Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

JEV (Japanese type B encephalitis virus) nucleic acid assay kit and application thereof

A type of Japanese encephalitis virus and kit technology, applied in the biological field, can solve the problems of disease prevention and control and community detection can not fully play a role, insufficient implementation of immunization, low vaccination rate of Japanese encephalitis, etc., easy to achieve large-scale Promote the application, solve the effect of expensive equipment and quick response

Active Publication Date: 2016-02-24
INST OF BASIC MEDICAL SCI ACAD OF MILITARY MEDICAL SCI OF PLA
View PDF1 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In 2008, JE vaccine was included in the planned immunization project, and the incidence rate was relatively controlled. However, due to insufficient implementation of immunization in some areas, especially in towns and towns with relatively poor sanitation and epidemic prevention conditions, the JE vaccination rate is not high
However, the PCR method requires expensive instruments and strict laboratory conditions, which are only equipped in large general hospitals and scientific research institutions with excellent equipment, which limits its application and makes it unable to fully play its role in disease prevention and control and community testing
There is no report on the use of RPA technology to detect Japanese encephalitis virus

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • JEV (Japanese type B encephalitis virus) nucleic acid assay kit and application thereof
  • JEV (Japanese type B encephalitis virus) nucleic acid assay kit and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0031] 1. Primer design: Download the nucleic acid sequence from Genebank, select the conserved segment of Japanese encephalitis virus, and design and synthesize RPA primers with the following sequence.

[0032] primerA: TGTGTCTTGACCGTGGTTGGAATGGTGGCAGC;

[0033] primerB: GGTTAGCACGACTGTGCTCCCCATACAATGC.

[0034] 2. Probe design:

[0035] 5'-GTACGGGATGCTGGAAAAAACCAAAGCAGAT / THF / TCAAGAGCATGTTTGG / C3-spacer / -3'. The dT near the 5' end (31bp) is labeled with FAM, and the dT near the 3' end (33bp) is labeled with BHQ1.

[0036]Primers and probes were synthesized by Shanghai Sangon Bioengineering Co., Ltd.

[0037] RPA lyophilized reagent, buffer and magnesium salt solution were purchased from TwistAmp of TwistDX Company TM Reagent test kit.

[0038] 3. Reaction system: Add 29.5 μL Rehydration Buffer, 2.1 μL 10 μM PrimerA, 2.1 μL 10 μM Primer B, 0.6 μL 10 μM probe and 10.7 μL double distilled water to the RPA lyophilized reagent. Add 2.5 μL of magnesium acetate to the cap of th...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a JEV (Japanese type B encephalitis virus) nucleic acid assay kit and application thereof. The kit comprises RPA (recombinase polymerase amplification) freeze-dried reagents, PRA reaction primers, an RPA reaction probe, buffer solution, magnesium salt solution and double-distilled water. The RPA reaction probe is used for real-time quantitative detection of RPA nucleic acid amplification products. Low contamination is achieved due to the fact that users do not need to open caps during the whole detection. The whole reaction is performed in a constant temperature of 38 DEG C, and users can determine and read results within 5-20 minutes by observing fluorescent curves. The JEV nucleic acid assay kit has the advantages of high sensitivity and specificity, operational convenience, quick reaction, portability, low contamination and the like.

Description

technical field [0001] The invention belongs to the field of biotechnology, in particular to a kit for detecting Japanese encephalitis virus nucleic acid and its application. Background technique [0002] Japanese encephalitis is a zoonotic natural foci disease, with blood-sucking insects such as Culex tritaeniorhynchus as the main vector, and is one of the main infectious diseases prevalent in summer and autumn in my country. The disease is an acute infectious disease mainly caused by central nervous system lesions. Clinically, the onset is sudden, with symptoms such as high fever, disturbance of consciousness, convulsions, tonic convulsions, and meningeal irritation. Severe patients often have sequelae after recovery, which is harmful to children. great. [0003] JE was first discovered in Japan in the 1870s, and there have been pandemics every 10 years since then. In 2008, JE vaccine was included in the planned immunization project, and the incidence rate was relatively...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/70C12Q1/68
CPCC12Q1/6844C12Q1/70C12Q2521/507C12Q2522/101C12Q2537/1376
Inventor 徐东刚邢微微孙魁付文亮
Owner INST OF BASIC MEDICAL SCI ACAD OF MILITARY MEDICAL SCI OF PLA
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products