Escherichia coli genetically engineered bacterium for producing hyaluronic acid as well as construction method and application thereof

Abstract

The invention belongs to the technical field of microorganisms and fermentation engineering, and particularly relates to an escherichia coli genetically engineered bacterium for producing hyaluronic acid as well as a construction method and application of the escherichia coli genetically engineered bacterium. According to the application disclosed by the invention, it is reported for the first time that probiotic escherichia coli Escherichia coli Nissle1917 (ECN) is adopted as a chassis bacterium to carry out HA biosynthesis, and meanwhile, glucose-xylose double carbon sources are adopted for fermentation for the first time, so that the production cost of HA is further saved, and meanwhile, the yield of HA is further improved through directional modification of a key enzyme hyaluronic acid synthase. Experiments prove that the yield of the modified engineering bacteria can reach 10.7 g after the engineering bacteria are subjected to enlarged culture in a fermentation tank, which is the highest yield of HA produced by using probiotics as a chassis reported at present, so that the engineering bacteria have good practical application value.

Description

Technical Field

[0001] The invention belongs to the technical field of microorganisms and fermentation engineering, and specifically relates to a genetically engineered Escherichia coli bacteria producing hyaluronic acid, a construction method and an application thereof. Background Art

[0002] The information disclosed in the background of the invention is only intended to enhance the understanding of the overall background of the invention and should not be necessarily regarded as an acknowledgment or any form of suggestion that the information constitutes the prior art already known to a person skilled in the art.

[0003] Hyaluronic acid (HA) is an important type of mucopolysaccharide with excellent moisturizing effect and high safety. Therefore, it is widely used in many fields such as medicine, cosmetics, and food, and has wide application value.

[0004] The production method of hyaluronic acid has developed from the initial animal tissue extraction method to the chemical synthesis method and microbial fermentation method. The tissue extraction method is to extract hyaluronic acid from different species and tissues, such as chicken comb, human umbilical cord, eye vitreous body and joint synovial fluid, but the components in animal tissue cells are complex, and hyaluronic acid is very easy to aggregate with macromolecular substances such as protein and DNA, which makes it difficult to separate, resulting in cumbersome extraction process, complex process, high cost, and great impact on product purity and quality. These factors limit the application of this method in hyaluronic acid production. The chemical synthesis method is to synthesize hyaluronic acid through chemical reaction, using D-glucuronic acid and N-acetylglucosamine as raw materials, and preparing crude products through acid hydrolysis, polycondensation reaction and neutralization purification. Purified hyaluronic acid usually needs to go through further processing steps, such as washing, drying, crushing, etc. This method usually requires more complicated synthesis steps and conditions, and the product produced may contain impurities, which is not suitable for use in the fields of medicine and beauty. In recent years, synthetic biology has been continuously developed, and the synthesis mechanism of hyaluronic acid has been continuously analyzed. The use of microorganisms with clear genetic background and high biosafety to synthesize hyaluronic acid has become a development trend of synthesizing hyaluronic acid by microbial fermentation. The synthesis pathway of hyaluronic acid has been successfully constructed and characterized in relatively safe strains such as Escherichia coli, Lactobacillus, Bacillus subtilis and Corynebacterium glutamicum. The commonly used strain is Streptococcus zooepidemicus, which is still widely used in the production of hyaluronic acid industry. However, there are many shortcomings in the process of fermenting hyaluronic acid using Streptococcus zooepidemicus. With the increase of hyaluronic acid content, the viscosity of the fermentation liquid will increase sharply, resulting in uneven material stirring and a decrease in the ability to dissolve oxygen in water, resulting in the use of anaerobic respiration for bacterial growth. A large amount of carbon source is wasted, and a large amount of lactic acid is synthesized. The accumulation of lactic acid will inhibit bacterial growth and hyaluronic acid synthesis. Secondly, in the process of continuous synthesis of hyaluronic acid, a large amount of UDP-N-acetylglucosamine (UDP-GlcNAc) and UDP-glucuronic acid (UDP-GlcA) in the bacteria will be consumed. These two substances are essential for the growth of microorganisms. Therefore, a large amount of synthetic hyaluronic acid will affect the growth of bacteria. Most importantly, the presence of pathogenic factors such as endotoxins in Streptococcus zooepidemicus can cause many diseases, which has seriously restricted its development in the fields of medicine and other fields, seriously affecting the safety, health and green environmental protection of polysaccharide products. Although it has been successfully constructed and characterized in safer strains such as Escherichia coli and Corynebacterium glutamicum in recent years, its output and production cost still have a lot of room for improvement. In order to improve the shortcomings of hyaluronic acid synthesis by Streptococcus zooepidemicus, it is urgent to find more high-yield, environmentally friendly and economical production technologies and methods. Summary of the invention

[0005] In view of the problems existing in the prior art, the object of the present invention is to provide a genetically engineered Escherichia coli bacteria producing hyaluronic acid and a construction method and application thereof. Specifically, the present invention reports for the first time the use of probiotic Escherichia coli Escherichiacoli Nissle1917 (ECN) as a base bacteria for the biosynthesis of HA, and also for the first time the use of "glucose-xylose" dual carbon source for fermentation, further saving the production cost of HA, while the directional modification of the key enzyme hyaluronan synthase further increases the yield of HA. Based on the above research results, the present invention is completed.

[0006] Specifically, the technical solution of the present invention is as follows:

[0007] The first aspect of the present invention provides a genetically engineered Escherichia coli strain that produces hyaluronic acid, wherein the genetically engineered Escherichia coli strain is depleted of any one or more of the gene pck encoding phosphoenolpyruvate carboxykinase, the gene ppsA encoding phosphoenolpyruvate synthetase, the genes pykA and pykF encoding two isozymes of pyruvate kinase, the gene ppc encoding phosphoenolpyruvate carboxylase, the gene ptsG encoding the key component EⅡCBGlc in the PTS system, and the gene ptsI encoding the phosphohistidine transport protein HPr, and simultaneously overexpresses key genes in the hyaluronic acid synthesis pathway;

[0008] Among them, the key genes of the hyaluronic acid synthesis pathway include any one or more of the gene ugdA encoding UDP-glucose 6-dehydrogenase, the gene pgm encoding glucose phosphoglucomutase, the gene glmU encoding the bifunctional enzyme acetylglucosamine pyrophosphorylase / glucose-1-phosphate acetyltransferase, the gene galU encoding glucose-6-phosphate uramide transferase, the gene glmS encoding glutamine-fructose-6-phosphate aminotransferase and the gene hasA encoding hyaluronic acid synthase.

[0009] In another specific embodiment of the present invention, in order to circumvent the bacterial carbon repression effect and further improve the utilization rate of xylose, the genetically engineered Escherichia coli producing hyaluronic acid overexpresses the D-xylose dehydrogenase gene xylB and the xylolactonase gene xylC in the Weimberg pathway of xylose to convert xylose into xylulose; and at the same time overexpresses the xylulose dehydratase encoding gene YjhG and the aldolase encoding gene YjhH.

[0010] In another specific embodiment of the present invention, the bottom plate bacteria is Escherichia coli, further is Escherichia coli Nissle1917 (ECN).

[0011] In another specific embodiment of the present invention, among the key genes of the hyaluronic acid synthesis pathway, the gene ugdA encoding UDP-glucose 6-dehydrogenase, the gene pgm encoding glucose phosphomutase, the gene glmU encoding acetylglucosamine pyrophosphorylase / glucose-1-phosphate acetyltransferase bifunctional enzyme, the gene galU encoding glucose-6-phosphate uramide transferase, and the gene glmS encoding glutamine-fructose-6-phosphate aminotransferase are derived from Escherichia coli MG1655;

[0012] The gene hasA encoding hyaluronan synthase is derived from Streptococcus equi; further, since hyaluronan synthase is the key enzyme in hyaluronan synthesis, the present invention further performs molecular modification on it and screens to obtain the dominant double mutant SeHasA (G38A&F304E) that can improve the stability of hyaluronan synthase, thereby further improving the final hyaluronan yield.

[0013] The second aspect of the present invention provides the use of the above-mentioned genetically engineered Escherichia coli in the fermentation production of hyaluronic acid.

[0014] The third aspect of the present invention provides a method for producing hyaluronic acid by fermentation, the method comprising: fermenting and culturing the above-mentioned genetically engineered Escherichia coli to express hyaluronic acid; and separating and purifying the hyaluronic acid.

[0015] Wherein, the fermentation medium contains at least glucose and xylose.

[0016] The fourth aspect of the present invention provides a method for constructing a genetically engineered Escherichia coli that produces hyaluronic acid, the method comprising: using Escherichia coli as a base bacterium, and performing the following transformations on the base bacterium:

[0017] a) knocking out any one or more of the gene pck encoding phosphoenolpyruvate carboxykinase, the gene ppsA encoding phosphoenolpyruvate synthetase, the genes pykA and pykF encoding two isozymes of pyruvate kinase, the gene ppc encoding phosphoenolpyruvate carboxylase, and the gene ptsG encoding the key component EⅡCBGlc in the PTS system; and the gene ptsI encoding the phosphohistidine transport protein HPr in the chassis bacteria;

[0018] b) overexpressing any one or more of the exogenous gene ugdA encoding UDP-glucose 6-dehydrogenase, the gene pgm encoding glucose phosphoglucomutase, the gene glmU encoding the bifunctional enzyme acetylglucosamine pyrophosphorylase / glucose-1-phosphate acetyltransferase, the gene galU encoding glucose-6-phosphate uramide transferase, the gene glmS encoding glutamine-fructose-6-phosphate aminotransferase, and the gene hasA encoding hyaluronan synthase.

[0019] Furthermore, the construction method also includes overexpressing the D-xylose dehydrogenase gene xylB and the xylolactonase gene xylC in the Dahms pathway of exogenous xylose; and simultaneously overexpressing the xylulose dehydratase encoding gene YjhG and the aldolase encoding gene YjhH in the chassis bacteria.

[0020] Wherein, the D-xylose dehydrogenase gene xylB and the xylolactone acidase gene xylC

[0021] The gene ugdA encoding UDP-glucose 6-dehydrogenase, the gene pgm encoding glucose phosphomutase, the gene glmU encoding acetylglucosamine pyrophosphorylase / glucose-1-phosphate acetyltransferase bifunctional enzyme, the gene galU encoding glucose-6-phosphate uramide transferase, and the gene glmS encoding glutamine-fructose-6-phosphate aminotransferase were derived from Escherichia coli MG1655;

[0022] The gene hasA encoding hyaluronan synthase is derived from Streptococcus equi; further, since hyaluronan synthase is the key enzyme in hyaluronan synthesis, the present invention further performs molecular modification on it and screens to obtain the dominant double mutant SeHasA (G38A&F304E) that can improve the stability of hyaluronan synthase, thereby further improving the final hyaluronan yield.

[0023] The fifth aspect of the present invention provides the application of the above-mentioned genetically engineered Escherichia coli or fermentation method for producing hyaluronic acid in many fields such as medicine, cosmetics and food.

[0024] Beneficial technical effects of one or more of the above technical solutions:

[0025] The above technical solution uses probiotics as the chassis for the biosynthesis of HA for the first time, and it is also the first time that the "glucose-xylose" dual carbon source is used for fermentation, which further saves the production cost of HA. At the same time, the targeted transformation of the key enzyme hyaluronan synthase further increases the production of HA.

[0026] The above technical solution transforms the synthesis method of HA into a green and sustainable production method, which is environmentally friendly, sustainable, efficient and clean. It is expected to change the existing chemical synthesis method that is highly dependent on fossil raw materials and the unsustainable industrial manufacturing pattern of "high pollution and high emissions", and has broad market prospects. At the same time, a series of technical means to enrich carbon metabolic flow can bring economic benefits in many aspects such as HA production increase, quality improvement, cost reduction, industrial development and innovation drive, and promote the healthy and sustainable development of the HA biosynthesis industry. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] The accompanying drawings in the specification, which constitute a part of the present invention, are used to provide a further understanding of the present invention. The exemplary embodiments of the present invention and their descriptions are used to explain the present invention and do not constitute improper limitations on the present invention.

[0028] Figure 1 The wild mushroom chassis of the present invention produces HA.

[0029] Figure 2 Schematic diagram of the biosynthesis of hyaluronic acid by the metabolism of "glucose-xylose" of the present invention.

[0030] Figure 3 The invention shows the chassis modification of the strain MG07 and the production of HA by dual-carbon mixed fermentation; wherein A is a pcK gene knockout map, lanes 1-9 are knockout bacteria, lane 10 is a wild-type control, and lane 11 is a marker; B is a ppsA gene knockout map, lanes 1-3 are knockout bacteria, lane 4 is a wild-type control, and lane 5 is a marker; C is a PyKA gene knockout map, lanes 1-8 are knockout bacteria, lane 9 is a wild-type control, and lane 10 is a marker. PyKA gene knockout map, lanes 1-8 are for each gene knockout bacteria, lane 9 is for the wild-type control, and lane 10 is a marker; D is the PyFA gene knockout map, lanes 1-5 are for each gene knockout bacteria, lane 6 is for the wild-type control, and lane 7 is a marker; E is the PtsG gene knockout map, lanes 1-6 are for each gene knockout bacteria, lane 7 is for the wild-type control, and lane 8 is a marker; F is the ppC gene knockout map, lanes 1-5 are for each gene knockout bacteria, lane 6 is for the wild-type control, and lane 7 is a marker; G is the PtsI gene knockout map, lanes 1-6 are for each gene knockout bacteria, lane 7 is for the wild-type control, and lane 8 is a marker; H is a map of HA production by dual-carbon mixed fermentation.

[0031] Figure 4 The UDP-GlcA precursor synthesis pathway of the present invention is strengthened; wherein, A is a map of the overexpressed pgm gene, lane 1 is a Marker, and lanes 2-3 are each overexpression strain; B is a map of the overexpressed galU gene, lanes 1-3 are each overexpression strain, and lane 4 is a Marker; C is a map of the overexpressed ugdA gene, lane 1 is a Marker, and lanes 2-4 are each overexpression strain.

[0032] Figure 5 (A) UDP-GlcNAc precursor synthesis pathway enhancement of the present invention, lane 1 is the glmU overexpression strain, lane 2 is the glmM overexpression strain, lane 3 is the glmS overexpression strain, lane 4 is the negative control strain, and lane 5 is Marker; and (B) dual-carbon mixed fermentation to produce HA.

[0033] Figure 6 This is the result of the point mutation of the hyaluronan synthase of the present invention.

[0034] Figure 7 This is the result of the point mutation of the hyaluronan synthase of the present invention.

[0035] Figure 8 This is the result of the double mutation of hyaluronan synthase of the present invention.

[0036] Fig. 9 This is a diagram showing the results of HA production in the fermenter of the present invention. DETAILED DESCRIPTION

[0037] It should be noted that the following detailed descriptions are all illustrative and intended to provide further explanation of the present invention. Unless otherwise specified, all technical and scientific terms used herein have the same meanings as those commonly understood by those skilled in the art to which the present invention belongs.

[0038] It should be noted that the terms used herein are only for describing specific embodiments and are not intended to limit exemplary embodiments according to the present invention. As used herein, unless the context clearly indicates otherwise, the singular form is also intended to include the plural form. In addition, it should be understood that when the terms "comprising" and / or "including" are used in this specification, it indicates the presence of features, steps, operations, devices, components and / or combinations thereof.

[0039] In order to further reduce the production cost of HA biosynthesis, the present invention reprograms the central metabolic network of Escherichia coli, and divides the chassis bacteria into two modules of "biological production" and "bacterial growth" through the synergistic metabolism of the dual carbon source of "glucose-xylose", thereby optimizing the production performance of chassis cells. In the chassis bacteria, glucose is used exclusively for the biosynthesis of hyaluronic acid, further increasing the yield of hyaluronic acid, while the growth of bacteria is supported by xylose. At the same time, the use of xylose can reduce the production cost of hyaluronic acid and improve economic benefits. The distribution and utilization of carbon sources in fine-tuned engineering bacteria are achieved, cell metabolism is balanced, and the efficiency of polysaccharide synthesis is enhanced, which has theoretical advancement; the present invention transforms the synthesis method of hyaluronic acid from a low-yield, high-cost animal tissue extraction method to a green, high-yield and relatively safe biosynthesis method. The present invention has broad market application prospects by changing the existing industrial production pattern, achieving green energy saving, and reducing costs and increasing efficiency.

[0040] Specifically, the starting substrates for hyaluronic acid biosynthesis are glucose-1-phosphate (glucose-1-phosphatase, Glc-1-P) and fructose-6-phosphate (fructose-6-phosphate, Fru-6-P) from the central metabolic pathway, while the Glc-1-P and Fru-6-P in the original chassis need to be decomposed and metabolized into the tricarboxylic acid cycle (TCA) to support bacterial growth metabolism, which will have a certain impact on the biosynthesis of hyaluronic acid. Phosphoenolpyruvic acid (PEP) and pyruvic acid (PYR) are important intermediates for the synthesis of hyaluronic acid and also participate in TCA to support cell growth. Therefore, hyaluronic acid synthesis competes with TCA for carbon flux. If the TCA metabolic pathway is directly destroyed or the carbon source is blocked from flowing into TCA, it will cause an imbalance in bacterial metabolism, thereby affecting the normal life activities of the cells. To this end, the present invention divides the metabolic activities of the chassis bacteria into two modules of "biological production" and "bacterial growth" through metabolic engineering. In the chassis bacteria, glucose is exclusively used for the biosynthesis of hyaluronic acid, while xylose is used to support the growth of bacteria.

[0041] By analyzing the metabolic network pathway of Escherichia coli, the sugar engineering optimized chassis strain was quickly constructed with the help of CRISPR-Cas9 technology, so that the chassis bacteria were divided into two major modules: "biological production" and "bacterial growth". PEP has three consumption pathways: it is converted into pyruvate through the pyruvate kinase isozyme PYKA / F and enters the TCA cycle; through the PTS system, glucose is phosphorylated under the action of the glucose-specific PTS enzyme PTSG and itself becomes pyruvate; under the action of phosphoenolpyruvate carboxylase PPC, it reacts with carbon dioxide to generate oxaloacetate and enters the TCA pathway. After blocking the PEP consumption pathway, PEP is converted to PYR and enters the TCA cycle only accompanied by the phosphorylation of glucose, thereby enriching the carbon metabolic flow for the biosynthesis of hyaluronic acid. However, PYR generates PEP under the action of phosphoenolpyruvate synthase PPSA, and oxaloacetate generates PEP under the action of phosphoenolpyruvate carboxykinase PCK, which reduces the carbon flux of the TCA pathway and affects the growth metabolism of cells. This study intends to compensate for cell growth by introducing xylose as a second carbon source. Through multi-step knockout, a highly efficient hyaluronic acid production base strain MG07 was constructed: Escherichiacoli Nissle1917: Δpck: ppsA: pykA: pykF: ppc: ptsG: ptsI. That is, hyaluronic acid is polymerized by UDP-GlcA (UDP-glucuronic acid) and UDP-GlcNAc (UDP-N-acetylglucosamine). The present invention improves the concentration of the two precursors by optimizing the tandem combination of pathway genes.

[0042] At the same time, the above recombinant bacteria MG07 overexpressed the key genes pgm, ugdA, glmU, galU, glmS and hasA in the hyaluronic acid synthesis pathway. In order to circumvent the bacterial carbon repression effect and further improve the utilization rate of xylose, this study intends to overexpress the D-xylose dehydrogenase gene xylB and the xylolactone acidase gene xylC in the Dahms pathway of xylose to convert xylose into xylulose. Overexpressing the endogenous xylulose dehydratase YjhG and aldolase YjhH of E. coli converts xylulose into PYR and ethanolaldehyde, both of which can directly enter TCA to compensate for the growth defects of cells.

[0043] It should be noted that the key enzyme for HA synthesis is hyaluronan synthase. The present invention combines bioinformatics and biological experiments to dig out and screen out the hyaluronan synthase of the best species. At the same time, the molecular transformation of the key enzyme is achieved through the rational design of the enzyme, the three-dimensional structure of the enzyme is analyzed, and the enzyme catalytic performance and stability are further improved, thereby realizing the green, efficient and safe synthesis of HA. Finally, through the above-mentioned multi-step optimization, the recombinant strain EcnO7 uses the "glucose-xylose" dual carbon source in a 5L fermenter for batch feed fermentation of hyaluronic acid, with a maximum yield of 10.7g, which is the highest yield of HA produced using a probiotic chassis reported so far.

[0044] The present invention is further explained by the following examples, but they are not intended to limit the present invention. It should be understood that these examples are only used to illustrate the present invention and are not intended to limit the scope of the present invention.

[0045] Example

[0046] Extraction of E. coli MG1655 genome

[0047] Activation of bacterial strains: Take out the E. coli strains stored at -80℃, streak them on the LB plate, place them in a 37℃ incubator and incubate them upside down in the dark for more than 16 hours until a single colony that can be observed with the naked eye grows out.

[0048] Bacterial culture: Use a sterilized toothpick or gun tip to pick up a single colony and place it in 20mL LB, incubate at 37℃, 180rpm, and culture for more than 16 hours. After the culture solution becomes turbid, transfer it to 200mL LB for culture. After the bacteria become turbid, centrifuge to collect the bacteria and extract the genome according to the steps in the kit instructions. Finally, use the ultra-micro spectrophotometer Nano-800 to measure the concentration and purity. After marking the corresponding values, aliquot and freeze at -20℃ to avoid repeated freezing and thawing in later experiments.

[0049] Construction of knockout system

[0050] Use primers to amplify 200bp homologous fragments upstream and downstream of the gene to be knocked out. Secondly, use the 1000bp sequence of the target gene to find N20 and design sgRNA. Furthermore, use the corresponding primers to amplify the pTarget linear fragment. Finally, perform multi-fragment assembly. The assembly system is as follows:

[0051]

[0052] After gentle mixing, place in a PCR instrument and react at 50°C for 15 minutes. After the PCR reaction is completed, place the reaction product on ice for 3 minutes and then perform the transformation experiment.

[0053] Knockout:

[0054] The pcas9 plasmid was transformed into E.coli MG1655 by electroporation, the successfully transformed bacteria were made into electroporation competent cells, and the pTarget constructed above was re-transformed to knock out the gene. The specific knockout steps are as follows:

[0055] 1) Pick a single pcas9 colony and inoculate it in 10 mL LB. When OD600 grows to about 0.2, add arabinose with a final concentration of 10 mM to induce expression.

[0056] 2) When the bacteria grow to an OD600 of about 0.4-0.6, collect the bacteria and prepare competent cells according to conventional methods.

[0057] 3) Prepare competent cells to transform the successfully constructed pTarget, and spread them on a plate containing kanamycin and spectinomycin double antibodies, and incubate them upside down at 30°C for more than 16 hours to allow homologous recombination and knockout of the gene.

[0058] 4) The single colonies grown on the double-antibody plate were screened for positive colonies with successful knockout using bacterial liquid PCR and sequencing.

[0059] 5) The selected positive colonies were inoculated with LB containing a final concentration of 0.1mM IPTG for induction, cultured at 30℃ for more than 24h, and then diluted and coated on non-resistant plates. When single colonies grow to be visible to the naked eye, the single colonies are photocopied onto three resistance plates (kana, spectinomycin, kana and spectinomycin double resistance). Finally, colonies that only grow on kana resistance plates but not on spectinomycin resistance and kana and spectinomycin double resistance plates are selected. These colonies are considered positive strains that have successfully eliminated pTarget. The bacteria are inoculated into LB for rejuvenation and stored at -80℃ for later use.

[0060] 6) The positive bacteria that successfully eliminated pTarget were cultured at 42°C to eliminate the pCas9 plasmid. After several transfers, we diluted the bacterial solution and spread it on a plate without antibiotics, and inverted and cultured it at 37°C overnight until a single colony was observed.

[0061] 7) Repeat the above steps to obtain the chassis strain MG07 in which the pck (GenBank Accession No.: 945667), ppsA (GenBank Accession No.: 946209), pykA (GenBank Accession No.: 946527), pykF (GenBank Accession No.: 946179), ppc (GenBank Accession No.: 948457), ptsG (GenBank Accession No.: 945651) and ptsI (GenBank Accession No.: 946879) gene clusters are deleted;

[0062] 6) The nucleotide sequences of the pck, ppsA, pykA, pykF, ppc, ptsG and ptsI deletion primers and identification primers are shown in the following table.

[0063]

[0064]

[0065]

[0066] 7) Copy the single colonies grown on the non-antibiotic plate onto the Kana resistance plate and the non-antibiotic plate. Finally, select the colonies that only grow on the non-antibiotic plate for colony PCR verification again. The strains that are confirmed to be successfully knocked out are frozen at -80℃ for future use. Finally, through multi-gene knockout, this experiment successfully constructed chassis cells that optimize the synthesis of hyaluronic acid.

[0067] Conversion:

[0068] 1) Thaw competent cells on ice.

[0069] 2) Add all the above PCR reaction products to the competent medium and incubate on ice for 15 minutes.

[0070] 3) Heat shock at 42°C for 90 seconds and immediately place on ice for 2 minutes.

[0071] 4) Add recovery medium, culture and spread.

[0072] 5) The grown single colonies were identified by PCR and positive clones were screened.

[0073] Double restriction enzyme digestion of ugdA gene and PET28m plasmid

[0074] The recovered ugdA gene amplification product and plasmid PET28m were double-digested and reacted at 16°C overnight; after the double-digestion, the digestion product was detected by agarose gel electrophoresis and recovered using a gel recovery kit. The reaction system is as follows:

[0075] Target gene ugdA double restriction enzyme digestion reaction system

[0076]

[0077]

[0078] Plasmid PET28m double restriction enzyme digestion reaction system

[0079]

[0080] Expression vector ligation and amplification

[0081] The recovered ugdA gene fragment and the PET28m plasmid fragment were connected to form a complete recombinant plasmid PET28m-ugdA using T4 DNA ligase. The reaction system is as follows:

[0082]

[0083] The ligation product was transferred into E.coli DH5α competent cells to amplify the recombinant plasmid:

[0084] 1) Take 10 μL of the ligated product and add it to 100 μL of E. coli DH5α competent cells, mix well, and place on ice for 20 minutes;

[0085] 2) After the ice bath, place in a metal bath at 42°C for 45 seconds;

[0086] 3) After the heat shock, place the cells in an ice bath for 2 minutes, add 900 μL of LB medium, mix well, and culture at 37°C and 180 rpm for 1 hour.

[0087] 4) After the recovery culture is completed, the bacterial solution is spread on an LB plate containing 50 mg / L ampicillin and cultured inverted at 37°C overnight.

[0088] After overnight culture, single colonies were picked for colony PCR to test whether the recombinant plasmid was successfully constructed and verified using primers.

[0089]

[0090] 1) The UDP-glucose 6-dehydrogenase gene ugdA (GenBank Accession No.: 946571), the glucose phosphomutase gene pgm (GenBank Accession No.: 945271), the acetylglucosamine pyrophosphorylase / glucose-1-phosphate acetyltransferase bifunctional enzyme gene glmU (GenBank Accession No.: 948246), the gene encoding glucose-6-phosphate uramide transferase galU (GenBank Accession No.: 945730), the glutamine-fructose-6-phosphate aminotransferase gene glmS (GenBank Accession No.: 948241) and the hyaluronan synthase gene hasA from Streptococcus equi (GenBank Accession No.: LC753992.1) were cloned.

[0091] 2) ligating the UDP-glucose 6-dehydrogenase gene ugdA, the glucose phosphomutase gene pgm, the acetylglucosamine pyrophosphorylase / glucose-1-phosphate acetyltransferase bifunctional enzyme gene glmU, the gene encoding glucose-6-phosphate urea amidotransferase galU, the gene encoding glutamine-fructose-6-phosphate aminotransferase glmS and the gene encoding hyaluronan synthase from Streptococcus equi obtained in step 1) into the plasmid vector PET28m to obtain a recombinant plasmid: PET28m-ugdA-pgm-hasA-glmU-galU-glmS;

[0092]

[0093] 3) Cloning the xylB gene of xylose dehydrogenase and the xylC gene of xylolactonase from Caulobacter crescentus, and connecting the two genes to the plasmid vector PCDFm after codon optimization (SEQ ID NO: 1-2), the xylose dehydratase gene yjhG (Gene ID: 946829) and the 3-deoxy-D-glycerol leupropentose aldolase gene yjhH (Gene ID: 948825), to obtain the recombinant plasmid PCDFm-xylB-xylC-yjhG-yjhH;

[0094]

[0095] 4) Introducing the recombinant plasmid obtained in step 2) and step 3) into the modified chassis bacteria MG07 to obtain the recombinant bacteria.

[0096] 5) Based on site-directed mutagenesis, the hyaluronan synthase seHasA enzyme (GenBank: BDX35410.1, its encoding gene is GenBank: LC753992.1, and the nucleotide sequence after codon optimization is shown in SEQ ID NO: 3) is molecularly modified to screen for superior mutants with improved enzyme catalytic efficiency. In this embodiment, a mutant library is constructed by error-prone PCR and mutants with improved catalytic activity are screened; the single-point mutants obtained by screening are iteratively combined with the construction and screening of the mutation library, and finally superior mutants with improved catalytic efficiency are obtained, thereby realizing the directed evolution of enzyme molecules.

[0097] 1) Using pET28a-seHasA plasmid as a template, primers with HindIII and BamHI restriction sites at both ends were designed to amplify the seHasA gene fragment;

[0098] 2) By adjusting the Mn in the PCR reaction system 2+ Random mutagenesis was performed at 100 μg / ml concentration;

[0099] 3) Determine the optimal Mn based on the mutation rate 2+ The error-prone PCR products were detected by gel electrophoresis and the products were recovered using a DNA gel recovery kit;

[0100] 4) The purified PCR product was double-digested with HindIII and BamHI, and then recombined with the pET-28a(+) expression vector;

[0101] 5) The recombinant product was transferred into the expression host E. coli BL21 (DE3) competent cells, and coated on LB plates containing 50 μg / mL Kan, and cultured overnight at 37°C for 12 to 16 hours to obtain a mutant library;

[0102] 6) Select a single colony from the resistance plate, inoculate it into a 96-well screening plate, and culture it at 37°C and 200 rpm for 12 hours;

[0103] 7) Take 100 μL of the cultured seed solution and transfer it to a 48-deep-well plate containing 1 mL of M9 fermentation medium;

[0104] 8) adding UDP-GlcA (UDP-glucuronic acid) and UDP-GlcNAc (UDP-N-acetylglucosamine) substrates at a final concentration of 1 g / L to the fermentation medium for fermentation;

[0105] 9) When OD600 reaches 0.6-0.8, add IPTG at a final concentration of 100 μM and induce expression at 30°C for more than 16 h;

[0106] 10) The fermentation broth was centrifuged and the supernatant was collected and tested for HA synthesis by HPLC. The wild type of seHasA was used as a negative control to screen out mutants with increased HA production, and sequencing was performed to verify the mutant sequence.

[0107] The selected single-point mutant strains were subjected to iterative combination mutations to obtain double-site combination mutations. A series of combination mutation plasmids were transferred into the expression host E. coli BL21 (DE3) competent cells by heat shock method, and coated with LB plates containing 50 μg / mL Kan, and cultured overnight at 37°C for 12 to 16 hours to obtain combination mutant strains. Positive colonies were selected and inoculated into 96-well screening plates containing 500 μL LB medium in each well for overnight culture; 100 μL of seed solution was transferred to a 48-deep-well plate containing 1 mL M9 fermentation medium (50 μg / mL kanamycin) for fermentation, and UDP-GlcA (UDP-glucuronic acid) and UDP-GlcNAc (UDP-N-acetylglucosamine) substrates with a final concentration of 1 g / L were added to the fermentation medium respectively; when OD600 reached 0.6-0.8, IPTG with a final concentration of 100 μM was added at 30°C to induce expression for more than 16 hours; the fermentation broth was centrifuged to collect the supernatant, and the synthesis of HA was detected by HPLC, and the superior mutant SeHasA with improved HA production was screened out. d (G38A&F304E, the nucleotide sequence after codon optimization is shown in SEQ ID NO:4), the HA yield was 223.71 mg / L, and sequencing was performed to verify it.

[0108] Fermentation culture to produce hyaluronic acid

[0109] (1) Culture medium and fermentation method:

[0110] 1) LB medium (1L): Tryptone: 10g, Yeast Extract: 5g, Sodium chloride: 10g, double distilled water to 1L, 121℃, sterilize for 15min. If solid medium is used, add 15g Agar.

[0111] 2) NBS medium (1L): Tryptone: 10g, Yeast Extract: 5g, KH2PO4 (monopotassium phosphate): 3.5g, (NH4)2SO4 (ammonium sulfate): 1.6g, K2HPO4·3H2O (dipotassium hydrogen phosphate trihydrate): 6.5g. FeSO4·7H2O: 0.0775g, MnSO4·H2O: 0.004525g, Na2SO 4: 0.02g,ZnSO 4:0.0064g, CoCl2·6H2O: 0.004g, CuSO4·5H2O: 0.0006g. 50% glucose 40mL, 50% xylose 40mL, 1M MgSO41mL, 1MCaCl2 100μL. FeSO4·7H2O and the last five are made into 1000× stock solution and sterilized by filtration. Glucose and xylose are sterilized at 105℃ for 15min. Others are sterilized at 121℃ for 15min. If solid culture medium is prepared, add 15g Agar.

[0112] 3) Fermentation tank medium: glucose 20 g / L, xylose 10 g / L, yeast extract 2.5 g / L, MgSO4·7H2O 0.1 g / L, manganese sulfate tetrahydrate 1.5 g / L, dipotassium hydrogen phosphate 0.64 g / L, potassium dihydrogen phosphate 2 g / L, sodium bicarbonate 0.5 g / L, calcium chloride 0.2 g / L, zinc chloride 0.2 g / L, copper sulfate pentahydrate 0.019 g, ammonia water was added to maintain the pH stable at 7.0.

[0113] (2) Shake flask fermentation and fermentation tank fermentation:

[0114] The steps of shake flask fermentation experiment are as follows:

[0115] Take the fermentation strain constructed in the bacterium preservation tube or on the plate and inoculate it into a shake flask containing 20mL LB medium and place it in a shaker at 37°C and 180rpm for overnight culture. Add 2% of the seed liquid to a shake flask containing 50mL fermentation medium, add the corresponding antibiotics, place it at the corresponding temperature, and culture the bacteria in a shaker at 200rpm until the OD600 is about 0.6, and add 1.0mmol / L isopropyl-β-D-thiogalactopyranose (IPTG) and 5g / L glucose and xylose at a final concentration of 1.0mmol / L.

[0116] Fermentation in fermenter:

[0117] Use a 5L microbial reactor and add 2L fermentation medium for HA high-density fermentation. Take the HA fermentation strain in the preservation tube or pick the plate and transfer it to 20mL LB medium and place it in a shaker at 37℃ and 180rpm for overnight culture. Transfer it to 200mL LB medium at a ratio of 1% and place it in a shaker at 37℃ and 180rpm to culture the bacteria OD600 to about 0.6-0.8, and transfer it to a fermenter containing 2L fermentation medium as a seed liquid. The microbial reactor can monitor the pH change in real time and maintain the pH stable at 6.8±0.5 by adding ammonia water. The system can couple the dissolved oxygen content (DO) of the fermentation system with the speed of the stirring paddle to maintain DO at a certain level, set the fermenter ventilation rate to 1.5-2.0vvm, and the stirring paddle speed to 300-800rpm. When the bacteria OD600 reaches 10, adjust the temperature to 28℃ and add IPTG at a final concentration of 1mmol. Sampling was performed every 2 hours, and the carbon source and HA in the fermentation broth were determined by liquid chromatography, and the OD600 of the bacterial broth was determined. When the glucose concentration was lower than 10g / L, glucose was added to ensure that the glucose concentration was not lower than 10g / L. When the xylose concentration was lower than 5g / L, xylose was added to ensure that the xylose concentration was not lower than 5g / L. After 48 hours of final fermentation, the HA yield was as high as 10.15g / L, which is the highest yield currently obtained by using probiotics as the chassis for producing HA.

[0118] Sequence of exogenous gene after codon optimization:

[0119] xylB:

[0120] ATGTCAAGTGCTATATATCCCTCTCTAAAAGGCAAGCGCGTCGTGATCACTGGTGGCGGC

[0121] AGCGGTATTGGTGCTGGCCTGACCGCAGGCTTCGCCCGTCAGGGTGCGGAGGTTATCTTT

[0122] CTGGATATTGCGGACGAGGACAGCCGTGCGCTTGAGGCCGAGTTAGCGGGTTCGCCGAT

[0123] TCCACCGGTTTACAAGCGTTGCGATCTGATGAATTTGGAGGCAATTAAAGCTGTGTTCGC

[0124] GGAGATCGGTGATGTTGATGTTCTTGTCAACAACGCGGGCAATGATGACCGCCACAAACT

[0125] GGCGGACGTGACCGGTGCGTACTGGGACGAACGCATTAACGTGAACCTGCGTCACATGC

[0126] TGTTTTGTACCCAGGCAGTAGCTCCGGGTATGAAAAAGCGCGGTGGCGGCGCTGTGATCA

[0127] ACTTTGGTTCCATTAGCTGGCATCTGGGCCTGGAAGACTTGGTTCTGTATGAAACGGCGA

[0128] AAGCGGGCATCGAAGGCATGACCAGAGCATTGGCACGTGAACTGGGTCCGGATGACATC

[0129] CGTGTGACGTGCGTTGTTCCGGGTAATGTTAAAACCAAGCGCCAAGAAAAGTGGTACAC

[0130] CCCGGAGGGTGAAGCGCAAATCGTGGCGGCGCAGTGTCTGAAAGGTCGTATCGTGCCGG

[0131] AGAACGTCGCTGCCTTGGTTCTGTTCCTCGCGTCTGACGACGCCAGCCTGTGCACCGGTCATGAATATTGGATTGATGCTGGCTGGCGTTAA(SEQ ID NO:1)

[0132] xylC:

[0133] CTAGACAAAGCTGATCTTATGTTGGGATTAGCTGGCCACATCGACCGCAACGGTGAACAT

[0134] ACCGCAGGCCAGCGTGTCCTGGGCCAAGGCTTGGTTGCCCAAGCTTTAGCGGGTGGCGG

[0135] CGAGATCGAGGGTCTGCAAGTGCGCCCAGCTGAAGCGGGTCTGGGTGACGTGGGCGGC

[0136] GGCCAATTTGATGCCCGTCATGGTGTGGCGTTGCGCCGCGAGGCGGACCGCGCGGAAAC

[0137] CGCTCCTCAGGGTGGTCCGCAAATCGCGTTTGGTATCGATGACAGAACTGTACGTATTGA

[0138] CATCGTGGCGCAGGGTGAGCTGCATGAAGATGCGTTGGTTCGTCAGCAAGCTGTGCTGG

[0139] GTCAAGTTGAAGGCGTGGACCGCCTGTTCCAGGGCGTCGGCGTGGTTGAGGGCCTGGCG

[0140] GTGGGTCGTGATGCACGTGCGGTGGGCGACGCGGATGTTGCAGTTCACCCGGGTGACGC

[0141] AGGTGAGGTTCATCCGATTGAACGTGCGGCAATTGTTCTCTTCCCGGTTGTGCACGGTGC

[0142] GGAGCCGCAGACCGCACTGCGTGTTGATCGTGGTGTGGTGGGCGCCGTCGTTCAGCGCC

[0143] GTGTTCTTGACCTGGAACAGCAGGCTGAGGCCCGTGGTCGTGTAGAAGCGGTTAATCCG

[0144] GGTTTACAAACGGACGACAAGGCGGGTCGTGCGGACGACCGCCGCGAGGAAGGCCACC

[0145] TGATCCGTCGTGTCGAGGCCGAGGCCTTGGCGGGGGGCGGTGTCGTGGTTGTGGATTTTA

[0146] CCCTGCTGGATGTGGATGAACCGCAGGGTGTCGCAATGCCGGATCGTGCGTTCGCACAGAGAGGCTTGCAAATTCCGTACGCGTCCGATCTGAGCGGTCAC(SEQ ID NO:2)

[0147] hasA

[0148] ATGAGAACACTTAAAAATCTGATCACGGTTGTTGCATTTAGCATCTTTTGGGTTCTGCTGA

[0149] TCTATGTTAATGTTTATTTATTTGGCGCAAAAGGCTCACTGTCAATCTATGGCTTTCTGCTG

[0150] ATCGCATATTTACTGGTTAAAATGAGCCTTAGCTTTTTTTATAAACCGTTTAAAGGAAGAG

[0151] CAGGCCAATATAAAGTTGCAGCAATTATCCCGAGCTATAATGAAGATGCAGAATCATTACT

[0152] TGAAACACTTAAATCAGTTCAACAACAAACGTATCCTCTGGCAGAAATCTATGTTGTTGAT

[0153] GATGGAAGCGCAGATGAAACAGGAATTAAACGCATCGAAGATTATGTTCGCGATACGGGG

[0154] GATCTCTCTTCTAATGTTATCGTTCATCGCTCAGAAAAAAATCAAGGCAAACGCCATGCAC

[0155] AAGCATGGGCATTTGAACGCTCAGATGCAGATGTTTTTCTTACAGTTGATAGCGATACGTA

[0156] TATCTATCCGGATGCACTTGAAGAACTTCTTAAAACATTTAATGATCCGACAGTTTTTGCA

[0157] GCAACGGGACATCTTAATGTTAGAAATAGACAAACGAATTTACTGACACGCCTGACGGAT

[0158] ATTCGCTATGATAATGCATTTGGAGTTGAACGCGCAGCACAAAGCGTTACAGGCAATATCC

[0159] TGGTTTGCTCAGGACCTCTGTCAGTTTATAGACGCGAAGTTGTTGTTCCTAATATCGATAA

[0160] ATATATTAATCAAACGTTTCTTGGGATTCCGGTTAGCATCGGCGATGATCGCTGCCTGACG

[0161] AATTATGCAACGGATCTGGGCAAAACGGTTTATCAATCTACAGCAAAATGCATTACGGATG

[0162] TTCCGGATAAAATGTCTACGTATCTTAAACAACAAAATAGATGGAATAAATCGTTTTTTCG

[0163] CGAATCAATTATCTCAGTTAAAAAAATCATGAATAATCCGTTTGTTGCACTGTGGACGATC

[0164] CTGGAAGTTAGCATGTTTATGATGCTGGTTTATAGCGTTGTTGATTTTTTTGTTGGCAATGT

[0165] TAGAGAATTTGATTGGCTGCGCGTTCTGGCATTTCTGGTTATTATCTTTATCGTTGCACTGT

[0166] GCCGCAATATTCATTATATGCTGAAACATCCGCTGAGCTTTCTGCTGTCACCGTTTTATGGA

[0167] GTTCTTCATTTATTTGTTCTTCAACCTCTGAAACTGTATAGCCTGTTTACGATTCGCAATGC

[0168] AGATTGGGGCACACGCAAAAAACTGCTTGCTAGCCATCATCATCATCATCATTAA(SEQ

[0169] ID NO:3)

[0170] SeHasA d (G38A&F304E)

[0171] ATGAGAACACTTAAAAATCTGATCACGGTTGTTGCATTTAGCATCTTTTGGGTTCTGCTGA

[0172] TCTATGTTAATGTTTATTTATTTGGCGCAAAAGGCTCACTGTCAATCTATGCCTTTCTGCTG

[0173] ATCGCATATTTACTGGTTAAAATGAGCCTTAGCTTTTTTTATAAACCGTTTAAAGGAAGAG

[0174] CAGGCCAATATAAAGTTGCAGCAATTATCCCGAGCTATAATGAAGATGCAGAATCATTACT

[0175] TGAAACACTTAAATCAGTTCAACAACAAACGTATCCTCTGGCAGAAATCTATGTTGTTGAT

[0176] GATGGAAGCGCAGATGAAACAGGAATTAAACGCATCGAAGATTATGTTCGCGATACGGGG

[0177] GATCTCTCTTCTAATGTTATCGTTCATCGCTCAGAAAAAAATCAAGGCAAACGCCATGCAC

[0178] AAGCATGGGCATTTGAACGCTCAGATGCAGATGTTTTTCTTACAGTTGATAGCGATACGTA

[0179] TATCTATCCGGATGCACTTGAAGAACTTCTTAAAACATTTAATGATCCGACAGTTTTTGCA

[0180] GCAACGGGACATCTTAATGTTAGAAATAGACAAACGAATTTACTGACACGCCTGACGGAT

[0181] ATTCGCTATGATAATGCATTTGGAGTTGAACGCGCAGCACAAAGCGTTACAGGCAATATCC

[0182] TGGTTTGCTCAGGACCTCTGTCAGTTTATAGACGCGAAGTTGTTGTTCCTAATATCGATAA

[0183] ATATATTAATCAAACGTTTCTTGGGATTCCGGTTAGCATCGGCGATGATCGCTGCCTGACG

[0184] AATTATGCAACGGATCTGGGCAAAACGGTTTATCAATCTACAGAAAATGCATTACGGATG

[0185] TTCCGGATAAAATGTCTACGTATCTTAAACAACAAAATAGATGGAATAAATCGTTTGAACG

[0186] CGAATCAATTATCTCAGTTAAAAAAATCATGAATAATCCGTTTGTTGCACTGTGGACGATC

[0187] CTGGAAGTTAGCATGTTTATGATGCTGGTTTATAGCGTTGTTGATTTTTTTGTTGGCAATGT

[0188] TAGAGAATTTGATTGGCTGCGCGTTCTGGCATTTCTGGTTATTATCTTTATCGTTGCACTGT

[0189] GCCGCAATATTCATTATATGCTGAAACATCCGCTGAGCTTTCTGCTGTCACCGTTTTATGGA

[0190] GTTCTTCATTTATTTGTTCTTCAACCTCTGAAACTGTATAGCCTGTTTACGATTCGCAATGCAGATTGGGGCACACGCAAAAAACTGCTTGCTAGCCATCATCATCATCATCATTAA(SEQ ID NO:4)

[0191] Matters not covered by the present invention are known technologies.

[0192] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. For those skilled in the art, the present invention may have various modifications and variations. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention shall be included in the protection scope of the present invention.

Claims

1. A genetically engineered strain of Escherichia coli producing hyaluronic acid, characterized in that: The Escherichia coli genetically engineered bacteria knock out the gene pck encoding phosphoenolpyruvate carboxykinase, the gene ppsA encoding phosphoenolpyruvate synthetase, the genes pykA and pykF encoding two isozymes of pyruvate kinase, the gene ppc encoding phosphoenolpyruvate carboxylase, and the gene ptsG encoding the key component EⅡCBGlc in the PTS system in the chassis bacteria; Any one or more of the genes ptsI encoding the phosphohistidine transport protein HPr, and overexpression of key genes in the hyaluronic acid synthesis pathway; Among them, the key genes of the hyaluronic acid synthesis pathway include any one or more of the gene ugdA encoding UDP-glucose 6-dehydrogenase, the gene pgm encoding glucose phosphoglucomutase, the gene glmU encoding the bifunctional enzyme acetylglucosamine pyrophosphorylase / glucose-1-phosphate acetyltransferase, the gene galU encoding glucose-6-phosphate uramide transferase, the gene glmS encoding glutamine-fructose-6-phosphate aminotransferase and the gene hasA encoding hyaluronic acid synthase.

2. The genetically engineered Escherichia coli according to claim 1, characterized in that: The hyaluronic acid-producing Escherichia coli genetically engineered bacteria overexpresses the D-xylose dehydrogenase gene xylB and the xylolactonase gene xylC in the Dahms pathway of xylose to convert xylose into xylulose; and simultaneously overexpresses the xylulose dehydratase encoding gene YjhG and the aldolase encoding gene YjhH.

3. The genetically engineered Escherichia coli according to claim 1, characterized in that: The base bacteria is Escherichia coliNissle1917.

4. The genetically engineered Escherichia coli according to claim 1, characterized in that: Among the key genes in the hyaluronic acid synthesis pathway, the gene ugdA encoding UDP-glucose 6-dehydrogenase, the gene pgm encoding glucose phosphoglucomutase, the gene glmU encoding acetylglucosamine pyrophosphorylase / glucose-1-phosphate acetyltransferase bifunctional enzyme, the gene galU encoding glucose-6-phosphate uramide transferase, and the gene glmS encoding glutamine-fructose-6-phosphate aminotransferase are derived from Escherichia coli MG1655; The gene hasA encoding hyaluronan synthase is derived from Streptococcus equi; further, the hyaluronan synthase is a hyaluronan synthase double mutant SeHasA (G38A&F304E).

5. Use of the genetically engineered Escherichia coli according to any one of claims 1 to 4 in the fermentation production of hyaluronic acid.

6. A method for producing hyaluronic acid by fermentation, characterized in that: The method comprises: fermenting and culturing the genetically engineered Escherichia coli according to any one of claims 1 to 4 to express hyaluronic acid; and separating and purifying the hyaluronic acid; Wherein, the fermentation medium contains at least glucose and xylose.

7. A method for constructing a genetically engineered Escherichia coli that produces hyaluronic acid, characterized in that: The construction method comprises: using Escherichia coli as the base bacteria, and performing the following transformation on the base bacteria: a) knocking out any one or more of the gene pck encoding phosphoenolpyruvate carboxykinase, the gene ppsA encoding phosphoenolpyruvate synthetase, the genes pykA and pykF encoding two isozymes of pyruvate kinase, the gene ppc encoding phosphoenolpyruvate carboxylase, and the gene ptsG encoding the key component EⅡCBGlc in the PTS system; and the gene ptsI encoding the phosphohistidine transport protein HPr in the chassis bacteria; b) overexpressing any one or more of the exogenous gene ugdA encoding UDP-glucose-6-dehydrogenase, the gene pgm encoding glucose phosphoglucomutase, the gene glmU encoding the bifunctional enzyme acetylglucosamine pyrophosphorylase / glucose-1-phosphate acetyltransferase, the gene galU encoding glucose-6-phosphate uramide transferase, the gene glmS encoding glutamine-fructose-6-phosphate aminotransferase, and the gene hasA encoding hyaluronan synthase; The construction method also includes overexpressing the D-xylose dehydrogenase gene xylB and the xylolactonase gene xylC in the Dahms pathway of exogenous xylose; and simultaneously overexpressing the xylulose dehydratase encoding gene YjhG and the aldolase encoding gene YjhH in the chassis bacteria.

8. The construction method according to claim 7, characterized in that: The base bacteria is Escherichia coliNissle1917.

9. The construction method according to claim 7, characterized in that: The gene ugdA encoding UDP-glucose 6-dehydrogenase, the gene pgm encoding glucose phosphomutase, the gene glmU encoding the bifunctional enzyme acetylglucosamine pyrophosphorylase / glucose-1-phosphate acetyltransferase, the gene galU encoding glucose-6-phosphate uramide transferase, and the gene glmS encoding glutamine-fructose-6-phosphate aminotransferase were derived from Escherichia coli MG1655; The gene hasA encoding hyaluronan synthase is derived from Streptococcus equi; further, the hyaluronan synthase is a hyaluronan synthase double mutant SeHasA (G38A&F304E).

10. Use of the genetically engineered Escherichia coli according to any one of claims 1 to 4 or the method for producing hyaluronic acid by fermentation according to claim 6 in the fields of medicine, cosmetics and food.

Images