JEV (Japanese type B encephalitis virus) nucleic acid assay kit and application thereof
A type of Japanese encephalitis virus and kit technology, applied in the biological field, can solve the problems of disease prevention and control and community detection can not fully play a role, insufficient implementation of immunization, low vaccination rate of Japanese encephalitis, etc., easy to achieve large-scale Promote the application, solve the effect of expensive equipment and quick response
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0031] 1. Primer design: Download the nucleic acid sequence from Genebank, select the conserved segment of Japanese encephalitis virus, and design and synthesize RPA primers with the following sequence.
[0032] primerA: TGTGTCTTGACCGTGGTTGGAATGGTGGCAGC;
[0033] primerB: GGTTAGCACGACTGTGCTCCCCATACAATGC.
[0034] 2. Probe design:
[0035] 5'-GTACGGGATGCTGGAAAAAACCAAAGCAGAT / THF / TCAAGAGCATGTTTGG / C3-spacer / -3'. The dT near the 5' end (31bp) is labeled with FAM, and the dT near the 3' end (33bp) is labeled with BHQ1.
[0036]Primers and probes were synthesized by Shanghai Sangon Bioengineering Co., Ltd.
[0037] RPA lyophilized reagent, buffer and magnesium salt solution were purchased from TwistAmp of TwistDX Company TM Reagent test kit.
[0038] 3. Reaction system: Add 29.5 μL Rehydration Buffer, 2.1 μL 10 μM PrimerA, 2.1 μL 10 μM Primer B, 0.6 μL 10 μM probe and 10.7 μL double distilled water to the RPA lyophilized reagent. Add 2.5 μL of magnesium acetate to the cap of th...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap