17 results about "Deoxyribonucleoside triphosphate" patented technology

The invention belongs to the field of detection, and particularly relates to a kit for detecting and identifying staphylococcus capitis and a detection method. The kit for detecting and identifying the staphylococcus capitis comprises Taq DNA (deoxyribonucleic acid) polymerase, a 10 * Taq buffer solution, a dNTP (deoxyribonucleoside triphosphate) mixed solution, an upstream primer, a downstream primer and a DNA Marker III. During detection, DNA of a sample to be detected is taken as a template, electrophoresis is performed after PCR amplification, if a 863bp band appears, the sample is positive, rapid and specific detection can be performed, and clinical (such as non-lactation period mastitis) requirements are met.

The invention discloses a method for screening self-incompatible strains of Bo-white peony roots. The method is characterized by comprising the following steps: step 1, extracting genome DNA (Deoxyribonucleic Acid) of Bo-white peony roots; 2, carrying out a PCR amplification reaction; an identification primer is composed of 5 'ACTGGTGGAACGCAGGAAAA3'and 5' TCAAGTGTCACCTTCCTGC3 ', and an identification primer is composed of 5' ACTGGTGGAACGCAGGAAAA3 'and 5' A PCR reaction system is carried out in a centrifugal tube, the reaction system comprises a PCR buffer solution, magnesium dichloride, deoxyribonucleoside triphosphate, an identification primer, high-fidelity Taq DNA polymerase, a template and sterile ultrapure water, the centrifugal tube is placed in a PCR instrument, and PCR reaction parameters are set; 3, analyzing a PCR amplification product, and judging whether the Bo-white paeony root plant is a self-incompatible strain or not according to the characteristics of the product; the method is simple, reliable and efficient, and samples can be screened from the molecular level in the seedling stage. Meanwhile, the invention discloses application of the identification primer in screening of self-incompatible strains of Bo-white peony roots.

The invention discloses a kit and a method for preparing cDNA (complementary deoxyribonucleic acid) by reverse recording of a single B cell of a mouse. The kit comprises a B cell lysis solution and a reverse transcription buffer solution system, wherein the B cell lysis solution is prepared from a nonionic detergent, dNTP (deoxyribonucleoside triphosphate), dCTP (deoxycytidine triphosphate), a secondary structure stabilizer, a reducing agent, BioIS-mCH2-RT (reverse transcriptase), BioIS-CK-RT, a mouse RNA (Ribonucleic Acid) enzyme inhibitor and nuclease-free water; the reverse transcription buffer solution system comprises 5X RT Buffer, a secondary structure stabilizer, Mg < 2 + >, a reducing agent, a mouse RNA enzyme inhibitor, a Bio-Adaptor primer, reverse transcriptase and nuclease-free water. The kit can significantly improve the success rate, accuracy and sensitivity of reverse transcription of a single B cell, and simplify the operation process.

The invention provides a qPCR reaction system, a product thereof and application of the qPCR reaction system in virus detection, and relates to the technical field of qPCR. The invention provides a qPCR (quantitative polymerase chain reaction) buffer solution. The qPCR buffer solution comprises the following components: SYBR Green I, a hot start Taq enzyme, Tris, KCl, MgCl2, (NH4) 2SO4, dNTPs (deoxyribonucleoside triphosphates), choline chloride and hexadecyl trimethyl ammonium bromide. When the qPCR buffer solution is used for detection, the repeatability is good, the detection limit is low, the anti-interference capability is high, and the application potential in virus detection is huge.

The invention belongs to the technical field of molecular biology, and provides a reinforcing agent for improving amplification efficiency of mismatched primers in PCR (polymerase chain reaction), a reaction system and application of the reinforcing agent. The reaction system is a liquid reaction system and comprises a reinforcing agent, Trisma, dNTP (deoxyribonucleoside triphosphate), MgCl2, NH4Cl, KCl, BSA (bovine serum albumin), glycerol, betaine, a specific primer, a DNA (deoxyribonucleic acid) template, DNA polymerase, DMSO (dimethylsulfoxide) and water. The invention also provides an application of the enhancer in gene polymorphism detection by a PCR-RFLP (Polymerase Chain Reaction-Restriction Fragment Length Polymorphism) method. Tetramethylammonium chloride and glutathione in the enhancer have a synergistic effect, so that the binding capacity of a mismatched primer and a DNA template can be remarkably enhanced, the completeness of a mismatched region at the 3'end of the primer is protected, and non-specific amplification is inhibited while the amplification efficiency is improved.

The invention provides a DNA paper-cutting system, method and product for resisting polymerase chain displacement, and belongs to the field of DNA nanotechnology, the DNA paper-cutting system comprises: a DNA nanostructure comprising a cutting region and a non-cutting region; wherein on the template chain of the non-cutting area, a blocking sequence is arranged at the 5'end of a template chain section corresponding to at least one nicking site, and the blocking sequence is composed of one or more basic groups belonging to a target basic group type; the specific reaction buffer solution contains DNA (deoxyribonucleic acid) polymerase and a plurality of deoxyribonucleoside triphosphates except a specific deoxyribonucleoside triphosphate; wherein the type of the specific deoxyribonucleoside triphosphate deleted in the specific reaction buffer solution is complementary to the type of the target basic group.

The invention discloses a method for rapidly detecting MTHFR (Methylene Tetrahydrofolate Reductase) gene polymorphism based on a complementary probe technology, which comprises the following steps: S1, acquiring a sample: extracting genome DNA (Deoxyribose Nucleic Acid) from a sample to be detected as an amplification template; s2, preparing a reaction system: adding the genome DNA, the upstream primer, the downstream primer, the C probe, the T probe, uracil-N-glycosylase, DNA polymerase, deoxyribonucleoside triphosphate and deoxyuridine triphosphate of the sample to be detected into the reaction system; s3, carrying out PCR (Polymerase Chain Reaction) amplification reaction under the conditions that the temperature is 90-98 DEG C, and the time is 5-20 minutes; performing denaturation at the temperature of 90-98 DEG C for 10-50 seconds; the temperature is 55-69 DEG C, and annealing is conducted for 60-120 s; the temperature is 68-72 DEG C, and extension is carried out for 15-300 s; carrying out 35 to 40 cycles; and S, genotype judgment. A test result is the same as a first-generation sequencing test result, which shows that the detection method of the scheme has relatively high accuracy. Meanwhile, compared with a sequencing method, the method has the advantages that a series of complex follow-up treatment does not need to be carried out on a PCR product, PCR amplification and detection are synchronously carried out, the detection time is greatly shortened, and the detection cost is reduced.

A method for producing deoxyribonucleic acid (DNA) includes providing a circular DNA template. The method also includes conducting in vitro an amplification reaction on the circular DNA template to generate a DNA product that is rolling circle amplified, wherein a reaction fold-amplification is minimized to enhance protein expression from the DNA product, and wherein a rolling circle amplification reaction is conducted with at least one of (i) the rolling circle amplification reaction being conducted at 15 degrees Celsius to less than 25 degrees Celsius to minimize the reaction fold-amplification, (ii) the rolling circle amplification reaction being conducted with an input concentration of the circular DNA template being greater than 1 nanogram per milliliter to minimize the reaction-fold amplification, or (iii) the rolling circle amplification reaction being conducted with input concentrations of deoxyribonucleoside triphosphates being titrated to 1.2 millimolar or less per deoxynucleotide to minimize the reaction-fold amplification.

The invention provides a kit for DNA ligation reaction as well as a use method and application thereof. The kit comprises a first component and a second component, wherein the first component comprises a positively charged substance and a first buffer solution; the positively charged substance is selected from at least one of positively charged polypeptide, positively charged protein, positively charged synthetic macromolecule and positively charged glucan; the second component comprises a negatively charged substance and a second buffer solution; the negatively charged substance is selected from at least one of adenosine triphosphate, deoxyribonucleoside triphosphate, oligonucleotide and negatively charged polypeptide. The first component and the second component are arranged in the kit, when the first component and the second component are prepared into a reaction system, a condensate emulsion of hundreds of nanometers to several micrometers can be formed in situ, the condensate emulsion can spontaneously enrich all the components required by the reaction, and an emulsion matrix phase is a gel-like environment; and the ligation reaction efficiency and accuracy can be remarkably improved through the crowding effect between macromolecules.

The invention provides an improved method for identifying interaction between RNA and RNA binding protein, and relates to the field of biological analysis. Comprising the following steps: ultraviolet crosslinking: carrying out covalent crosslinking on RNA and binding protein in cells through ultraviolet rays, and fixing instantaneous transition of interaction between RNA and RNA binding protein; s2, cell lysis and fragmentation: splitting the cells treated in the step S1, and then cutting RNA into short fragments by using RNA enzyme; s3, immunoprecipitation: enriching the target RBP and the RNA fragment combined with the target RBP by using a specific antibody; s4, linker connection and library construction: firstly, carrying out reverse transcription on RNA molecules by using a random primer to form a cDNA first chain; then synthesizing a cDNA second chain by using dNTP (deoxyribonucleoside triphosphate) containing dUTP (deoxyuridine triphosphate) and DNA polymerase; carrying out terminal repair and A addition on the double-stranded DNA; connecting a double-chain DNA (deoxyribonucleic acid) joint with a protruding T basic group at the tail end; carrying out PCR amplification to obtain a sequencing library; and S5, performing high-throughput sequencing. The treatment of FastAP and PNK is omitted, the loss of RNA molecules is reduced, and the experimental period is shortened.

The invention discloses a group of primer composition, application thereof and a method for detecting the quality of deoxyribonucleoside triphosphate. The nucleotide sequences of primers are respectively shown as SEQ ID NO: 18 and SEQ ID NO: 19. The primer composition disclosed by the invention can be used for detecting the quality of the dNTP in a conventional biological laboratory, so that the subsequent PCR amplification efficiency is ensured.

A method for detecting a target polynucleotide, the method comprising: (1) providing a sample comprising or suspected of comprising the target polynucleotide; (2) subjecting the sample to an isothermal amplification, wherein the isothermal amplification comprises: combining the sample, one or more primers for the target polynucleotide, deoxyribonucleoside triphosphates (dNTPs), enzyme (s), and a magnesium salt, with functionalized gold nanoparticles, which are gold nanoparticles modified with poly (ethylene glycol) and 11-mercaptoundecanoic acid (MUA) (PEG / MUA-AuNPs), thereby forming an amplification mixture, and incubating the amplification mixture thereby forming an incubated mixture; and (3) detecting the target polynucleotide. The present method has high accuracy, sensitivity, specificity, is easy to operate, and can be used for decentralized (point-of-care / on-site) testing.

The present invention addresses the problem of providing a novel method for synthesizing a deoxynucleoside triphosphate or nucleoside triphosphate.　This method for synthesizing a deoxynucleoside triphosphate (dNTP) from a deoxyribonucleoside or synthesizing a ribonucleoside triphosphate (NTP) from a ribonucleoside is characterized by: adding, to a reaction vessel, (i) a deoxyribonucleoside or ribonucleoside as a starting material, (ii) a kinase capable of producing a deoxyribonucleoside monophosphate from the deoxyribonucleoside or a ribonucleoside monophosphate from the ribonucleoside, a kinase capable of producing a deoxyribonucleoside diphosphate from the deoxyribonucleoside monophosphate or a ribonucleoside diphosphate from the ribonucleoside monophosphate, and a pyruvate kinase as enzymes, and (iii) a nucleoside triphosphate or deoxynucleoside triphosphate and a phosphoenolpyruvic acid (PEP) as phosphoric acid donors, thereby adjusting a reaction solution; and reacting the same in one pot.

A LAMP assay system for detection of a respiratory virus is disclosed. The LAMP system includes a LAMP reaction mixture having a primer kit, a strand-displacing polymerase and deoxyribonucleoside triphosphates for amplifying a target sequence. The primer kit includes at least one of a first primer set specific to SARS-CoV-2, a second primer set specific to Influenza A, and a third primer set specific to Influenza B. The first primer set includes primers having nucleotide sequences of SEQ ID NOs: 1 to 6 and SEQ ID NOs: 13 to 18. The second primer set includes primers having nucleotide sequences of SEQ ID NOs: 25 to 30. The third primer set includes primers having nucleotide sequences of SEQ ID NOs: 44 to 49.

One or more enzymes are used to repair damage in synthetic DNA molecules that encode digital information. The enzymes are included in a repair mixture containing one or more of DNA polymerase, DNA ligase, T4 Endonuclease, Endonuclease IV, Endonuclease VIII, and uracil glycosylase. The repair mixture may also contain one or more of a buffering solution, oxidized nicotinamide adenine dinucleotide (NAD+), and deoxyribose nucleoside triphosphates (dNTPs). The synthetic DNA molecules are incubated with the repair mixture for approximately four hours. Use of the repair solution allows recovery of the digital information from damaged DNA molecules.

The invention relates to a chemiluminiscence homogeneous detection method of a monoclonal antibody and a kit. The chemiluminescence detection method comprises the following three steps: step 1, adding a sample to be detected into a reaction reagent 1 for recognition reaction, wherein the reaction reagent 1 contains anti-DNA1, anti-DNA2, double-stranded DNA3 / DNA4, annular DNA5, phi29 polymerase and deoxyribonucleoside triphosphate; step 2, adding a reaction reagent 2 to carry out heme (hemin) activation reaction, wherein the reaction reagent 2 contains hemin dimerization low-activity double-chain DNA6-hemin / DNA7-hemin; 3, a detection reagent 1 and a detection reagent 2 are added at the same time, chemiluminescence signals are generated, the detection reagent 1 is a luminol solution containing imidazole, and the detection reagent 2 is a hydrogen peroxide solution. And finally, quantitatively detecting the monoclonal antibody in the sample according to the intensity of the chemiluminescence signal. The method has the advantages of being high in sensitivity, good in specificity, convenient to operate and the like, and has important significance in the fields of antibody drug screening, production and the like.