Application of PARIT1 in Promoting the Maintenance and Reprogramming of Stem Cell Pluripotency

Abstract

The present invention discloses the application of PARIT1 in promoting the maintenance and reprogramming of stem cell pluripotency. The present invention discovers for the first time the new use of lncRNA PARIT1 in promoting the maintenance and / or reprogramming of stem cell pluripotency. The present invention provides a new idea and strategy for stably maintaining cell pluripotency and more efficiently inducing iPSCs, and has important theoretical and practical significance for promoting the application of stem cells and reprogramming technologies.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine technology, and specifically relates to the application of PARIT1 in promoting the maintenance and reprogramming of stem cell pluripotency. Background Art

[0002] Reprogramming terminally differentiated somatic cells into induced pluripotent stem cells (iPSCs) by introducing specific transcription factors, such as OCT4-SOX2-NANOG-C-MYC (OSKM), is a major milestone in the field of regenerative medicine, providing a new cell biology technology platform for cell fate research, cell therapy, and new drug development. However, how to stably maintain cell pluripotency and more efficiently induce iPSCs remains a major challenge in this field. In-depth exploration of the molecular mechanism of stem cell fate regulation and exploration of important regulatory factors of cell reprogramming are of great theoretical and practical significance for promoting the application of stem cells and reprogramming technology.

[0003] As the most abundant epigenetic regulatory factor in cells, lncRNA is not translated into protein, but it also plays an important role in the communication and interaction between organelles and the regulation of cell fate. The regulation of stem cell fate by lncRNA is reflected in monitoring the quality of stem cell genome and ensuring the maintenance of genomic homeostasis of stem cell and embryonic development. At the gene transcription level, lncRNA can cis-regulate the transcription of adjacent coding genes and participate in pluripotency regulation. However, how lncRNA regulates stem cell fate at the translation level and whether it participates in the coordination of stem cell organelle or sub-organelle function is still poorly understood and needs further study. Summary of the invention

[0004] In view of this, the object of the present invention is to provide the use of PARIT1 in promoting the maintenance of stem cell pluripotency and reprogramming.

[0005] The present invention adopts the following technical solutions to achieve the above-mentioned invention objectives:

[0006] The first aspect of the present invention provides the use of an agent that overexpresses lncRNA PARIT1 in promoting the maintenance of stem cell pluripotency and / or reprogramming.

[0007] Furthermore, the nucleotide sequence of the lncRNA PARIT1 is shown in SEQ ID NO:1.

[0008] Furthermore, the reagent includes a vector overexpressing lncRNA PARIT1, nanoparticles carrying lncRNA PARIT1, protein microspheres encapsulating lncRNA PARIT1, liposomes encapsulating lncRNA PARIT1 and / or any combination thereof.

[0009] Furthermore, the reagent is a vector overexpressing lncRNA PARIT1 or a PARIT1 RNA sequence synthesized in vitro;

[0010] Optionally, the vector overexpressing lncRNA PARIT1 includes a lentiviral vector overexpressing lncRNA PARIT1, an adeno-associated viral vector overexpressing lncRNA PARIT1, or an adenoviral vector overexpressing lncRNA PARIT1.

[0011] Furthermore, the stem cells include iPSCs, embryonic stem cells, mesenchymal stem cells, hematopoietic stem cells, neural stem cells, bone marrow stem cells, dental pulp stem cells, placental stem cells, umbilical cord stem cells, adipose stem cells or epidermal stem cells;

[0012] Optionally, overexpression of the lncRNA PARIT1 can promote the expression of pluripotency genes OCT4 and SOX2 in iPSCs or embryonic stem cells.

[0013] In the present invention, the PARIT1 is a lncRNA, and the nucleotide sequence of the PARIT1 is shown in SEQ ID NO: 1 or a derivative molecule thereof. In some embodiments, the PARIT1 is a molecule comprising the following sequences: (a) PARIT1 having a sequence as shown in SEQ ID NO: 1; (b) a molecule hybridizing with the sequence defined in (a) under stringent conditions; (c) a molecule having a sequence homology of more than 70% (e.g., 75%, 80%, 85%, 90%, 95%, 98%, 99%, 99.5% or more, or any value or range of values ​​therebetween) with the sequence of the molecule shown in (a) or (b).

[0014] In some embodiments, the agent for overexpressing lncRNA PARIT1 refers to any substance capable of promoting the expression of lncRNA PARIT1, including but not limited to: natural purified substances, modified natural purified substances, semi-synthetic substances, chemically synthesized substances and / or any combination thereof capable of promoting the expression of lncRNA PARIT1.

[0015] In some embodiments, the agent for overexpressing lncRNA PARIT1 includes but is not limited to: a recombinant vector containing lncRNA PARIT1, nanoparticles containing lncRNA PARIT1, protein microspheres containing lncRNA PARIT1, liposomes containing lncRNA PARIT1, PEG-modified proteins containing lncRNA PARIT1, extracellular vesicles containing lncRNA PARIT1, and / or any combination thereof.

[0016] In some embodiments, the vector is not particularly limited, as long as it can be used to deliver the lncRNA PARIT1 described in the present invention to overexpress lncRNA PARIT1, it is within the protection scope of the present invention, including but not limited to: lentiviral vectors, DNA plasmid vectors, retroviral vectors, poxvirus vectors, herpes simplex virus vectors, adenovirus vectors, adeno-associated virus vectors, liposomes combining DNA plasmids and RNA molecules, molecular couples combining DNA plasmids and RNA molecules, and / or polymers combining DNA plasmids and RNA molecules, etc.

[0017] In some embodiments, the agent overexpressing lncRNA PARIT1 includes but is not limited to: a viral vector overexpressing lncRNA PARIT1 or a non-viral vector overexpressing lncRNA PARIT1. In other embodiments, the viral vector includes but is not limited to: an adeno-associated viral vector, a lentiviral vector, a retroviral vector, an adenoviral vector, a herpes simplex virus vector, a Sendai virus vector and / or a Boca virus vector, wherein the adeno-associated viral vector includes AAV9, AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8 and / or AAV-DJ. In other embodiments, the non-viral vector includes but is not limited to: liposome nanoparticles, polymer nanoparticles, protein microspheres, exosomes, polypeptide complexes, aptamers and / or mRNA vectors.

[0018] In some embodiments, the vector overexpressing lncRNA PARIT1 is a lentiviral vector overexpressing lncRNA PARIT1. The lentiviral vector overexpressing lncRNA PARIT1 comprises the lncRNA PARIT1 and can integrate the lncRNA PARIT1 described herein into the genome of the host cell. The lentivirus overexpressing lncRNA PARIT1 described herein can be prepared by methods well known in the art. For example, a lentiviral vector containing the lncRNA PARIT1 described herein is first prepared, and then the virus is packaged in a suitable host cell, and the desired lentivirus is isolated and purified. Reagents for lentiviral packaging are well known in the art, such as conventional lentiviral vector systems (Tronolab) including but not limited to: pRsv-REV, pMDlg-pRRE, pMD2G, etc.

[0019] In some embodiments, the stem cells are not limited to the iPSCs, embryonic stem cells, mesenchymal stem cells, hematopoietic stem cells, neural stem cells, bone marrow stem cells, dental pulp stem cells, placental stem cells, umbilical cord stem cells, adipose stem cells or epidermal stem cells. Any stem cells that are not highly differentiated and have the potential to regenerate various tissues, organs and the human body (including but not limited to totipotent stem cells, pluripotent stem cells and unipotent stem cells) are within the scope of protection of the present invention.

[0020] The second aspect of the present invention provides the use of a lncRNA PARIT1 inhibitor in promoting the exit of stem cell pluripotency.

[0021] Furthermore, the nucleotide sequence of the lncRNA PARIT1 is shown in SEQ ID NO:1.

[0022] Furthermore, the lncRNA PARIT1 inhibitor includes any one or more of shRNA, siRNA, dsRNA, microRNA, and antisense nucleic acid targeting lncRNA PARIT1.

[0023] Furthermore, the lncRNAPARIT1 inhibitor is a shRNA or siRNA targeting lncRNA PARIT1;

[0024] Optionally, the sequence of the shRNA targeting lncRNAPARIT1 is shown in SEQ ID NO: 2 or SEQ ID NO: 3;

[0025] Optionally, the sequence of the siRNA targeting lncRNA PARIT1 is shown as SEQ ID NO:4 or SEQ ID NO:5.

[0026] In a specific embodiment of the present invention, the lncRNA PARIT1 inhibitor is a shRNA or siRNA targeting lncRNA PARIT1, the sequence of the shRNA targeting lncRNA PARIT1 is shown in SEQ ID NO: 2 or SEQ ID NO: 3, and the sequence of the siRNA targeting lncRNA PARIT1 is shown in SEQ ID NO: 4 or SEQ ID NO: 5;

[0027] siPARIT1-1:GGAGUGAGUAGCCUCCGUA (SEQ ID NO:4);

[0028] siPARIT1-2:GCUGUAGUCCAGGAAUAGU (SEQ ID NO:5).

[0029] Furthermore, the stem cells include iPSCs, embryonic stem cells, mesenchymal stem cells, hematopoietic stem cells, neural stem cells, bone marrow stem cells, dental pulp stem cells, placental stem cells, umbilical cord stem cells, adipose stem cells or epidermal stem cells;

[0030] Optionally, the lncRNA PARIT1 inhibitor can inhibit the formation of embryoid bodies and the differentiation of three germ layers of iPSCs or embryonic stem cells.

[0031] In some embodiments, the lncRNA PARIT1 inhibitor includes any biosynthetic substance, chemically synthesized substance, naturally purified substance, modified naturally purified substance, semi-synthetic substance and / or any combination thereof that can inhibit the expression level of PARIT1, including but not limited to: shRNA, siRNA, dsRNA, microRNA, antisense nucleic acid targeting PARIT1, and constructs, small molecule compounds, etc. that can express or form the siRNA, shRNA, dsRNA, microRNA, antisense nucleic acid. The lncRNA PARIT1 inhibitor described in the present invention is not limited to the shRNA targeting PARIT1 as shown in SEQ ID NO:2 or SEQ ID NO:3, and the siRNA targeting PARIT1 as shown in SEQ ID NO:4 or SEQ ID NO:5 used in the specific embodiments of the present invention.

[0032] In some embodiments, the shRNA refers to a short hairpin RNA, which includes two short inverted repeat sequences. The shRNA cloned into the shRNA expression vector includes two short inverted repeat sequences separated by a stem-loop sequence in the middle, forming a hairpin structure, which is controlled by the polⅢ promoter. Subsequently, 5-6 Ts are connected as the transcription terminator of RNA polymerase Ⅲ. The shRNA can be stably integrated into the genome of the cell, allowing long-term gene knockout.

[0033] In some embodiments, the siRNA refers to a small interfering ribonucleic acid, i.e. a relatively short-length double-stranded nucleic acid or optionally a longer precursor thereof. In some embodiments, the length of the available siRNA in the present invention is preferably a length of about 20 to 50 bp. However, there is no particular restriction on the length of the available siRNA. For example, the siRNA may initially be present in the cell in a precursor form, which is substantially different from the final or processed form of the siRNA that performs and exerts gene silencing activity when or after being delivered to the target cell. For example, the precursor form of the siRNA may include a precursor sequence element, which may be processed, degraded, changed or cut when or after being delivered to produce an siRNA that mediates gene silencing activity in the cell. In some embodiments, the precursor length of the available siRNA is, for example, about 100 to 200 base pairs or 50 to 100 base pairs or less than about 50 base pairs, which may produce active, processed siRNA in the target cell. In other embodiments, useful siRNAs or siRNA precursors are about 10 to 49 bp, or 15 to 35 bp, or about 21 to 30 bp in length.

[0034] In some embodiments, the dsRNA refers to a double-stranded ribonucleic acid, an RNA molecule formed by the renaturation of two complementary strands, which can be cleaved by the Dicer enzyme to form siRNA. dsRNA inhibits gene expression through RNA interference (RNAi), and dsRNA does not need to have 100% homology with the target gene sequence, as long as it can inhibit the expression of the target gene.

[0035] In some embodiments, the microRNA refers to microribonucleic acid (miRNA), which is a non-coding RNA of about 22 nt in length and widely present in various organisms from viruses to humans. The main function of mature miRNA is to negatively regulate the post-transcriptional level of genes, and participate in many life processes such as cell proliferation, apoptosis, immunity, neuroendocrine and stem cell differentiation by causing the degradation of its target mRNA or the interruption of the translation process.

[0036] In some embodiments, the antisense nucleic acid refers to a nucleic acid containing a sequence complementary to that encoding PARIT1. Antisense nucleic acids can be composed of DNA, RNA or both. Antisense nucleic acids may contain non-complementary bases as long as they can specifically hybridize under stringent conditions. When the antisense nucleic acid is introduced into a cell, it binds to the target polynucleotide and inhibits transcription, RNA processing or stability. In addition to antisense polynucleotides, antisense nucleic acids also include polynucleotide mimics, which contain a modified main chain, and 3' and 5' end portions. Such antisense nucleic acids can be appropriately designed based on the sequence information of PARIT1 and generated using methods known to those skilled in the art.

[0037] In some embodiments, the stem cells are not limited to the iPSCs, embryonic stem cells, mesenchymal stem cells, hematopoietic stem cells, neural stem cells, bone marrow stem cells, dental pulp stem cells, placental stem cells, umbilical cord stem cells, adipose stem cells or epidermal stem cells. Any stem cells that are not highly differentiated and have the potential to regenerate various tissues, organs and the human body (including but not limited to totipotent stem cells, pluripotent stem cells and unipotent stem cells) are within the scope of protection of the present invention.

[0038] A third aspect of the present invention provides any of the following methods:

[0039] (1) A method for promoting the maintenance and / or reprogramming of stem cell pluripotency for non-therapeutic purposes in vitro, the method comprising the following steps: administering an effective amount of the agent for overexpressing lncRNA PARIT1 described in the first aspect of the present invention to an in vitro stem cell system in need thereof;

[0040] (2) An in vitro method for promoting stem cell pluripotency exit for non-therapeutic purposes, the method comprising the following steps: administering an effective amount of the lncRNA PARIT1 inhibitor described in the second aspect of the present invention to an in vitro stem cell system in need thereof.

[0041] In some embodiments, the stem cells in the method include, but are not limited to, iPSCs, embryonic stem cells, mesenchymal stem cells, hematopoietic stem cells, neural stem cells, bone marrow stem cells, dental pulp stem cells, placental stem cells, umbilical cord stem cells, adipose stem cells, or epidermal stem cells. Any stem cells that are not highly differentiated and have the potential to regenerate various tissues, organs, and the human body (including, but not limited to, totipotent stem cells, pluripotent stem cells, and unipotent stem cells) are within the scope of protection of the present invention.

[0042] A fourth aspect of the present invention provides any of the following products:

[0043] (1) A product for promoting the maintenance and / or reprogramming of stem cell pluripotency, the product comprising the agent for overexpressing lncRNA PARIT1 as described in the first aspect of the present invention;

[0044] (2) A product for promoting the exit of stem cell pluripotency, the product comprising the lncRNA PARIT1 inhibitor described in the second aspect of the present invention.

[0045] In some embodiments, the product may also include a cell culture system, which includes but is not limited to: stem cell culture medium, stem cell-derived differentiation cell culture medium, ascorbic acid, acetylcysteine, quinoline dimethacrylate, BSA, SCF, EPO, Flt-3L, TPO, IL-3, UM171, VPA, LAA, Trolox, NAC, SR1, PVA and / or dexamethasone, etc.

[0046] Compared with the prior art, the present invention has the following beneficial effects:

[0047] The present invention is the first to discover a new use of lncRNA PARIT1 in promoting the maintenance of stem cell pluripotency and / or reprogramming. The present invention experimentally confirms that overexpression of lncRNA PARIT1 can promote the maintenance of stem cell pluripotency and / or reprogramming, and inhibition of lncRNA PARIT1 can inhibit stem cell pluripotency and / or reprogramming, providing a new idea and strategy for stably maintaining cell pluripotency and more efficiently inducing iPSCs, and has important theoretical and practical significance for promoting the application of stem cells and reprogramming technology. BRIEF DESCRIPTION OF THE DRAWINGS

[0048] Figure 1 :Combined Ribo-seq and CRIST-seq analysis of pluripotency-related ribosome-interacting lncRNAs, including: Figure A: Human H9, iPSC and FBL polyribosome separation curves; Figure B: Nuclear small RNA-U6 expression peak diagram, excluding contamination of nuclear components in the cytoplasm; Figure C: Comprehensive analysis of Ribo-seq and CRIST-seq of human H9, iPSC and FBL cells. PARIT1 is the most significantly differentially pluripotency-related ribosome-enriched transcript in H9 / iPSC and FBL screened by Ribo-seq and CRIST-seq.

[0049] Figure 2 : Identification of PARIT1 and its expression in pluripotent stem cell ribosomes, wherein, Figure A: RNA-seq and CRIST-seq sequencing peaks of PARIT1 (top), RACE method identified the full-length PARIT1 sequence and the positions of two exons (bottom); Figure B: The expression difference of PARIT1 in iPSC, H9 and FBL ribosomes, ***P<0.005, ****P<0.001vs.day 0; Figure C: With the differentiation of embryoid bodies, the expression of PARIT1 decreased; Figure D: The enrichment distribution of PARIT1 in the monomeric and polymeric components of ribosomes.

[0050] Figure 3: PARIT1 knockdown leads to cell pluripotency exit, where A: PARIT1 knockdown in iPSC and H9 cells using shRNA; B: PARIT1 knockdown leads to a significant decrease in the mRNA levels of stemness genes OCT4, SOX2 and NANOG in iPSC and H9 cells; C: PARIT1 knockdown leads to a decrease in the protein expression levels of stemness genes OCT4, SOX2 and NANOG in iPSC and H9 cells; D: PARIT1 knockdown changes the morphology of iPSC cells, tending to differentiated morphology. *P<0.05, **P<0.01, ***P<0.005, ****P<0.001vs.shCT.

[0051] Figure 4 : PARIT1 knockdown affects embryoid body formation and mesoderm and ectoderm differentiation. Figure A: Knockdown of PARIT1 causes failure of iPSC embryoid body culture; Figure B: Dynamic expression of various germ layer markers during embryoid body differentiation. Knockdown of PARIT1 inhibits mesoderm and ectoderm differentiation.

[0052] Figure 5 : PARIT1 overexpression promotes the maintenance of stem cell pluripotency, among which, Figure A: PARIT1 overexpression in human iPSC. **P<0.01vs.EV; Figure B: By partially replacing the pluripotency maintenance components in the culture system with FBS, cell differentiation was induced, and it was found that overexpression of PARIT1 can help maintain cell pluripotency and inhibit cell differentiation; Figure C: In the differentiation induction culture system, overexpression of PARIT1 can maintain pluripotency gene expression; Figure D: Overexpression of PARIT1 does not affect embryoid body formation.

[0053] Figure 6 : PARIT1 shuttling coordinates the functional interaction between the cell nucleus and ribosomes, among which, AB figure: RNA-pulldown-mass spectrometry analysis of PARIT1 binding protein map, showing binding to ribosomes, protein translation-related proteins and RNA processing and modification-related proteins; CD figure: RAT-PCR shows that PARIT1 binds to the promoters and enhancers of the stemness genes OCT4 and SOX2.

[0054] Figure 7 : Map of PARIT1 overexpression lentiviral plasmid with puromycin resistance.

[0055] Figure 8: Regulatory effect of PARIT1 on the multipotency of umbilical cord mesenchymal cells, wherein, Figure A: Detection of the expression levels of CD90, CD105, CD73 and CD44 after PARIT1 knockdown in MSC cells; Figure B: Detection of the expression levels of multipotent genes after PARIT1 knockdown in MSC cells; Figure C: Detection of the expression levels of multipotent genes after the lentiviral plasmid overexpressing PARIT1 was transferred into MSC cells. DETAILED DESCRIPTION

[0056] The present invention is further described below in conjunction with specific embodiments, which are only used to explain the present invention and cannot be understood as limiting the present invention. It can be understood by those skilled in the art that various changes, modifications, substitutions and variations can be made to these embodiments without departing from the principles and purpose of the present invention, and the scope of the present invention is defined by the claims and their equivalents.

[0057] The reagents and raw materials used in the present invention are easily obtained by ordinary technicians in the field and can be obtained from commercial channels unless otherwise specified. The experimental methods in the present invention that do not specify specific conditions are usually carried out under conventional conditions or under conditions recommended by the manufacturer. In particular, the following examples are only used to illustrate the present invention and should not limit the scope of the present invention in any way.

[0058] Example 1 Ribo-seq and CRIST-seq analysis to identify pluripotency-related lncRNAs enriched in ribosomes 1. Experimental materials

[0059] The human embryonic stem cell line H9 and iPSC clones, and skin fibroblasts FBL used in this project were kindly donated by the research group of Professor Miguel A. Esteban of the Guangzhou Institutes of Biomedicine and Health, Chinese Academy of Sciences. The skin fibroblasts were originally purchased from the Coriell Institute (AG06299).

[0060] 2. Experimental methods

[0061] The cytoplasm of human embryonic stem cell line H9, iPSC and fibroblast FBL was extracted, and after sucrose density gradient centrifugation, different density gradient samples were separated, and detected by spectrophotometer, and the absorbance curve was drawn ( Figure 1 A) to distinguish ribosomal monomeric and polymeric components. Extract RNA from polyribosomal components and total cellular RNA, and use high-throughput sequencing to analyze lncRNAs differentially expressed in pluripotent cells and differentiated cells (Ribo-seq). By observing the expression of RNU6-1 in the extracted ribosomal RNA, nuclear RNA contamination in the ribosomal RNA sample was excluded ( Figure 1B). CRIST-seq was used to analyze lncRNAs that interact with the promoters and enhancers of the pluripotent genes OCT4 and SOX2. The results of Ribo-seq and CRIST-seq were comprehensively analyzed to screen lncRNA transcript information that was differentially expressed in stem cells and fibroblasts, enriched in stem cell polyribosomes, and interacted with OCT4 and SOX2. After differential expression sorting and qPCR detection, the PARIT1 molecule was selected as the research object of this project.

[0062] 3. Experimental results

[0063] The comprehensive analysis results of Ribo-seq and CRIST-seq of human H9, iPSC and FBL cells are shown in Figure 1

[0064] Example 2 Expression of lncRNA PARIT1 in pluripotent stem cell ribosomes

[0065] 1. Experimental methods

[0066] The expression abundance of PARIT1 in H9, iPSC and FBL was detected. Specifically, Ribo-seq sequencing and CRIST-seq sequencing were used to detect the enrichment of PARIT1, and the full-length sequence and exon position of PARIT1 were identified by RACE method. The expression of PARIT1 in the ribosomes of iPSC, H9 and FBL cells was further verified by qPCR. The relationship between PARIT1 expression and cell pluripotency was analyzed by embryoid body differentiation experiment, and the ribosome monomeric and polymeric components were separated by sucrose density gradient centrifugation to analyze the enrichment distribution of PARIT1 on the ribosome.

[0067] 2. Experimental results

[0068] The expression abundance of PARIT1 in H9, iPSC and FBL is shown in Figure 2 As shown in A, PARIT1 was highly enriched in the Ribo-seq and CRIST-seq results of H9 and iPSC, but was not expressed in FBL. Based on the transcript location and sequence given by the sequencing results, the full length of PARIT1 was determined by RACE technology, and it was found that PARIT1 consists of 2 exons with a total length of 1161nt, located at chr12:14707427-14710251( Figure 2 A below). qPCR validation showed that PARIT1 was highly enriched in the ribosomes of iPSC and H9 cells, but not expressed in FBL ( Figure 2 B). The relationship between PARIT1 expression and cell pluripotency was analyzed by embryoid body differentiation experiment. It was found that with the differentiation of embryoid bodies and the exit of cell stemness, the expression of PARIT1 also decreased significantly ( Figure 2 C) The ribosome monomeric and polymeric components were separated by sucrose density gradient centrifugation, and the enrichment distribution of PARIT1 on the ribosome was analyzed. The results are shown in Figure 2 As shown in D, PARIT1 is enriched in both mono- and poly-ribosomes.

[0069] Example 3 PARIT1 knockdown leads to cell pluripotency exit

[0070] 1. Experimental methods

[0071] A PARIT1 shRNA knockdown lentiviral plasmid with puromycin resistance was constructed, and the embryonic stem cell line H9 and iPSC clones were transfected after packaging the lentivirus. Positive transfected cell clones were screened by puromycin. Total RNA and protein of PARIT1 knockdown cells were extracted, and RT-qPCR and Western Blot were used to detect the regulatory effect of PARIT1 on the expression of pluripotent genes OCT4, SOX2 and NANOG. At the same time, the expression of pluripotent genes was detected by immunofluorescence on cell slides, and the changes in cell pluripotency were analyzed by alkaline phosphatase-SSEA4 staining to clarify the regulatory effect of PARIT1 on pluripotent genes and cell pluripotency. Among them, the sequences corresponding to shPARIT1-1 and shPARIT1-2 are as follows:

[0072] shPARIT1-1:TAGCTGTAGTCCAGGAATAGT (SEQ ID NO:2);

[0073] shPARIT1-2: GCTACATGTGCCGGAAATCTG (SEQ ID NO: 3).

[0074] 2. Experimental results

[0075] Two shRNA lentiviruses were used to knock down PARIT1 in human H9 cells and iPSCs to observe its regulatory effect on cell pluripotency. Figure 3 As shown in A, the knockdown effect of shPARIT1-2 was more significant in H9 and iPSC. The mRNA expression levels of stemness genes in iPSC and H9 cells after PARIT1 knockdown were detected, and it was found that both shRNA lentiviruses could significantly reduce the mRNA expression of stemness genes OCT4, SOX2, and NANOG. Similarly, knockdown of PARIT1 reduced the protein expression levels of stemness genes OCT4, SOX2, and NANOG, especially in the shPARIT1-2 group, where the reduction in stemness gene protein expression was more obvious ( Figure 3 C). By observing the cell morphology, it was also found that compared with the shCT group, after PARIT1 knockdown, the iPSC cell morphology changed to spindle shape, the cell clone center became loosely structured, and tended to differentiate cell morphology ( Figure 3 D).

[0076] Example 4 PARIT1 knockdown affects embryoid body formation and mesoderm and ectoderm differentiation

[0077] 1. Experimental methods

[0078] Using AggreWell TM 800plates and AggreWell TMEB Formation Medium was used to induce PARIT1 knockdown or overexpressed H9 cells and iPSCs into embryoid bodies (EBs). The morphology of EBs was observed under a microscope, and the EBs were collected during the culture period of 1-7 days. Total RNA and total protein were extracted to detect the expression of pluripotent genes OCT4, SOX2, and NANOG, as well as endoderm markers SOX17, CXCR4, and FOXA2, mesoderm markers Brachyury (T), NCAM, and ectoderm markers PAX6 and Nestin, in order to clarify the regulatory effect of PARIT1 on the differentiation of pluripotent stem cells.

[0079] 2. Experimental results

[0080] The formation of embryoid bodies and the ability to differentiate into three germ layers are important indicators of stem cell pluripotency. In order to study the regulatory effect of PARIT1 on stem cell pluripotency, we cultured PARIT1-knockdown iPS cells in low-absorption U-shaped well plates (one embryoid body was formed in each well) and observed the formation of embryoid bodies and the expression of three germ layer differentiation markers. Figure 4 As shown in A, after 5-7 days of culture, iPS cells in the shCT group can form spherical embryoid bodies with regular shapes, while iPS cells with PARIT1 knockdown cannot form spherical embryoid bodies. By detecting markers of the three germ layers, it was found that knockdown of PARIT1 led to a significant blockage in the differentiation of mesoderm and ectoderm ( Figure 4 B), indicating that PARIT1 knockdown causes stem cells to exit pluripotency and impair differentiation function.

[0081] Example 5 PARIT1 overexpression promotes maintenance of stem cell pluripotency

[0082] 1. Experimental methods

[0083] Construction of PARIT1 overexpression lentiviral plasmid with puromycin resistance ( Figure 7 ), packaged lentivirus and transfected embryonic stem cell line H9 and iPSC clones, and positive transfected cell clones were selected by puromycin. Total RNA and protein of PARIT1 overexpressing cells were extracted, and RT-qPCR and Western Blot were used to detect the regulatory effect of PARIT1 on the expression of pluripotent genes OCT4, SOX2 and NANOG. At the same time, the expression of pluripotent genes was detected by immunofluorescence on cell slides, and the changes in cell pluripotency were analyzed by alkaline phosphatase-SSEA4 staining to clarify the regulatory effect of PARIT1 on pluripotent genes and cell pluripotency.

[0084] 2. Experimental results

[0085] By constructing PARIT1 overexpression lentivirus to transfect iPS cells, the effect of PARIT1 overexpression on the maintenance of cell pluripotency was observed. Figure 5 A) In this experiment, we partially replaced the pluripotency-maintaining additives in the iPSC culture system with FBS, induced differentiation, and observed whether PARIT1 overexpression could help cells resist differentiation and maintain pluripotency. Figure 5 As shown in B, from the observation of cell morphology, when the additive was reduced to 60%, the cells in the EV group that were transferred with the empty plasmid showed obvious differentiation morphology, while the cells overexpressing PARIT1 also showed differentiation trend, but maintained better stem cell morphology than the cells in the EV group. The expression of cell stemness gene protein was detected, and it was found that compared with the cells transferred with the empty vector, the overexpression of PARIT1 could alleviate the decrease in the expression level of stemness genes caused by external differentiation-promoting factors ( Figure 5 C). Using low-absorption U-shaped well plates to culture embryoid bodies, it was found that overexpression of PARIT1 had no effect on the formation of embryoid bodies. Like the control group, spherical embryoid bodies with regular shapes were formed ( Figure 5 D).

[0086] Example 6 PARIT1 interacts with nuclear stemness genes to shuttle and coordinate ribosome-nucleus functions 1. Experimental methods

[0087] First, RNA-pulldown-mass spectrometry was used to study the binding of PARIT1 to ribosome components in the cytoplasm and protein molecules distributed in the nucleus. At the same time, in order to study whether PARIT1 distributed in the nucleus interacts with stemness genes, the RAT method was used to retrieve the nuclear-bound DNA molecules of PARIT1. The specific method is as follows: 3-5×10 6 H9 or iPS cells were lysed by hypotonic method, and the cell nuclei were extracted by centrifugation. After washing twice, the purified cell nuclei were obtained. The collected cell nuclei were used for high temperature reverse transcription reaction. Three PARIT1 specific reverse primers were used as reverse transcription primers. The high temperature resistant reverse transcriptase Maxima (Thermo Scientific TM EP0751), reacted at 65°C for 1h, and labeled the newly synthesized cDNA molecules with biotin-dCTP. Unrelated sequence primers were used as controls. After ultrasonic cleavage of the reaction product, the cDNA-DNA complex was enriched with streptavidin magnetic beads. The complex was decrosslinked at 55°C overnight under the action of proteinase K, then digested with RNaseA, extracted with phenol-chloroform, and collected by alcohol precipitation. After library construction, it was analyzed by high-throughput sequencing. qPCR was further used to detect the enrichment of the promoter and enhancer regions of the key stemness genes OCT4 and SOX.

[0088] 2. Experimental results

[0089] RNA-pulldown-mass spectrometry studies have shown that PARIT1 not only binds to ribosome components in the cytoplasm, but also binds to many protein molecules distributed in the cell nucleus, including proteins related to DNA replication, repair, and RNA transcription processing ( Figure 6 AB). At the same time, in order to study whether PARIT1 distributed in the nucleus interacts with stemness genes, we used the RAT method to retrieve the nuclear-bound DNA molecules of PARIT1 and used qPCR to detect the enrichment of the promoter and enhancer regions of the key stemness genes OCT4 and SOX. The results showed that PARIT1 can bind to the promoter and enhancer sequence in exon 1 of OCT4, and can also bind to the promoter and enhancer sequence of SOX2 ( Figure 6 CD). This indicates that PARIT1 can enhance the long-range chromatin interaction between stemness gene promoters and enhancers. In the above experimental results, PARIT1 has a regulatory effect on the expression of stemness gene mRNA ( Figure 3 B) It may be mediated by this mechanism of regulating the spatial conformation of chromatin.

[0090] Example 7 PARIT1 regulates the multipotency of umbilical cord mesenchymal stem cells (MSCs) 1. Experimental methods

[0091] In P3 umbilical cord mesenchymal cells, PARIT1 was knocked down by siPARIT1-1 and siPARIT1-2, and the expression of PARIT1 in umbilical cord mesenchymal cells was analyzed by BD Stemflow TM Human MSC Analysis Kit (562245) was used to stain MSC multipotency marker molecules, and flow cytometry was used to detect CD90, CD105, CD73, and CD44, and the mean fluorescence intensity was analyzed.

[0092] 2. Experimental results

[0093] The results are as follows Figure 8 As shown by Figure 8 A shows that after knocking down PARIT1 in MSC cells, CD90, CD105, CD73 and CD44 were significantly reduced. Total cell protein was extracted, and Western Blot was used to detect the protein expression of pluripotency genes OCT4, SOX2 and NANOG. Figure 8 B shows that knocking down PARIT1 leads to decreased expression of pluripotent genes. Lentiviral plasmids overexpressing PARIT1 and empty plasmids were transferred into MSC cells, and Western Blot was used to detect the expression of pluripotent genes. Figure 8 As shown in C, overexpression of PARIT1 can promote the increase of pluripotent gene expression.

[0094] Example 8 Knockdown of PARIT1 inhibits reprogramming, and promoting the expression of PARIT1 promotes reprogramming

[0095] In addition, the present application demonstrates through reprogramming-related experiments that knocking down PARIT1 can inhibit reprogramming, while promoting the expression of PARIT1 can promote reprogramming.

Claims

1. Overexpression of lncRNA PARIT1 Use of a reagent for promoting the maintenance of stem cell pluripotency, characterized in that: The lncRNA PARIT1 The nucleotide sequence is shown in SEQ ID NO: 1; The stem cells are embryonic stem cells, iPSCs or mesenchymal stem cells; The reagent is overexpressed lncRNA PARIT1 carrier.

2. The use according to claim 1, characterized in that: The overexpressed lncRNA PARIT1 The vector is used to overexpress lncRNA PARIT1 Viral vectors carrying lncRNA PARIT1 Nanoparticles encapsulating lncRNA PARIT1 protein microspheres and / or any combination thereof.

3. The use according to claim 2, characterized in that: The lncRNA PARIT1 Nanoparticles for encapsulating lncRNA PARIT1 of liposomes.

4. The use according to claim 2, characterized in that: The overexpressed lncRNA PARIT1 Viral vectors for overexpression of lncRNA PARIT1 Lentiviral vectors, overexpression of lncRNA PARIT1 Adeno-associated virus vector or overexpression of lncRNA PARIT1 adenoviral vector.

5. The use according to claim 1, characterized in that: lncRNA PARIT1 Overexpression of can promote the expression of pluripotency genes OCT4 and SOX2 in iPSCs, embryonic stem cells or mesenchymal stem cells.

6. lncRNA PARIT1 Use of an inhibitor in promoting the exit of stem cell pluripotency, characterized in that The lncRNA PARIT1 The nucleotide sequence is shown in SEQ ID NO: 1; The stem cells are embryonic stem cells or iPSCs; The lncRNA PARIT1 Inhibitors targeting lncRNA PARIT1 shRNA.

7. The use according to claim 6, characterized in that: The targeted lncRNA PARIT1 The sequence of the shRNA is shown in SEQ ID NO:2 or SEQ ID NO:

3.

8. The use according to claim 6, characterized in that: The lncRNA PARIT1 The inhibitor can inhibit the formation of embryoid bodies and the differentiation of the three germ layers of iPSCs or embryonic stem cells.

9. A method for promoting the maintenance of stem cell pluripotency for non-therapeutic purposes in vitro, the method comprising the following steps: administering an effective amount of the overexpressed lncRNA described in any one of claims 1 to 4 to an in vitro stem cell system in need thereof PARIT1 of reagents.

10. A method for promoting stem cell pluripotency exit in vitro for non-therapeutic purposes, the method comprising the following steps: administering an effective amount of the lncRNA described in claim 6 or 7 to an in vitro stem cell system in need thereof PARIT1 Inhibitor.

Images