antibodies against other flaviviruses such as JEV, SLEV, or DENV. The present invention also provides a rapid, sensitive, and consistent method for the specific detection of DENV by employing diagnostic assays having the antigen NS5 which is specifically reactive with anti-DENV antibodies but do not cross-react with antibodies against other flaviviruses such as JEV, SLEV, or WNV. Further, the DENV NS5 antigens are serospecific and do not cross react with antibodies to other DENV strains. Thus, the method of the present invention provides a manner by which to discriminate infections by each DENV strain. Further, diagnostic kits for carrying out the methods are provided. The methods and kits for carrying out the methods of the invention are rapid and require as little as 10 minutes to detect a result.

Methods and pharmaceutical compositions for treating viral infections, by administering certain thienopyridine derivative compounds in therapeutically effective amounts are disclosed. Methods of using the compounds and pharmaceutical compositions thereof are also disclosed. In particular, the treatment of viral infections such as caused by flavivirus is disclosed, i.e., including but not limited to, Dengue virus, West Nile virus, yellow fever virus, Japanese encephalitis virus, and tick-borne encephalitis virus.

The present invention relates to the use of imatinib for treating viral liver diseases and in particular for viral hepatitis. The invention provides the use of imatinib for inhibiting replication, transmission or both of hepatitis viruses. The invention further relates to the use of imatinib for inhibiting replication, transmission or both of other viruses including herpes virus, poxvirus, influenza virus, para influenza virus, respiratory syncytial virus, rhinovirus, yellow fever virus, west nile virus, and encephalitis virus.

The invention discloses a set of epitope polypeptides, particularly relates to a neutralizing B cell epitope sequence of encephalitis B virus E protein, and further discloses application of controlling and diagnosing encephalitis B virus by these epitopes. The amino acid sequences of the epitope polypeptides in the invention are respectively any amino acid sequence of SEQ ID NO: 64, SEQ ID NO: 79, SEQ ID NO: 95, SEQ ID NO: 108, SEQ ID NO: 124 and SEQ ID NO: 139. After the epitope polypeptides in the invention are coupled or fused with carrier proteins to be expressed as immunogenic or vaccine immuno animal organism, neutralizing antibodies aiming at JEV can be generated, and the JEV can be neutralized in vivo or in vitro so as to prevent virus from infecting animal organism. The epitope polypeptides in the invention or the junctional complex thereof can be used as reagents for detecting encephalitis B virus antibodies or encephalitis B virus polypeptide antibodies.

The invention encompasses nucleic acid molecules containing transcription units which encode the flavivirus M and E protein antigens. The flaviviruses include Japanese encephalitis virus, dengue, yellow fever virus and St. Louis encephalitis virus. The nucleic acids function to provide the M and E protein antigens when the nucleic acid resides in an appropriate host cell, especially when the host cell is the cell of a subject. The invention also encompasses a vaccine whose active agent is the nucleic acid. The invention further encompasses the cultured host cells when they contain within them nucleic acid molecules containing the transcription units. The invention in addition encompasses a method of immunizing a subject against flavivirus infection by administering to the subject an effective amount of a vaccine containing a nucleic acid molecule containing the transcription unit of the invention.

The present invention discloses an attenuated recombinant alphavirus that is incapable of replicating in mosquito cells and of transmission by mosquito vectors. These attenuated alphavirus may include but is not limited to Western Equine Encephalitis virus, Eastern equine encephalitis virus, Venezuelan equine encephalitis virus or Chikungunya virus. The present invention also discloses the method of generating such alphaviruses and their use as immunogenic compositions.

The invention relates to gene VIb subtype Avian pneumo-encephalitis virus attenuated strain VIbI4 and a construction method thereof. The preserving number of the gene VIb subtype scriber set Avian pneumo-encephalitis virus attenuated strain VIbI4 is CGMCCNo: 6149. The gene VIb subtype Rubulavirus Newcastle disease virus attenuated strain VIbI4 and the construction method thereof relate to a technology for applying reverse genetics; and the method comprises the following steps: carrying out mutation on an F gene by using a transcription carrier Ptvt/071204 containing Avian pneumo-encephalitis virus JS/07/04/Pi full gene genome from pigeons so as to obtain to a transcription carrier ApTVT/071204, and then substituting corresponding parts on the ApTVT/071204 by the NP, P and L genetic fragments of Avian pneumo-encephalitis virus rNDV/I4 so as to obtain recombinant plasmids ApTVT/VIbI4, wherein the plasmids successfully save a recombinant virus VIbI4 after transfecting a BSR-T7/5 cell together with auxiliary plasmids. The virus is relatively high in propagating titre, is suitable for large-scale production of vaccines and can be used for manufacturing vaccines.

The present invention discloses an ELISA-Array method for detection of encephalitis viruses, and a special kit thereof. The kit of the present invention comprises six capture antibodies, wherein the solution of each capture antibody is a mixing solution prepared by mixing the capture antibody and a spotting solution, the concentration of each capture antibody in the corresponding capture antibody solution is 0.05 mg/ml. Experimental results of the present invention show that: the six specific encephalitis virus monoclonal antibodies are prepared by the method of the present invention; with adopting the ELISA-Array technology platform, and optimizing the experimental conditions, the ELISA-Array technology capable of concurrent detection of the six encephalitis viruses is established, and can be adopted for detection of the six encephalitis-related viruses; compared to the common ELISA, the ELISA-Array method of the present invention has the following advantages that: the specificity of the ELISA-Array method is the same as the specificity of the common ELISA, the sensitivity is high, the highest sensitivity is more than 10 times the sensitivity of the common ELISA, and the ELISA-Array method has a high clinical application prospect.

The invention discloses an epidemic encephalitis B/forest encephalitis hybrid virus and an application of the virus. The epidemic encephalitis B/forest encephalitis hybrid virus takes an epidemic encephalitis virus attenuated strain as a gene skeleton, and is a recombinant virus obtained by replacing a deoxyribonucleotide fragment of an encoded epidemic encephalitis virus prM-E delta 3 protein in epidemic encephalitis virus genome RNA (Ribonucleic Acid) with a deoxyribonucleotide fragment of an encoded forest encephalitis virus prM-E delta 3 protein in forest encephalitis virus genome RNA. The epidemic encephalitis B/forest encephalitis hybrid virus has the advantages that the virus is high in safety, and strong in stability, and can be induced to generate a good immune response to a forest encephalitis virus envelope protein, and protect an animal from being attacked by the exogenous forest encephalitis virus of lethal dose. The epidemic encephalitis B/forest encephalitis hybrid virus has a good application prospect in preventing and/or treating forest encephalitis virus infection as a vaccine.

The invention discloses an EIII-indirect ELISA (Enzyme-Linked Immuno Sorbent Assay) antibody detection kit for detecting a swine Japanese encephalitis virus and an application thereof. The kit disclosed by the invention consists of an elisa plate which takes a purified JEV-EIII protein as an envelope antigen, a cleaning liquid, a serum diluent, rabbit anti-pig elisa secondary antibody, a primer developing liquid, a stop buffer, a JEV positive serum and a JEV negative serum. The envelope antigen used by the invention is easy to be obtained stably and massively, the purifying method is simple and easy to realize, and concentration of recombinant proteins is easy to test and control, thereby facilitating industrialized production on a large scale. The kit disclosed by the invention is used for detecting the swine Japanese encephalitis virus antibody, and the detection coincidence rate with the ELISA kit in the prior art is 90%. The kit disclosed by the invention is convenient to operate, high in sensitivity, good in specificity, low in using cost, good in repeatability and suitable for popularization and application, and provides a reliable means for clinical rapid detection of the JEV antibody.

The invention discloses Japanese encephalitis virus like particles as well as a preparation method and an application thereof. The Japanese encephalitis virus like particles are prepared by assembling a PrM/E gene of a Japanese Encephalitis virus (JEV) and a JEVRNA replicor with a nucleotide sequence as shown in SEQ ID NO: 1. The preparation method of the Japanese encephalitis virus like particles comprises the steps of: connecting the JEV PrM/E gene amplified by an RT-PCR (Reverse Transcriptase Polymerase Chain Reaction) to a plasmid pTRE-Tight of a Tet-on advance expression system to form a recombination vector, transfecting a Hela Tet-on advanced cell by using an Xfect method, after screening and identifying through HygB, obtaining a Hela cell line for controllably and stably expressing the PrM/E gene through a limiting dilution process, inducing for expressing a PrM/E protein, and packaging to obtain the conventional virus like particles; and transfecting the Hela cell line by using a JEV replicor RNA vector and packaging to obtain the virus like particles with a capacity of transient infection. The Japanese encephalitis virus like particles can be used for preparing a vaccine or used as a detection agent, has better immunogenicity and reactivity, and is safe and reliable.

The invention provides a replicon vector taking Japanese encephalitis virus genome as a framework, as well as a cell line for packaging the same and a packaging system. The JEV replicon vector has the capability of efficiently expressing foreign protein. Mice are immunized with the replicon vector, and the titer of an anti-JEV antibody reaches 1:1280 after three immunizations so as to protect 75 percent of suckling mice from virus attack. The cell line provided can produce 1.6*105 U/ml of pseudovirus particles after packaging JEV replicon, and the titer of the anti-JEV antibody reaches 1:2560 after two immunizations so as to protect 73 percent of suckling mice from virus attack. The invention establishes a technical platform for a JEV replicon vector system for the first time, and explores the feasibility of researching replicon vaccines and pseudovirus vaccines through the JEV replicon vector system, thereby laying a solid foundation for developing and researching a plurality of novel vaccines used to prevent and treat tumors and viral diseases in future.

The invention discloses a kit for detecting eastern equine encephalitis virus and west equine encephalitis virus by real-time fluorescence quantitative RT-PCR. The kit provided by the invention comprises a primer pair as shown in the following (1) and (2): (1) EEEV forward primer: TGTGCGTACCTCCTCATCGTT, EEEV reverse primer: GACTGGCGTGAATCTCTGCT; (2) WEEV forward primer: AGGGATACCCCCGAAGGTT, WEEV reverse primer: GTGAATAGCACACGGGTGGTT. The kit can be applied to detecting EEEV and WEEV and has good sensitivity and specificity; in addition, the lowest EEEV virus titer that the kit can detect is 0.2TCID50/ml and the WEEV virus titer that the kit can detect is 1TCID50/ml.

The present invention provides rapid and accurate methods, primers, probes and kits for detecting certain flaviviruses in samples. Detectable flaviviruses include Japanese encephalitis virus serogroup members, dengue virus, St. Louis encephalitis virus, Montana myotis leukoencephalitis virus, Modoc virus, and yellow fever virus. The primers and probes of the present invention can hybridize to the region within the 3' untranslated region of the genome of the virus to be detected.

The invention discloses a JEV (Japanese type B encephalitis virus) nucleic acid assay kit and application thereof. The kit comprises RPA (recombinase polymerase amplification) freeze-dried reagents, PRA reaction primers, an RPA reaction probe, buffer solution, magnesium salt solution and double-distilled water. The RPA reaction probe is used for real-time quantitative detection of RPA nucleic acid amplification products. Low contamination is achieved due to the fact that users do not need to open caps during the whole detection. The whole reaction is performed in a constant temperature of 38 DEG C, and users can determine and read results within 5-20 minutes by observing fluorescent curves. The JEV nucleic acid assay kit has the advantages of high sensitivity and specificity, operational convenience, quick reaction, portability, low contamination and the like.

The invention relates to the technical field of biomedicine, in particular to a novel target resistant to Japanese encephalitis virus (JEV) infection and application. Human neuroblastoma cells (SK-N-SH) are taken as target cells, RNA technology is adopted to reduce expression of host protein of the target cells to find host factors capable of effectively inhibiting JEV-infected human neuroblastoma cells (SK-N-SH) so as to protect functions of a nerve system and prevent virus from infecting a central nerve system to cause inflammation. The invention provides application of Cofilin in preventing and treating JEV infection, and experiments find that Cofilin plays an important role in JEV-infected SK-N-SH, and JEV infection can be inhibited remarkably by reducing expression of Cofilin. The invention further provides application of Cofilin in preparing drug for preventing or treating JEV infection.

The invention relates to a method capable of detecting common viruses of arbovirus encephalitis. The invention also relates to an amplification primer and an extension primer which are used for detecting the common viruses of arbovirus encephalitis, and a kit containing the primers.

The invention relates to a combined vaccine prepared from epidemic encephalitis B viral vaccines and enterovirus 71 (EV71) viral vaccines and a preparation method thereof. An epidemic encephalitis B viral stock solution prepared from the epidemic encephalitis B virus through culture, harvest, inactivation, ultrafilter concentration and purification and an EV71 viral stock solution prepared from the EV71 virus through culture, harvest, inactivation, ultrafilter concentration and purification are prepared according to a certain proportion to form the combined vaccine. The combined vaccine can be used for simultaneously preventing and treating the hand-foot-and-mouth disease suffered by infants and children caused by the epidemic encephalitis B and the EV71 virus.

The invention specifically discloses an RT-PCR primer and probe combination for simultaneous detection of 8 arbo encephalitis viruses and a kit. The primer and probe have sequences shown as SEQ ID NO:1-24. The invention is based on the primer and probe combination, combines the sensitive and reliable advantages of real-time quantitative PCR technology and the advantages of simultaneous detection of multi-gene expression amount by microarray technology, and develops an RT-PCR array kit for simultaneous detection of 8 arbo encephalitis viruses. The kit can rapidly detect 8 arbo encephalitis viruses simultaneously by one RT-PCR reaction so as to realize integration and high throughput in RT-PCR detection of multiple pathogens. The kit provided by the invention can be applied to large-scale pathogen screening, provides technical support for diagnose of infection of pathogenic encephalitis arbo virus infection and determination of infection sources, and has important practical significance to clinical prevention and control of pathogenic encephalitis.

The invention discloses a gene chip and a kit for detecting a pig epidemic type B encephalitis virus and/or pig porcine reproductive and respiratory syndrome virus. The gene chip and the detection kit disclosed by the invention can accurately and effectively detect the pig epidemic type B encephalitis virus and the pig porcine reproductive and respiratory syndrome virus and are high in specificity, high in sensitivity, short in time, fast in detection speed and good in application prospect.