Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Novel technology for detecting viruses of arbovirus encephalitis

A technology of encephalitis virus and insect vector, applied in the field of virus molecular biology, can solve the problems of automation and high-throughput obstacles, easy delay in diagnosis, low specificity, etc., and achieve simple and stable reagent consumables, reduced use, and high sensitivity Effect

Active Publication Date: 2011-09-28
BGI GENOMICS CO LTD +1
View PDF4 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0007] 1. Hemagglutination inhibition test: Although the sensitivity is high, the specificity is low
[0008] 2. Complement fixation test: Complement fixation antibodies only exist in IgG, and appear late after the disease, which is easy to delay diagnosis
[0009] 3. Neutralization test: The neutralization test has high specificity and sensitivity, but the operation is complicated and requires a large number of animals or tissue culture tubes, which takes a long time and is not suitable for routine use in clinical diagnosis
However, there are still obstacles in terms of automation and high throughput, and the operation is more complicated

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Novel technology for detecting viruses of arbovirus encephalitis
  • Novel technology for detecting viruses of arbovirus encephalitis
  • Novel technology for detecting viruses of arbovirus encephalitis

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0065] In the present embodiment, a method for detecting 8 kinds of arboencephalitis viruses is provided, the method includes the following steps:

[0066] (1) Obtain target sequence amplification products by PCR amplification. The PCR amplification primer pair used herein is the following primer pair with the tag sequence acgttggatg (SEQ ID NO: 25) connected to the 5' end: SEQ ID NO: 1 and 2, SEQ ID NO: 3 and 4, SEQ ID NO: 5 and 6, SEQ ID NO: 7 and 8, SEQ ID NO: 9 and 10, SEQ ID NO: 11 and 12, SEQ ID NO: 13 and 14, and SEQ ID NO: 15 and 16; using extension primer SEQ ID NO : 17-24 are shown in Table 3 respectively.

[0067] Table 3: Extension primers for the 8 arboviruses used in this example.

[0068] SEQ ID NO:

Primer sequence 5'→3'

extended base

17

AGCTGCTGGAAAGAACCT

A

18

TCCCTATGGACCAGAAATGA

C

19

GCTTTGGCGACCACATGGAAA

G

20

CTCCCTTTTTGGAACCATTGGTG

A

21

TGGCACATACGTGCACACGGGAAA ...

Embodiment 2

[0089] In this embodiment, all the steps and processing methods are the same as those in Embodiment 1 except for the sample pre-treatment. The sample in this embodiment is TBEV pure virus, utilizes the E.Z.N.A. of Omega Company. Viral RNA Kit was used to extract sample RNA, and the operation steps were performed according to the kit instructions. Using PrimeScript purchased from Takara The RT reagent Kit reverse-transcribes the extracted RNA sample into cDNA.

[0090] The steps are the same as steps (1)-(5) in Example 1, except that the template DNA used in the PCR amplification reaction system of step (1) is the above-mentioned template cDNA.

[0091] The following combination Figure 9 with Figure 10 , to analyze and explain the cDNA detection results of TBEV pure virus culture samples and mixed cDNA detection results of TBEV, JEV, WEEV and RabV pure virus culture samples.

[0092] from Figure 9 It can be seen that when TBEV pure virus cDNA is used as a template, M...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a method capable of detecting common viruses of arbovirus encephalitis. The invention also relates to an amplification primer and an extension primer which are used for detecting the common viruses of arbovirus encephalitis, and a kit containing the primers.

Description

technical field [0001] The invention relates to the field of virus molecular biology, in particular to a detection method for encephalitis virus. The present invention also relates to amplification primers and extension primers for the detection of encephalitis virus, and kits comprising these primers. Background technique [0002] Arboviral encephalitis is a disease of the central nervous system caused by neurotropic arboviruses. Neurotropic arboviruses are a group of viruses that use blood-sucking insects as the medium of transmission. Many of them can cause acute encephalitis, which is very dangerous and has a high fatality rate, which will cause serious public health problems. Neurotropic arboviruses mainly include: Japanese encephalitis virus (JEV) of the Flavivirus genus, St. -borne encephalitis virus (TBEV) and West Nile virus (WNV); eastern equine encephalitis virus (EEEV) of the genus Alphavirus (Alphavirus), western equine encephalitis virus (western equine encep...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/70C12Q1/68
Inventor 陈唯军杨银辉管彦芳康小平刘利成姜永强吴伟立王鹏志
Owner BGI GENOMICS CO LTD
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com