Bacillus altitudinis and application thereof in prevention and treatment of tobacco black shank

Abstract

The invention discloses bacillus altitudinis and application thereof in preventing and treating tobacco black shank, the bacillus altitudinis CY1 with high inhibitory activity on phytophthora nicotianae is obtained by separating and screening from a test field of a Yimeng modern tobacco science and technology park in Yimeng city, and the preservation number of the bacillus altitudinis CY1 is CCTCC NO: M 20241744. The strain biological agent has good biocontrol potential on tobacco black shank, and a new strain resource is provided for preventing and treating tobacco black shank in production. When the bacillus altitudinis CY1 and the 30% hymexazol-methyl aqueous solution 600-fold solution are compounded for use, the control effect on tobacco black shank in a pot experiment is 84.5%, the control effect in a field experiment is 87.3%, the control effect is remarkable, and the pesticide use amount can be reduced; secondly, the price cost of independent use of the biocontrol bacteria can be reduced, the tobacco planting cost is effectively reduced, and the biocontrol bacteria can be applied and popularized on a large scale in tobacco planting production.

Description

Technical Field

[0001] The invention belongs to the technical field of tobacco disease biological prevention and control, and specifically relates to a highland bacillus and application thereof in preventing and controlling tobacco black shank disease. Background Art

[0002] Tobacco black shank, caused by Phytophthora parasitica, is one of the most devastating rhizome diseases in tobacco production worldwide. Under high temperature and high humidity conditions, the disease can easily cause large-scale outbreaks and rapid epidemics in tobacco fields, causing yellowing and necrosis of leaves, dark brown pith and shrinkage into a "disc shape", dwarfing of tobacco plants and obvious sunken lesions on the surface, so it is also called "black plaster", "waist leakage" and "wearing a coat". In recent years, with the continuous increase in the number of years of tobacco cultivation and continuous cropping area in China, tobacco black shank has become more and more serious year by year. It has occurred in major tobacco-growing areas such as Hubei, Hunan, Yunnan, Guizhou, Shandong, Henan, Anhui, Jiangxi, Guangdong, Fujian, and Sichuan in my country. In severe cases, the incidence rate of tobacco fields is as high as 75%, and even causes total production. It is reported that tobacco black shank causes an annual tobacco production loss of about 2.86×10 7 kg, with direct annual economic losses exceeding 123 million yuan, and has become one of the bottlenecks restricting the high-quality development of the tobacco industry.

[0003] At present, field control measures for tobacco black shank include agricultural control, chemical control and biological control, and mainly rely on chemical control. Ren Xiaofen (Ren Xiaofen, Qi Wenzhe, Cheng Xingkai, et al. Effect of fluazifop-p-butyl on tobacco black shank and its effect on tobacco plant growth [J]. Journal of Chinese Tobacco Science, 2018, 24(04): 129-134.) found that 92% fluazifop-p-butyl had a control effect of 81.5% on tobacco black shank. However, due to the complex genetic diversity and evolutionary mechanism of tobacco phytophthora, the long-term use of chemical pesticides has caused a significant increase in the resistance of tobacco phytophthora, the control effect has gradually decreased, and the difficulty and cost of control have increased sharply. In addition, the continuous and large-scale use of chemical pesticides and irregular application in tobacco fields have caused problems such as pesticide residues, environmental pollution, and destruction of natural ecosystems. With the development of modern agricultural technology, biological control has many advantages such as long duration, no pesticide residues, and high environmental safety, and has become a research hotspot for tobacco disease control. Studies have shown that the development and promotion of high-efficiency biocontrol agents is one of the most important ways to achieve efficient and green prevention and control of tobacco black shank. CN111919859A discloses a method for synergistically preventing and controlling tobacco black shank using Bacillus amyloliquefaciens and salicylic acid. Bacillus amyloliquefaciens ZY-9-13 and salicylic acid are compounded in a mass ratio of 75-85:15-25. The two can be synergistically applied to the prevention and control of tobacco black shank, significantly improving the field prevention and control effect of tobacco black shank. CN117586915A discloses a strain of Bacillus subtilis JH6 and its application. A strain of Bacillus subtilis JH6 was screened to have an inhibitory effect on tobacco phytophthora. The fermentation liquid has a prevention effect of 79.41% on detached eggplant fruits and 82.86% on detached eggplant leaves. It plays an effective role in the prevention and control of eggplant cotton blight. The Bacillus subtilis obtained in this invention mainly acts on the fruits and leaves of detached eggplants. There is a lack of actual field prevention and control effect verification, and the promotion value is insufficient.

[0004] Although some biocontrol strains against tobacco black shank have been screened and identified, there is still a serious lack of efficient and broad-spectrum biocontrol strains with good development potential. It is still necessary to explore strain resources with obvious prevention effects on tobacco black shank and design a tobacco black shank prevention and control plan with more outstanding effects and practical promotion value, which is of great significance to the development of the tobacco industry. At present, no technical solution has been found to use highland Bacillus in combination with drugs to synergistically prevent and control tobacco black shank. Summary of the invention

[0005] In view of the above problems, the present invention provides a strain of Bacillus altitudinis and an application thereof in preventing and controlling tobacco black shank disease. The strain is Bacillus altitudinis CY1, which has good biocontrol potential for tobacco black shank disease, provides a new bacterial resource for using Bacillus altitudinis to prevent and control tobacco black shank disease in production, and has a broad-spectrum antibacterial effect, which provides a reference for the prevention and control of other tobacco diseases; secondly, when the Bacillus altitudinis CY1 biological bacterial agent is compounded with methamphetamine and oxazolidinone, the prevention effect of the CY1 biological bacterial agent can be improved, the occurrence and spread of tobacco black shank disease can be effectively prevented and controlled, and the use of pesticides in the field can be reduced, showing broad application prospects.

[0006] The above-mentioned object of the present invention is achieved by the following technical scheme: The present invention isolates and screens Bacillus saltitudinis CY1 with high inhibitory activity against tobacco phytophthora from the experimental field of Yishui Modern Tobacco Science and Technology Park in Linyi City, Shandong Province. The strain has been deposited in the China Center for Type Culture Collection on August 5, 2024, with a deposit number of CCTCC NO: M 20241744, and the deposit address is Wuhan University, Wuhan, China. The strain grows on LB plate culture medium, and the colonies are nearly round, yellow, with regular edges, smooth and shiny surfaces, opaque, non-viscous, and low fluidity.

[0007] The invention also provides a biological bacterial agent with Bacillus altitudinis CY1 as an effective ingredient.

[0008] The preparation method of the above-mentioned Bacillus CY1 biological agent is characterized in that, under sterile conditions, the seed liquid of Bacillus CY1 is inoculated into the fermentation medium at a volume ratio of 1-3%, 28-32°C, 200-240r·min -1 After constant temperature shaking culture for 36-72h, the highland Bacillus CY1 biological agent was obtained, and the effective viable count was 1×10 6 ~1×10 8 CFU·mL -1 .

[0009] Furthermore, the fermentation medium formula is: yeast powder 10-20g / L, peptone 5-15g / L, glucose 5-15g / L, pH 6.8-7.2.

[0010] The preparation method of the above-mentioned highland Bacillus CY1 seed liquid is as follows: under sterile conditions, highland Bacillus CY1 is streaked on LB solid culture medium, and after constant temperature activation culture at 26-30°C for 24-48 hours, a single colony is picked and inoculated into a seed liquid culture medium, and after constant temperature shaking culture at 26-30°C and 180-200r / min for 36-48 hours, CY1 seed liquid is obtained. The seed liquid culture medium formula is: yeast powder 5-8g / L, peptone 9-11g / L, NaCl 10-15g / L, pH 6.8-7.2.

[0011] The invention provides application of Bacillus altitudinis CY1 in tobacco diseases. The tobacco disease is one of tobacco black shank disease, tobacco root rot, tobacco target spot disease, tobacco brown spot disease, tobacco damping-off disease and tobacco anthrax.

[0012] Another object of the present invention is to provide the use of Bacillus altitudinis CY1 biological agent in preventing and controlling tobacco black shank disease.

[0013] The specific methods of the above application are as follows:

[0014] (1) compounding the Bacillus subtilis CY1 biological agent with 600 times dilution of 30% ammonia-oxadone aqueous solution;

[0015] (2) In the early stage of tobacco transplanting, the compound liquid is applied to prevent and control tobacco black shank disease.

[0016] Furthermore, the concentration of the Bacillus subtilis CY1 biological agent in step (1) is 1×10 4 ~1×10 8 CFU·mL -1 .

[0017] Furthermore, the compounding ratio in step (1) is 1-3:2-6 by volume.

[0018] Furthermore, the dosage of the compound liquid in step (2) is 150-200 ml / 100 plants. After the tobacco plants are irrigated once 8-12 days after transplanting, the treatment is performed once every 15-25 days, and the treatment is continued for 2-4 times.

[0019] Beneficial effects:

[0020] (1) The Bacillus CY1 screened by the present invention has good biocontrol potential against tobacco black shank disease, providing a new bacterial resource for the use of Bacillus CY1 to control tobacco black shank disease in production. It has a broad-spectrum antibacterial effect and also provides a reference for the prevention and control of other tobacco diseases.

[0021] (2) When the highland Bacillus CY1 biological agent is used in combination with 600 times diluted 30% ammonia-methyl aqueous solution, the prevention effect on tobacco black shank disease is 84.5% in pot tests and 87.3% in field tests. The prevention effect is significant, which can reduce the amount of pesticides used and effectively alleviate the environmental pollution caused by the use of chemical pesticides, which is in line with the current development direction of environmentally friendly green agriculture.

[0022] (3) The combination of Bacillus subtilis CY1 and 600 times diluted 30% ammonia-chlor ammonia solution also reduces the price cost of using the biocontrol bacteria alone. The combination of the two combines the labor and time costs of using pesticides and biocontrol bacteria into one, which can significantly reduce the planting cost and can be widely used in tobacco planting and production. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 The figure shows the inhibitory effect of Bacillus subtilis CY1 on tobacco phytophthora; A is the control of tobacco phytophthora without CY1 inoculation; B is the inhibitory effect of CY1 inoculation on tobacco phytophthora;

[0024] Figure 2 This is the colony morphology of Bacillus subtilis CY1 on LB medium;

[0025] Figure 3 This is the phylogenetic tree of Bacillus CY1 based on 16S rDNA and gyrB sequences;

[0026] Figure 4 Figure 1 is a graph showing the inhibitory effect of different concentrations of Bacillus subtilis CY1 on tobacco phytophthora; A is a graph showing the inhibitory effect of liquid culture medium without CY1 inoculation on tobacco phytophthora; B is a graph showing the inhibitory effect of liquid culture medium with a concentration of 1×10 4 CFU·mL -1 The inhibitory effect of CY1 biological agent on tobacco phytophthora; C is the concentration of 1×10 6 CFU·mL -1 The inhibitory effect of CY1 biological agent on tobacco phytophthora; D is the concentration of 1×10 8 CFU·mL -1 The inhibitory effect of CY1 biological agent on tobacco phytophthora. DETAILED DESCRIPTION

[0027] The following will combine the contents in the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0028] The test pathogens: Phytophthora parasitica, Fusarium oxysporum, Fusarium solani, Rhizoctonia solani, Alternaria alternata, Pythium myriotylum and Colletotrichum nicotianae are all stored in the National Plant Protection Microbial Germplasm Resource Bank (Shandong).

[0029] 600-fold dilution of 30% cypermethrin-aminobenzoic acid aqueous solution was purchased from Jiangsu Heben Biochemical Co., Ltd., DNA extraction kit was purchased from Kangwei Century Biotechnology Co., Ltd., and gel recovery kit was purchased from Tiangen Biochemical Technology (Beijing) Co., Ltd.

[0030] Example 1 Isolation and purification of Bacillus subtilis strain CY1

[0031] 1. Strain Isolation and Purification Method

[0032] (1) Separation source

[0033] The Bacillus CY1 involved in the present invention is isolated from the rhizosphere soil of healthy tobacco plants in the experimental field (118°62'E, 35°79'N) of Yishui Modern Tobacco Science and Technology Park in Linyi City, Shandong Province, where the incidence of tobacco black shank disease exceeds 80%.

[0034] (2) Separation time and place

[0035] It was isolated and obtained in July 2021 at the Key Laboratory of Agricultural Microbiology of Shandong Province, Shandong Agricultural University.

[0036] (3) Separation and purification steps

[0037] The dilution coating method is used for separation. The specific method is as follows:

[0038] ① Sample collection: 15 samples of rhizosphere soil from healthy tobacco plants were collected from tobacco fields with a tobacco black shank incidence rate of more than 80% in the experimental field of Yishui Modern Tobacco Science and Technology Park, Linyi City, Shandong Province (118°62'E, 35°79'N), packed in fresh-keeping bags and placed in foam boxes containing biological ice packs, and transported back to the laboratory; each fresh-keeping bag was marked with information such as the collection time, collection location, and collector;

[0039] ② Separation and preservation: Weigh 10g of soil sample and place it in 90mL of sterile water. Oscillate on a shaker at 28℃ for 30min. Use the gradient dilution method to prepare 10 2 Up to 10 50.2 mL of each dilution was spread on a solid LB plate and cultured at 28°C for 36 h. Single colonies with obvious differences in colony morphology were picked and streaked on LB solid medium plates for purification. The purification experiment was repeated 3 times. The purified strains were suspended in 30% glycerol and frozen in a -80°C refrigerator for later use.

[0040] 2. Results Analysis

[0041] Using the above method, a total of 89 bacterial isolates were screened from the collected rhizosphere soil.

[0042] Example 2 Screening of Bacillus CY1 with High Efficiency in Inhibiting Phytophthora nicotianae

[0043] 1. Preparation of bacterial suspensions of different strains to be tested

[0044] Under sterile conditions, 89 bacterial isolates to be tested were streaked onto LB solid culture medium, activated and cultured at 28°C for 2 days, and the presence of contamination was observed to obtain different bacterial strains to be tested.

[0045] 2. Detection of the inhibitory effect of different bacterial strains on tobacco phytophthora

[0046] Under sterile conditions, tobacco blight was inoculated on oatmeal culture medium and cultured at 25℃ for 7 days. A sterile picking needle was used to pick up a circular bacterial block with a diameter of 5 mm and inoculated into the center of a new oatmeal plate culture medium. A sterile transfer ring was then used to inoculate the bacterial strain to be tested 3 cm away from the edge of the bacterial block. After cultured at 25℃ for 4 days, the radius of the inhibition zone was observed and recorded, and its inhibition rate was calculated. Each treatment was repeated 3 times, and finally the strain with the largest inhibition rate was screened for subsequent experiments.

[0047] Inhibition rate = (colony diameter of control group - colony diameter of treatment group) / (colony diameter of control group - diameter of bacterial cake) × 100%

[0048] 3. Results Analysis

[0049] Using the plate confrontation method, it was found that 21 bacterial isolates had an inhibitory effect on tobacco phytophthora. Figure 1 A), among which the bacterial strain numbered CY1 had the most obvious antibacterial effect ( Figure 1 B), the inhibition rate was 68.6%. After five generations of continuous subculture, the inhibition ability of CY1 against tobacco phytophthora was stable.

[0050] Example 3 Identification of Bacillus subtilis strain CY1

[0051] (1) Analysis of colony morphology: The strain grew on LB plate medium (10 g tryptone, 5 g yeast extract, 10 g sodium chloride, 15 g agar powder, dissolved in 1 L water). The single colony of CY1 was nearly round, yellow, with regular edges, smooth and shiny surface, opaque, non-viscous, and low fluidity ( Figure 2 ).

[0052] (2) Analysis of physiological and biochemical characteristics: With reference to the Bergey's Manual of Bacterial Identification, the physiological and biochemical characteristics of strain CY1 were detected and analyzed. As shown in Table 1, the results showed that strain CY1 could utilize glucose, sucrose, mannitol, and glycerol, but could not utilize dextran and galactose; Gram staining reaction, VP test, ONPG test, catalase reaction, methyl red reaction, and gelatin liquefaction reaction were all positive, and strain CY1 was identified as Bacillus altitudinis.

[0053] Table 1 Physiological and biochemical characteristics of strain CY1

[0054]

[0055] (3) Molecular biological characteristics:

[0056] 1. Test methods

[0057] The genomic DNA of strain CY1 was extracted using a bacterial genomic DNA extraction kit. The 16S rRNA gene of CY1 was amplified by PCR, and the universal primers of bacterial 16S rRNA gene were:

[0058] 27F:5'-AGAGTTTGATCCTGGCTCAG-3';

[0059] 1492R:5'-GGTTACCTTGTTACGACTT-3';

[0060] PCR amplification of the gyrB gene of CY1, universal primers of the gyrB gene:

[0061] F:5'-TTGRCGGHRGYGGHTATAAAGT-3';

[0062] R:5'-TCCDCCSTCAGARTCWCCCTC-3';

[0063] In the above, R represents A / G, H represents A / T / C, Y represents C / T, D represents G / A / T, S represents G / C, and W represents A / T. Primers were synthesized by Sangon Biotech (Shanghai) Co., Ltd.

[0064] The PCR reaction system (25 μL) of 16S rRNA and gyrB genes was: 1 μL cDNA template, 2.5 μL 10× Buffer (Mg2+), 2 μL dNTP (2.5 mmol·L-1), 0.3 μL Taq DNA polymerase, and 0.5 μmol·L upstream and downstream primers. -1 ) 1 μL each, ddH2O 17.2 μL.

[0065] The PCR reaction conditions for 16S rRNA gene were: 94℃5min; 94℃30s, 52℃30s, 72℃90s, 32 cycles; 72℃10min. The PCR reaction conditions for gyrB gene were: 94℃5min; 94℃40s, 55℃40s, 72℃90s, 30 cycles; 72℃10min.

[0066] The PCR products were detected by 1% agarose gel electrophoresis, and the amplified target fragments were recovered by gel recovery kit and sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing. The sequences obtained by sequencing were compared by Blast in GenBank, and the 16S rDNA and gyrB gene sequences with high homology were selected to construct a phylogenetic tree by the Neighbor-Joining method in MEGA 11 software.

[0067] 2. Results Analysis

[0068] The 16S rDNA gene sequence of the strain is as follows (SEQ-1):

[0069]

[0070] The results of the gyrB gene sequence determination of the strain are as follows (SEQ-2):

[0071] ttgacggcagcggttataaagtatctggcggtctgcatggtgtaggggcatctgttgttaatgcgttatctacgaccttagacgtgaccgtataccgtgatgggaaaattcattatcaacaattcaaacgcggtgttccagttggagatttagagatcattggtgaaacagatgtaacagggacaaccactcattttgtgccagatccagaaatttttactgaaaccattgaatttgattacgacacacttgctaaccgtgtacgtgagttagctttcttaacaaaaggcgtcaacatcatcattgaagacttacgcgaaggtaaagagcgaagaaacgaatactgctatgaaggcggtattaagagctatgtagaacatttgaatcgctcgaaagaagtcgttcatgaagaacctgtttacatcgaaggcgaaaaagacggaatcacggttgaagtggcattacaatataacgattcctatacaagcaacatctattccttcgctaacaatatcaacacgtatgaaggcggaacacatgaagcaggctttaaaaccggtctgacgcgtgtgatcaatgattatgctcgtaaaaatggcgtattcaaagatggtgactcgaatttgagcggtgaagatgtacgagaaggcttaacagccattatctctatcaaacatccagaccctcaattcgaaggacaaacgaagacaaagctcggtaactcagaagcaagaaccattaccgactccctcttctccgaagcacttgagaaattcctcttagagaaccctgatgctgcaaagaaaattgtggagaaaggtgtgatggcagctcgtgcaagaatggctgccaaaaaggcacgtgagctgacaagacgtaaaagtgcactggaagtctctagcttgcctgggaaactggcagactgttcttctaaagatccttccatctctgagctttatatcgtagagggagattctgagggcgga

[0072] like Figure 3 As shown, the phylogenetic tree constructed by 16S rDNA and gyrB genes of CY1 and closely related bacteria showed that strain CY1 was clustered with Bacillus altitudinis strains CCM7 and KUDC1738. Combined with the morphological, physiological and biochemical and molecular biological characteristics, strain CY1 was identified as Bacillus altitudinis. The strain was deposited in the China Center for Type Culture Collection on August 5, 2024, with the deposit number CCTCC NO: M 20241744.

[0073] Example 4 Antibacterial spectrum of Bacillus subtilis strain CY1

[0074] 1. Test methods

[0075] The plate confrontation method was used to detect and analyze the antibacterial effect of Bacillus CY1 on tobacco phytophthora, Fusarium oxysporum, Fusarium solani, Rhizoctonia solani, Alternaria solani, Pythium solani, and Colletotrichum nicotianae. Under sterile conditions, tobacco phytophthora was inoculated on oat culture medium, and Fusarium oxysporum, Fusarium solani, Rhizoctonia solani, Alternaria solani, Pythium solani, and Colletotrichum nicotianae were inoculated on PDA solid culture medium at 25℃ for 7 days. Then, a sterile pick was used to pick a circular bacterial block with a diameter of 3 mm and inoculated into the center of new oat and PDA plate culture medium respectively; then, a sterile transfer loop was used to inoculate strain CY1 at 3 cm from the edge of the bacterial block, and cultured at 25℃ for 4 days. The antibacterial effect was observed and the antibacterial rate was calculated. Each treatment was repeated 3 times.

[0076] Inhibition rate = (colony diameter of control group - colony diameter of treatment group) / (colony diameter of control group - diameter of bacterial cake) × 100%

[0077] 2. Results Analysis

[0078] The antibacterial spectrum of strain CY1 was detected and analyzed by confrontation culture method. The results are shown in Table 2. CY1 has different degrees of inhibitory effect on 7 common tobacco pathogens. Among them, the inhibitory effect on Fusarium oxysporum (inhibition rate is 65.1%) and Fusarium solani (inhibition rate is 64.8%) is second only to the inhibitory effect on tobacco phytophthora (inhibition rate is 68.6%), while the inhibition rate on tobacco anthracnose is the lowest, which is 52.7%. The above results show that strain CY1 has a broad-spectrum antibacterial ability against tobacco disease pathogens.

[0079] Table 2 Antibacterial effect of strain CY1

[0080] Pathogens Common diseases Antibacterial rate / % Phytophthora nicotianae Tobacco Black Leg 68.6±1.3a Fusarium oxysporum Tobacco root rot 65.1±2.1ab Fusarium solani Tobacco root rot 64.8±1.6ab Rhizoctonia solani Tobacco target spot 58.9±1.7b Alternaria alternata Tobacco brown spot 56.3±2.3c Pythium Tobacco damping-off disease 54.1±1.4c Tobacco Anthrax Tobacco Anthrax 52.7±0.9d

[0081] Note: Different letters indicate significant differences (P<0.05).

[0082] Example 5 Preparation process of Bacillus subtilis CY1 biological agent

[0083] Seed liquid culture medium formula: yeast powder 5g, peptone 10g, NaCl 10g, deionized water to 1000mL, pH7.

[0084] Fermentation medium formula: 15 g yeast powder, 10 g peptone, 10 g glucose, dilute to 1000 mL with deionized water, pH 7.

[0085] Seed liquid acquisition: Under sterile conditions, Bacillus CY1 was streaked on LB solid medium, and after activation culture at 28°C for 36 hours, a single colony was picked and inoculated into a 250 mL Erlenmeyer flask containing 50 mL of seed liquid medium at 28°C and 200 r·min. -1 After constant temperature shaking culture for 48 hours, CY1 seed solution was obtained.

[0086] Obtaining the biological agent: Under sterile conditions, inoculate 1% of the above seed solution into a triangular flask containing fermentation medium at 30°C and 220 r / min. -1 After 48 h of constant temperature shaking culture, the highland Bacillus CY1 biological agent was obtained, and the effective viable count was 1×10 6 ~1×10 8 CFU·mL -1 .

[0087] Example 6 Inhibitory effect of Bacillus subtilis CY1 biological agent on tobacco phytophthora

[0088] Using the Oxford cup confrontation culture method, 200 μL of different concentrations of CY1 biological agent (1×10 4 CFU·mL -1 , 1×10 6 CFU·mL -1 , 1×10 8 CFU·mL -1 ) were added into a sterilized Oxford cup and cultured on solid oatmeal medium with tobacco blight at 25°C for 7 days. Then, the liquid culture medium without CY1 biological agent was used as the control. Each treatment was repeated 3 times to observe the antibacterial effect.

[0089] like Figure 4 As shown, 1×10 4 CFU·mL -1 The concentration of biological agents can significantly inhibit the growth of tobacco phytophthora, and the inhibitory effect is significantly enhanced with the increase of bacterial concentration. 8 CFU·mL -1 The CY1 biological agent had the best inhibitory effect.

[0090] Example 7 Test on the efficacy of the highland Bacillus CY1 biological agent and the combination of oxadiazine and oxadiazine on tobacco black shank disease

[0091] (1) Greenhouse potted plant protection test

[0092] 1. Greenhouse potted plant protection test method

[0093] Healthy tobacco plants with 5-7 leaves of the main tobacco variety NC55 in Linyi, Shandong Province were selected and the 20 mL of 1×10 5 CFU·mL -1 The tobacco plants were irrigated with the spore suspension of tobacco phytophthora nicotianae. After 3 days, 30 mL of 1×10 7 CFU·mL -1 The tobacco roots were irrigated with CY1 biological bacteria agent, 600 times diluted 30% cypermethrin water, and a mixed solution of the two at a volume ratio of 1:2. The treatment was performed once every 15 days for 3 consecutive times. 15 days after the last treatment, the incidence of tobacco black shank was observed and recorded. The greenhouse conditions were constant temperature of 28℃ and humidity of 85%. Clear water was used as the control (CK). Each treatment had 20 tobacco plants and each treatment was repeated 3 times.

[0094] The incidence of black shank disease was investigated according to the national standard GB / T 23222-2008 tobacco pest classification. The calculation formula is as follows:

[0095] Incidence rate = number of diseased plants / total number of plants investigated × 100%;

[0096] Disease index = ∑ (number of plants at each disease level × number of diseased plants) / (highest number of diseased plants × total number of plants) × 100;

[0097] Control effect = (control disease index - treatment disease index) / control disease index × 100%.

[0098] 2. Results Analysis

[0099] As shown in Table 3, the results show that after the application of CY1 biological agent, oxazolidinone and the mixed solution of the two in a volume ratio (1:2), the incidence rate and disease index of tobacco black shank were significantly lower than those of the water control, and the control effect of the mixed preparation was significantly higher than that of CY1 biological agent. In addition, in the mixed agent, the control effect of CY1 biological agent and oxazolidinone in a volume ratio of 1:2 reached 84.5%, which was significantly better than the 71.7% of CY1 biological agent alone, and there was no significant difference with the control effect of only oxazolidinone (89.4%), but it significantly reduced the use of chemical pesticides.

[0100] Table 3 The results of the control effect of different preparations on potted tobacco black shank

[0101]

[0102] Note: Different letters indicate significant differences (P<0.05).

[0103] (2) Field control efficacy test

[0104] 1. Field control effectiveness test method

[0105] A field experiment was conducted in the experimental field of Yishui Modern Tobacco Science and Technology Park in Linyi City, Shandong Province. The main tobacco variety was NC55. On the 10th day after the tobacco seedlings were transplanted, 150 mL of CY1 biological agent (concentration of 1×10 7 CFU·mL -1 ), 600 times dilution of 30% oxadiazine·oxadiazine water, and the mixed solution of the two in a volume ratio of (1:2) were used for root irrigation, once every 20 days, for 3 consecutive times. 20 days after the last treatment, the incidence of tobacco black shank was observed and recorded. With clear water as the control (CK), 100 tobacco plants were treated in each treatment, and each treatment was repeated 3 times.

[0106] The incidence of black shank disease was investigated according to the national standard GB / T 23222-2008 tobacco pest classification. The calculation formula is as follows:

[0107] Incidence rate = number of diseased plants / total number of plants investigated × 100%;

[0108] Disease index = ∑ (number of plants at each disease level × number of diseased plants) / (highest number of diseased plants × total number of plants) × 100;

[0109] Control effect = (control disease index - treatment disease index) / control disease index × 100%.

[0110] 2. Results Analysis

[0111] As shown in Table 4, the field control results show that CY1 biological agent, 30% cypermethrin·oxamyl aqueous solution and the combination of the two can significantly inhibit tobacco black leg disease. When CY1 biological agent is used alone, the field control effect of black leg disease reaches 74.7%; when CY1 biological agent is combined with cypermethrin·oxamyl, the control effect of CY1 biological agent can be effectively improved, and the field control effect reaches 87.3%, which is not significantly different from the control effect of cypermethrin·oxamyl alone (92.8%). This shows that CY1 biological agent can effectively inhibit the occurrence of black leg disease in tobacco fields, and the effect is better when combined with cypermethrin·oxamyl, and it can effectively reduce the use of pesticides in the field.

[0112] Table 4 The results of the control effect of different preparations on tobacco black shank in the field

[0113]

[0114] Note: Different letters indicate significant differences (P<0.05).

Claims

1. A Bacillus altitudinis CY1 strain, the deposit number of which is CCTCC NO: M 20241744.

2. A highland Bacillus CY1 biological agent, characterized in that: The Bacillus subtilis CY1 described in claim 1 is used as an active ingredient.

3. The method for preparing the Bacillus subtilis CY1 biological agent according to claim 2, characterized in that: Under sterile conditions, inoculate the highland Bacillus CY1 seed liquid into the fermentation medium at a volume ratio of 1-3%, 28-32°C, 200-240r·min -1 After constant temperature shaking culture for 36-72h, the highland Bacillus CY1 biological agent was obtained, and the effective viable count was 1×10 6 ~1×10 8 CFU·mL -1 .

4. The use of Bacillus CY1 or biological agent according to claim 1 or 2 in preventing and controlling tobacco diseases, characterized in that: The tobacco disease is one of tobacco black shank, tobacco root rot, tobacco target spot, tobacco brown spot, tobacco damping-off and tobacco anthrax.

5. Use of the Bacillus subtilis CY1 biological agent according to claim 2 in preventing and treating tobacco black shank disease.

6. The method for applying the Bacillus subtilis CY1 biological agent in preventing and treating tobacco black shank disease according to claim 5, characterized in that: The specific steps are as follows: (1) compounding the Bacillus subtilis CY1 biological agent with 600 times dilution of 30% oxazolidinone-methyl aqueous solution; (2) In the early stage of tobacco transplanting, the compound liquid is applied to prevent and control tobacco black shank disease.

7. The application method according to claim 6, characterized in that: The concentration of the Bacillus subtilis CY1 biological agent in step (1) is 1×10 4 ~1×10 8 CFU·mL -1 .

8. The application method according to claim 6, characterized in that: The compounding ratio of step (1) is 1-3:2-6 by volume.

9. The application method according to claim 6, characterized in that: The dosage of the compound liquid in step (2) is 150-200 ml / 100 plants. After the tobacco plants are irrigated once 10-15 days after transplanting, the treatment is performed once every 15-20 days, and the treatment is continued for 2-4 times.

Images