38 results about "Deoxyribonucleoside triphosphate" patented technology

The invention discloses a genetically engineered bacterium for producing uridine diphosphate glucose as well as a construction method and application of the genetically engineered bacterium, and belongs to the technical field of genetic engineering. The following genes are overexpressed in the genetically engineered bacterium: a pyrimidine nucleoside operon gene, a carbamyl phosphate synthetase gene, an aspartate carbamyl transaminase gene, an orotic acid phosphoribose transferase gene, a phosphoribose pyrophosphate synthase gene, a uridylate kinase gene and a glucophosphate mutase gene. A uridine triphosphate glucose-1-phosphate uridine group transferase gene; the genetically engineered bacterium does not express the following genes: a purine nucleotide repressor protein gene, a deoxyribonucleoside triphosphate reductase gene, a nucleoside triphosphate pyrophosphohydrolase gene, a cytidine triphosphate synthase gene, a pyrimidine nucleotidase gene, a nucleotidase gene, an ornithine carbamoyltransferase gene, a UDPG dehydrogenase gene and a lacI repressor protein gene. The genetically engineered bacterium can be used for efficiently synthesizing UDPG by taking glucose as a substrate.

The invention discloses a rapid culture system of mycoplasma pneumoniae. The rapid culture system comprises a growth-promoting additive A, a growth-promoting additive B and a growth-promoting additive C, wherein the growth-promoting additive A is A549 cell lysis buffer; the growth promoting additive B is a mixture of deoxyribonucleoside triphosphate and / or ribonucleoside triphosphate. The rapid culture system can promote rapid growth and reproduction of the mycoplasma pneumoniae, fully meets the nutritional requirements and growth requirements of the mycoplasma pneumoniae, and is of great significance to isolated culture, enrichment culture, epidemic disease prevention and control and molecular diagnosis of the mycoplasma pneumoniae. The invention also provides a culture method of the mycoplasma pneumoniae. The invention also provides application of the rapid culture system of the mycoplasma pneumoniae in in-vitro cell culture of the mycoplasma pneumoniae.

The invention belongs to the field of detection, and particularly relates to a kit for detecting and identifying staphylococcus capitis and a detection method. The kit for detecting and identifying the staphylococcus capitis comprises Taq DNA (deoxyribonucleic acid) polymerase, a 10 * Taq buffer solution, a dNTP (deoxyribonucleoside triphosphate) mixed solution, an upstream primer, a downstream primer and a DNA Marker III. During detection, DNA of a sample to be detected is taken as a template, electrophoresis is performed after PCR amplification, if a 863bp band appears, the sample is positive, rapid and specific detection can be performed, and clinical (such as non-lactation period mastitis) requirements are met.

The invention discloses a method for screening self-incompatible strains of Bo-white peony roots. The method is characterized by comprising the following steps: step 1, extracting genome DNA (Deoxyribonucleic Acid) of Bo-white peony roots; 2, carrying out a PCR amplification reaction; an identification primer is composed of 5 'ACTGGTGGAACGCAGGAAAA3'and 5' TCAAGTGTCACCTTCCTGC3 ', and an identification primer is composed of 5' ACTGGTGGAACGCAGGAAAA3 'and 5' A PCR reaction system is carried out in a centrifugal tube, the reaction system comprises a PCR buffer solution, magnesium dichloride, deoxyribonucleoside triphosphate, an identification primer, high-fidelity Taq DNA polymerase, a template and sterile ultrapure water, the centrifugal tube is placed in a PCR instrument, and PCR reaction parameters are set; 3, analyzing a PCR amplification product, and judging whether the Bo-white paeony root plant is a self-incompatible strain or not according to the characteristics of the product; the method is simple, reliable and efficient, and samples can be screened from the molecular level in the seedling stage. Meanwhile, the invention discloses application of the identification primer in screening of self-incompatible strains of Bo-white peony roots.

The invention discloses a kit and a method for preparing cDNA (complementary deoxyribonucleic acid) by reverse recording of a single B cell of a mouse. The kit comprises a B cell lysis solution and a reverse transcription buffer solution system, wherein the B cell lysis solution is prepared from a nonionic detergent, dNTP (deoxyribonucleoside triphosphate), dCTP (deoxycytidine triphosphate), a secondary structure stabilizer, a reducing agent, BioIS-mCH2-RT (reverse transcriptase), BioIS-CK-RT, a mouse RNA (Ribonucleic Acid) enzyme inhibitor and nuclease-free water; the reverse transcription buffer solution system comprises 5X RT Buffer, a secondary structure stabilizer, Mg < 2 + >, a reducing agent, a mouse RNA enzyme inhibitor, a Bio-Adaptor primer, reverse transcriptase and nuclease-free water. The kit can significantly improve the success rate, accuracy and sensitivity of reverse transcription of a single B cell, and simplify the operation process.

The invention discloses a probe for detecting HBV-DNA as well as application and a method thereof, the probe is a padlock probe, and the padlock probe comprises an RCA annular template region and an HBV-DNA recognition region. The preparation method of the working electrode comprises the following steps: incubating padlock probe DNA (Deoxyribose Nucleic Acid) and HBV (Hepatitis B Virus)-DNA; then exonuclease III is added for incubation, and then thermal inactivation treatment is carried out; adding PolyT-primer and escherichia coli DNA ligase, mixing, incubating, and carrying out thermal inactivation treatment; then adding dNTP (deoxyribonucleoside triphosphate) without dATP (deoxyadenosine triphosphate) and phi29 DNA (deoxyribonucleic acid) polymerase, incubating, and carrying out thermal inactivation treatment; and after the incubation sample liquid is cooled, incubating by using MB (ZIF)-90, then centrifugally collecting the supernatant, transferring the supernatant to the electrode modified by MX / MWCNTs, and after incubation, washing away MB which is not adsorbed on the electrode to obtain the working electrode. The method is simple to operate, rapid in detection and high in sensitivity.

The invention discloses a glow-type chemiluminescence sensor based on DRCA product DNA hydrogel and application of the glow-type chemiluminescence sensor. The glow type chemiluminescence sensor disclosed by the invention comprises an aptamer-primer compound, an annular template 1, an annular template 2, a Phi29 DNA polymerase, dNTPs (deoxyribonucleoside triphosphates), a chemiluminescence molecule and a target object. According to the present invention, the rapid gelling RCA reaction template sequence optimization scheme is established, the DRCA strategy is utilized to synergistically promote the formation of the DNA hydrogel, and the DNA hydrogel is further utilized to delay the reactant diffusion so as to prolong the chemiluminescence reaction time, such that the glow-type chemiluminescence sensor is prepared, the flash-type chemiluminescence defect is effectively overcome, and the application prospect is broad. And a lot of convenience is provided for on-site rapid detection of salmonella typhimurium.

The invention provides a qPCR reaction system, a product thereof and application of the qPCR reaction system in virus detection, and relates to the technical field of qPCR. The invention provides a qPCR (quantitative polymerase chain reaction) buffer solution. The qPCR buffer solution comprises the following components: SYBR Green I, a hot start Taq enzyme, Tris, KCl, MgCl2, (NH4) 2SO4, dNTPs (deoxyribonucleoside triphosphates), choline chloride and hexadecyl trimethyl ammonium bromide. When the qPCR buffer solution is used for detection, the repeatability is good, the detection limit is low, the anti-interference capability is high, and the application potential in virus detection is huge.

The invention belongs to the technical field of molecular biology, and provides a reinforcing agent for improving amplification efficiency of mismatched primers in PCR (polymerase chain reaction), a reaction system and application of the reinforcing agent. The reaction system is a liquid reaction system and comprises a reinforcing agent, Trisma, dNTP (deoxyribonucleoside triphosphate), MgCl2, NH4Cl, KCl, BSA (bovine serum albumin), glycerol, betaine, a specific primer, a DNA (deoxyribonucleic acid) template, DNA polymerase, DMSO (dimethylsulfoxide) and water. The invention also provides an application of the enhancer in gene polymorphism detection by a PCR-RFLP (Polymerase Chain Reaction-Restriction Fragment Length Polymorphism) method. Tetramethylammonium chloride and glutathione in the enhancer have a synergistic effect, so that the binding capacity of a mismatched primer and a DNA template can be remarkably enhanced, the completeness of a mismatched region at the 3'end of the primer is protected, and non-specific amplification is inhibited while the amplification efficiency is improved.

The invention provides a DNA paper-cutting system, method and product for resisting polymerase chain displacement, and belongs to the field of DNA nanotechnology, the DNA paper-cutting system comprises: a DNA nanostructure comprising a cutting region and a non-cutting region; wherein on the template chain of the non-cutting area, a blocking sequence is arranged at the 5'end of a template chain section corresponding to at least one nicking site, and the blocking sequence is composed of one or more basic groups belonging to a target basic group type; the specific reaction buffer solution contains DNA (deoxyribonucleic acid) polymerase and a plurality of deoxyribonucleoside triphosphates except a specific deoxyribonucleoside triphosphate; wherein the type of the specific deoxyribonucleoside triphosphate deleted in the specific reaction buffer solution is complementary to the type of the target basic group.

The invention discloses a method for rapidly detecting MTHFR (Methylene Tetrahydrofolate Reductase) gene polymorphism based on a complementary probe technology, which comprises the following steps: S1, acquiring a sample: extracting genome DNA (Deoxyribose Nucleic Acid) from a sample to be detected as an amplification template; s2, preparing a reaction system: adding the genome DNA, the upstream primer, the downstream primer, the C probe, the T probe, uracil-N-glycosylase, DNA polymerase, deoxyribonucleoside triphosphate and deoxyuridine triphosphate of the sample to be detected into the reaction system; s3, carrying out PCR (Polymerase Chain Reaction) amplification reaction under the conditions that the temperature is 90-98 DEG C, and the time is 5-20 minutes; performing denaturation at the temperature of 90-98 DEG C for 10-50 seconds; the temperature is 55-69 DEG C, and annealing is conducted for 60-120 s; the temperature is 68-72 DEG C, and extension is carried out for 15-300 s; carrying out 35 to 40 cycles; and S, genotype judgment. A test result is the same as a first-generation sequencing test result, which shows that the detection method of the scheme has relatively high accuracy. Meanwhile, compared with a sequencing method, the method has the advantages that a series of complex follow-up treatment does not need to be carried out on a PCR product, PCR amplification and detection are synchronously carried out, the detection time is greatly shortened, and the detection cost is reduced.

A method for producing deoxyribonucleic acid (DNA) includes providing a circular DNA template. The method also includes conducting in vitro an amplification reaction on the circular DNA template to generate a DNA product that is rolling circle amplified, wherein a reaction fold-amplification is minimized to enhance protein expression from the DNA product, and wherein a rolling circle amplification reaction is conducted with at least one of (i) the rolling circle amplification reaction being conducted at 15 degrees Celsius to less than 25 degrees Celsius to minimize the reaction fold-amplification, (ii) the rolling circle amplification reaction being conducted with an input concentration of the circular DNA template being greater than 1 nanogram per milliliter to minimize the reaction-fold amplification, or (iii) the rolling circle amplification reaction being conducted with input concentrations of deoxyribonucleoside triphosphates being titrated to 1.2 millimolar or less per deoxynucleotide to minimize the reaction-fold amplification.

The present invention relates to the technical field of detection kits, and discloses a gene methylation endometrial cancer detection kit, which comprises PCR reaction liquid for RP4, RP11 and CTD methylation detection, a negative control and a positive control, and the PCR reaction liquid comprises a PCR reaction liquid A and a PCR reaction liquid B; the PCR reaction liquid A comprises dNTP (deoxyribonucleoside triphosphate), a salt ion component, a stabilizer and DNA (deoxyribonucleic acid) polymerase; the PCR reaction liquid B comprises an RP4 primer, an RP11 primer, a CTD primer, a GAPDH primer and a fluorescent probe. The kit is based on the fluorescent quantitative PCR principle, the methylation of RP4, RP11 and CTD genes in a cervical epidermal cell sample is detected by a methylation PCR fluorescent probe method, the detection accuracy is high, the operation is convenient and rapid, and a reliable reference basis can be provided for clinical diagnosis of endometrial cancer.

The invention discloses a nucleic acid detection product, a system containing the nucleic acid detection product, a kit and a method for detecting Zika virus. The system comprises Tris, potassium acetate, DTT, polyethylene glycol 20000, deoxyribonucleoside triphosphate (dNTP), adenosine triphosphate (ATP), phosphocreatine, creatine kinase, Bsu, gp32, uvs X, uvs Y, Superscript IV Reverse Transcriptase, a primer pair, LbCas12a, a crRNA sequence, RNase H and magnesium acetate, and an RPA / CRISPR one-pot reaction can be realized, and detection is carried out through an electrochemical method. The system or the kit containing the system can realize rapid diagnosis of the Zika virus in different scenes, is simple and convenient in operation method and low in cost, has relatively high sensitivity and specificity, and is suitable for being applied to airports, disease control units and other grassroots units.

The invention provides a kit for DNA ligation reaction as well as a use method and application thereof. The kit comprises a first component and a second component, wherein the first component comprises a positively charged substance and a first buffer solution; the positively charged substance is selected from at least one of positively charged polypeptide, positively charged protein, positively charged synthetic macromolecule and positively charged glucan; the second component comprises a negatively charged substance and a second buffer solution; the negatively charged substance is selected from at least one of adenosine triphosphate, deoxyribonucleoside triphosphate, oligonucleotide and negatively charged polypeptide. The first component and the second component are arranged in the kit, when the first component and the second component are prepared into a reaction system, a condensate emulsion of hundreds of nanometers to several micrometers can be formed in situ, the condensate emulsion can spontaneously enrich all the components required by the reaction, and an emulsion matrix phase is a gel-like environment; and the ligation reaction efficiency and accuracy can be remarkably improved through the crowding effect between macromolecules.

The invention provides an improved method for identifying interaction between RNA and RNA binding protein, and relates to the field of biological analysis. Comprising the following steps: ultraviolet crosslinking: carrying out covalent crosslinking on RNA and binding protein in cells through ultraviolet rays, and fixing instantaneous transition of interaction between RNA and RNA binding protein; s2, cell lysis and fragmentation: splitting the cells treated in the step S1, and then cutting RNA into short fragments by using RNA enzyme; s3, immunoprecipitation: enriching the target RBP and the RNA fragment combined with the target RBP by using a specific antibody; s4, linker connection and library construction: firstly, carrying out reverse transcription on RNA molecules by using a random primer to form a cDNA first chain; then synthesizing a cDNA second chain by using dNTP (deoxyribonucleoside triphosphate) containing dUTP (deoxyuridine triphosphate) and DNA polymerase; carrying out terminal repair and A addition on the double-stranded DNA; connecting a double-chain DNA (deoxyribonucleic acid) joint with a protruding T basic group at the tail end; carrying out PCR amplification to obtain a sequencing library; and S5, performing high-throughput sequencing. The treatment of FastAP and PNK is omitted, the loss of RNA molecules is reduced, and the experimental period is shortened.

The invention discloses a group of primer composition, application thereof and a method for detecting the quality of deoxyribonucleoside triphosphate. The nucleotide sequences of primers are respectively shown as SEQ ID NO: 18 and SEQ ID NO: 19. The primer composition disclosed by the invention can be used for detecting the quality of the dNTP in a conventional biological laboratory, so that the subsequent PCR amplification efficiency is ensured.

A method for detecting a target polynucleotide, the method comprising: (1) providing a sample comprising or suspected of comprising the target polynucleotide; (2) subjecting the sample to an isothermal amplification, wherein the isothermal amplification comprises: combining the sample, one or more primers for the target polynucleotide, deoxyribonucleoside triphosphates (dNTPs), enzyme (s), and a magnesium salt, with functionalized gold nanoparticles, which are gold nanoparticles modified with poly (ethylene glycol) and 11-mercaptoundecanoic acid (MUA) (PEG / MUA-AuNPs), thereby forming an amplification mixture, and incubating the amplification mixture thereby forming an incubated mixture; and (3) detecting the target polynucleotide. The present method has high accuracy, sensitivity, specificity, is easy to operate, and can be used for decentralized (point-of-care / on-site) testing.

The invention relates to the field of enzymatic production of deoxyribonucleoside triphosphate, in particular to a method for enzymatic synthesis of deoxyribonucleoside triphosphate. According to the method, the salmon sperm DNA is subjected to enzymolysis through deoxyribonuclease to obtain dNMP, and the enzymolysis rate reaches 99.5% or above; and carrying out catalytic reaction on the dNMP obtained by enzymolysis by utilizing adenylate kinase, thymidylate kinase, cytidine monophosphate kinase, guanylate kinase, nucleoside diphosphate kinase and acetokinase to obtain corresponding dNTP, wherein the molar conversion rate is greater than 80%. The synthesis method is simple to operate, short in production period, easy to separate and purify and low in production cost, and has important industrial application prospects.

The invention discloses an MB-qPCR detection kit and a detection method for rapidly detecting enterocytozoon hepatopenaei, and belongs to the technical field of agricultural and aquatic organism detection. The kit comprises Tris-HCl, dNTP (deoxyribonucleoside triphosphate) containing U, KCl, MgCl2, Tween-20, tetrahydrothiophene 1-oxide, tetramethylammonium chloride, betaine, DMSO (dimethyl sulfoxide), Triton X-100, an upstream primer with a sequence as shown in SEQ ID NO. 1, a downstream primer with a sequence as shown in SEQ ID NO. 2 and an MB fluorescent probe with a sequence as shown in SEQ ID NO. 3. The invention also provides a method for detecting enterocytozoon hepatopenaei by using the kit, the enterocytozoon hepatopenaei can be rapidly detected, and the kit also has the characteristics of high sensitivity, strong specificity and wide detection range.

The present invention provides treatment of mitochondrial diseases. The present invention provides a composition comprising one or more deoxyribonucleosides for use in the treatment of a mitochondrial DNA depletion and / or multiplex deletion syndrome, provided that the syndrome is not caused by a defect in deoxyribonucleoside triphosphate (dNTP) metabolism. By using the invention, the mitochondrial DNA level recovery is independent of the severity of the disease in the patient, which imparts great therapeutic value to the invention.

The present invention addresses the problem of providing a novel method for synthesizing a deoxynucleoside triphosphate or nucleoside triphosphate.　This method for synthesizing a deoxynucleoside triphosphate (dNTP) from a deoxyribonucleoside or synthesizing a ribonucleoside triphosphate (NTP) from a ribonucleoside is characterized by: adding, to a reaction vessel, (i) a deoxyribonucleoside or ribonucleoside as a starting material, (ii) a kinase capable of producing a deoxyribonucleoside monophosphate from the deoxyribonucleoside or a ribonucleoside monophosphate from the ribonucleoside, a kinase capable of producing a deoxyribonucleoside diphosphate from the deoxyribonucleoside monophosphate or a ribonucleoside diphosphate from the ribonucleoside monophosphate, and a pyruvate kinase as enzymes, and (iii) a nucleoside triphosphate or deoxynucleoside triphosphate and a phosphoenolpyruvic acid (PEP) as phosphoric acid donors, thereby adjusting a reaction solution; and reacting the same in one pot.

A rapid amplification method for a nucleic acid of hepatitis B virus, comprises the following steps: mixing a sample containing hepatitis B virus with a nucleic acid releasing agent, and adding a PCR premix to obtain a reaction solution, the PCR premix comprising deoxyribonucleoside triphosphate, an upstream primer as shown in the sequence SEQ ID NO: 1, a downstream primer as shown in the sequence SEQ ID NO: 2, a DNA polymerase and an amplification buffer; placing the reaction solution in a PCR reaction tube so that the reaction solution is in a form of a thin film with a thickness of 0.1 mm or less; performing PCR amplification under the following reaction condition: pre-denaturation at 90 to 100° C. for 10 s to 600 s, denaturation at 90 to 100° C. for 0 to 1 s, and annealing and extending at 50-65° C. for 0 to 1 s.

The invention provides a qPCR (quantitative polymerase chain reaction) amplification reaction composition and application thereof. Specifically, the invention relates to a qPCR (quantitative polymerase chain reaction) amplification reaction composition which comprises Tris-HCl, ammonium sulfate, KCl, dNTPs (deoxyribonucleoside triphosphates), BSA (bovine serum albumin), MgCl2, DNA (deoxyribonucleic acid) polymerase, polyacrylic acid and a freeze-drying protective agent. The invention also relates to a kit comprising a reagent for preparing the composition and a nucleic acid releasing agent matched with the composition for use. The invention also relates to a method for quantitative or qualitative analysis of nucleic acids in a biological sample using the composition, kit or release agent. The nucleic acid releasing agent can rapidly and effectively release DNA under the room temperature condition, the composition can directly apply a nucleic acid crude sample to qPCR amplification in a freeze-drying form or a liquid form, nucleic acid detection is achieved under the condition that a nucleic acid extraction step is not needed, the detection efficiency is remarkably improved, and the composition is suitable for molecular POCT application scenes.

A LAMP assay system for detection of a respiratory virus is disclosed. The LAMP system includes a LAMP reaction mixture having a primer kit, a strand-displacing polymerase and deoxyribonucleoside triphosphates for amplifying a target sequence. The primer kit includes at least one of a first primer set specific to SARS-CoV-2, a second primer set specific to Influenza A, and a third primer set specific to Influenza B. The first primer set includes primers having nucleotide sequences of SEQ ID NOs: 1 to 6 and SEQ ID NOs: 13 to 18. The second primer set includes primers having nucleotide sequences of SEQ ID NOs: 25 to 30. The third primer set includes primers having nucleotide sequences of SEQ ID NOs: 44 to 49.

A colorimetric LAMP system includes a colorimetric LAMP reaction mixture and an extraction-free lysis buffer. The colorimetric LAMP reaction mixture is all-in-one lyophilized and includes a primer set, a strand-displacing polymerase and deoxyribonucleoside triphosphates for amplifying a target sequence; a pH indicating dye in a concentration ranged 0.08 to 0.3 mM; and a lyoprotectant sugar in a concentration ranged 1 to 10% (w / v), wherein the lyoprotectant sugar is selected from the group consisting of trehalose, raffinose, dextran, mannitol and mixtures thereof. The extraction-free lysis buffer includes potassium chloride in a concentration ranged 10 to 50 mM; ammonium sulfate in a concentration ranged 10 to 50 mM; and a detergent in a concentration ranged 0.5 to 6% (w / v). The lyophilized colorimetric LAMP reaction mixture is rehydrated with the extraction-free lysis buffer to be ready for nucleic acid amplification and detection.

One or more enzymes are used to repair damage in synthetic DNA molecules that encode digital information. The enzymes are included in a repair mixture containing one or more of DNA polymerase, DNA ligase, T4 Endonuclease, Endonuclease IV, Endonuclease VIII, and uracil glycosylase. The repair mixture may also contain one or more of a buffering solution, oxidized nicotinamide adenine dinucleotide (NAD+), and deoxyribose nucleoside triphosphates (dNTPs). The synthetic DNA molecules are incubated with the repair mixture for approximately four hours. Use of the repair solution allows recovery of the digital information from damaged DNA molecules.

The invention discloses a kit for rapidly constructing an endothelin converting enzyme ECE1 knock-down plasmid and application of the kit, and relates to the technical field of molecular biology and genetic engineering. Comprising the following components: a high fidelity PCR reagent which comprises # imgabs0 # High-Feliability DNA (deoxyribonucleic acid) Polymerase, a buffer solution and dNTPs (deoxyribonucleoside triphosphates) and is used for amplifying an ECE1 gene; the double enzyme digestion reagent comprises AgeI, EcoRI and a buffer solution thereof, and is used for linearizing the carrier; and the T4 DNA ligase and the buffer solution are used for connecting the ECE1 gene and the vector. By adopting high-fidelity PCR and seamless cloning technologies, the plasmid construction time is remarkably shortened, and the experiment efficiency is improved; according to the method, PCR (Polymerase Chain Reaction) amplification is carried out by using # imgabs1 # High-Felidity DNA (Deoxyribose Nucleic Acid) Polymerase, so that the high fidelity and the specificity of an amplified product are ensured.

The invention relates to an isothermal nucleic acid amplification system for simultaneously detecting brucella and mycobacterium bovis in one tube and application of the isothermal nucleic acid amplification system. The isothermal nucleic acid amplification system comprises a brucella primer probe, a mycobacterium bovis primer probe, dNTP (deoxyribonucleoside triphosphate), polyethylene glycol, dithiothreitol, phosphocreatine, creatine kinase, ATP (adenosine triphosphate), Tris, potassium acetate, DNA (deoxyribonucleic acid) polymerase, UvsX protein and UvsY protein. The isothermal nucleic acid amplification system provided by the invention can realize simultaneous detection of two pathogens in milk in one tube, and dual-channel detection has no competitive reaction, strong specificity and high sensitivity.