Application of TaMIP1 protein and coding gene thereof in regulation and control of plant drought resistance

Abstract

The invention discloses application of a TaMIP1 protein and a coding gene thereof in regulation and control of plant drought resistance. The TaMIP1 protein disclosed by the invention is A1), A2) or A3) as follows: A1) a protein of which the amino acid sequence is SEQ ID No.2, SEQ ID No.5 or SEQ ID No.8; a2) a protein which is obtained by substitution and / or deletion and / or addition of one or more amino acid residues of the amino acid sequence as shown in SEQ ID No.2, SEQ ID No.5 or SEQ ID No.8 in the sequence table and has the same function; and A3) a fusion protein obtained by connecting a label to the N end or / and C end of A1) or A2). Experiments prove that the TaMIP1 protein and the coding gene of the TaMIP1 protein can regulate the drought resistance of plants and have great production and application potential.

Description

Technical Field

[0001] The invention relates to the field of biotechnology and application of TaMIP1 protein and its encoding gene in regulating plant drought resistance. Background Art

[0002] Wheat (Triticum aestivum L.) is one of the three major grain crops in my country, and wheat production is crucial to ensuring my country's food security. In recent years, due to changes in the climate and environment, extreme weather events have occurred frequently, and abiotic stresses such as drought have seriously affected the growth and development of wheat, directly leading to a decrease in yield. Therefore, discovering genes related to wheat drought resistance is an important means to accurately select target traits and improve breeding efficiency, and can provide a theoretical basis for breeding drought-resistant varieties. Summary of the invention

[0003] The technical problem to be solved by the present invention is how to regulate the drought resistance of plants.

[0004] In order to solve the above technical problems, the present invention first provides any of the following applications of a protein or a substance for regulating the content or activity of the protein:

[0005] D1) Regulate plant drought resistance;

[0006] D2) preparing products for regulating plant drought resistance;

[0007] D3) Cultivating plants with modified drought resistance;

[0008] D4) preparing and cultivating drought-resistant modified plant products;

[0009] The protein is derived from wheat and is named TaMIP1. TaMIP1 is as follows A1), A2) or A3):

[0010] A1) a protein whose amino acid sequence is SEQ ID No. 2, SEQ ID No. 5 or SEQ ID No. 8;

[0011] A2) a protein having the same function as the amino acid sequence shown in SEQ ID No. 2, SEQ ID No. 5 or SEQ ID No. 8 in the sequence list, after one or more amino acid residues are substituted and / or deleted and / or added;

[0012] A3) A fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of A1) or A2).

[0013] The TaMIP1 protein in A2) above is a protein having 75% or more identity with the amino acid sequence of the protein shown in SEQ ID No.2, SEQ ID No.5 or SEQ ID No.8 and having the same function. Identity refers to the identity of the amino acid sequence. The identity of the amino acid sequence can be determined using a homology search site on the Internet, such as the BLAST page on the NCBI homepage website. For example, in Advanced BLAST2.1, by using blastp as a program, setting the Expect value to 10, setting all filters to OFF, using BLOSUM62 as a matrix, setting the Gap existence cost, Per residue gap cost and Lambda ratio to 11, 1 and 0.85 (default value) respectively, and searching for the identity of a pair of amino acid sequences, the identity value (%) can be calculated, and then the identity value (%) can be obtained. The 75% or more identity is 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity.

[0014] The TaMIP1 protein in A2) above can be artificially synthesized, or its encoding gene can be synthesized first and then expressed biologically.

[0015] The coding gene of TaMIP1 protein in A2) can be obtained by deleting one or several codons of amino acid residues in the DNA sequence shown in positions 169-1476 of SEQ ID No.1, positions 155-1489 of SEQ ID No.4 or positions 173-1504 of SEQ ID No.7, and / or performing missense mutation of one or several base pairs, and / or attaching a coding sequence of a tag at its 5′ end and / or 3′ end. Wherein, the DNA molecules shown in positions 169-1476 of SEQ ID No.1, positions 155-1489 of SEQ ID No.4 and positions 173-1504 of SEQ ID No.7 encode TaMIP1 proteins shown in SEQ ID No.2, SEQ ID No.5 and SEQ ID No.8, respectively.

[0016] The tag in A3) can be a polypeptide or protein fused and expressed with the target protein using DNA in vitro recombination technology to facilitate the expression, detection, tracing and / or purification of the target protein. The tag can be Poly-Arg, Poly-His, FLAG, Strep-tag II, c-myc, MBP tag, HA tag, GST tag and / or SUMO tag, etc.

[0017] In the above application, the substance may be any one of the following B1) to B9):

[0018] B1) Nucleic acid molecule encoding TaMIP1 protein;

[0019] B2) an expression cassette containing the nucleic acid molecule described in B1);

[0020] B3) a recombinant vector containing the nucleic acid molecule described in B1), or a recombinant vector containing the expression cassette described in B2);

[0021] B4) a recombinant microorganism containing the nucleic acid molecule described in B1), or a recombinant microorganism containing the expression cassette described in B2), or a recombinant microorganism containing the recombinant vector described in B3);

[0022] B5) a transgenic plant cell line containing the nucleic acid molecule described in B1) or a transgenic plant cell line containing the expression cassette described in B2);

[0023] B6) transgenic plant tissue containing the nucleic acid molecule described in B1), or transgenic plant tissue containing the expression cassette described in B2);

[0024] B7) a transgenic plant organ containing the nucleic acid molecule described in B1) or a transgenic plant organ containing the expression cassette described in B2);

[0025] B8) a nucleic acid molecule that reduces the content or activity of TaMIP1 protein;

[0026] B9) An expression cassette, a recombinant vector, a recombinant microorganism, a transgenic plant cell line, a transgenic plant tissue or a transgenic plant organ containing the nucleic acid molecule described in B8).

[0027] In the above application, the nucleic acid molecule in B1) may be the following b11) or b12) or b13) or b14) or b15) or b16):

[0028] b11) the coding sequence is a cDNA molecule or DNA molecule of positions 169-1476 of SEQ ID No. 1, positions 155-1489 of SEQ ID No. 4, or positions 173-1504 of SEQ ID No. 7 in the sequence listing;

[0029] b12) cDNA molecules or DNA molecules shown in positions 169-1476 of SEQ ID No. 1, positions 155-1489 of SEQ ID No. 4, or positions 173-1504 of SEQ ID No. 7 in the sequence listing;

[0030] b13) cDNA molecules or DNA molecules shown in SEQ ID No. 1, SEQ ID No. 4 or SEQ ID No. 7 in the sequence list;

[0031] b14) a DNA molecule shown in SEQ ID No.3, SEQ ID No.6 or SEQ ID No.9 in the sequence listing;

[0032] b15) a DNA molecule having 75% or more identity with the nucleotide sequence defined in b11) or b12) or b13) or b14) and encoding TaMIP1 protein;

[0033] b16) A DNA molecule which hybridizes under stringent conditions with the nucleotide sequence defined in b11) or b12) or b13) or b14) or b15) and encodes TaMIP1 protein.

[0034] The nucleic acid molecule may be DNA, such as cDNA, genomic DNA or recombinant DNA; the nucleic acid molecule may also be RNA, such as mRNA or hnRNA.

[0035] A person skilled in the art can easily mutate the nucleotide sequence encoding the TaMIP1 protein of the present invention by using known methods, such as directed evolution and point mutation. Those artificially modified nucleotides having 75% or higher identity with the nucleotide sequence of the TaMIP1 protein isolated from the present invention are derived from the nucleotide sequence of the present invention and are equivalent to the sequence of the present invention as long as they encode the TaMIP1 protein and have the function of the TaMIP1 protein.

[0036] The term "identity" as used herein refers to sequence similarity to a natural nucleic acid sequence. "Identity" includes nucleotide sequences that have 75% or more, or 85% or more, or 90% or more, or 95% or more identity to the nucleotide sequence encoding the protein of SEQ ID No. 2, SEQ ID No. 5 or SEQ ID No. 8 of the present invention. Identity can be evaluated by the naked eye or by computer software. Using computer software, the identity between two or more sequences can be expressed as a percentage (%), which can be used to evaluate the identity between related sequences.

[0037] In the above application, the stringent conditions may be as follows: hybridization at 50°C in a mixed solution of 7% sodium dodecyl sulfate (SDS), 0.5M NaPO4 and 1mM EDTA, and washing at 50°C in 2×SSC, 0.1% SDS.

[0038] The above 75% or more identity may be 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity.

[0039] In the above application, the expression cassette containing the nucleic acid molecule encoding TaMIP1 protein (TaMIP1 gene expression cassette) described in B2) refers to a DNA capable of expressing TaMIP1 protein in a host cell, and the DNA may include not only a promoter for initiating transcription of the TaMIP1 gene, but also a terminator for terminating transcription of the TaMIP1 gene. Furthermore, the expression cassette may also include an enhancer sequence.

[0040] Existing expression vectors can be used to construct a recombinant vector containing the TaMIP1 gene expression cassette.

[0041] B8) The nucleic acid molecule that reduces the content of TaMIP1 may be a sgRNA targeting the gene encoding TaMIP1.

[0042] B9) The recombinant vector can be a recombinant vector prepared by using the crisper / cas9 system that can edit the TaMIP1 gene. The recombinant vector can express the sgRNA targeting the nucleic acid molecule in B1). The target sequence of the sgRNA can be 230-252 and / or 412-434 of SEQ ID No.3 in the sequence list (i.e., 219-241 and / or 404-426 of SEQ ID No.6, 237-259 and / or 422-444 of SEQ ID No.9).

[0043] In the above application, the microorganism can be yeast, bacteria, algae or fungi. Among them, the bacteria can be Agrobacterium.

[0044] In the above applications, the transgenic plant cell lines, transgenic plant tissues and transgenic plant organs do not include propagation materials.

[0045] In the above application, the substance regulating the content or activity of TaMIP1 protein may be a substance reducing the content or activity of TaMIP1 protein, the regulating plant drought resistance may be reducing plant drought resistance, and the cultivating plants with altered drought resistance may be cultivating plants with reduced drought resistance.

[0046] The present invention also provides any of the following methods:

[0047] X1) A method for reducing drought resistance of a plant, comprising: reducing the content or activity of TaMIP1 protein in a recipient plant, or knocking out a gene encoding TaMIP1 protein in a recipient plant, or reducing the expression level of a gene encoding TaMIP1 protein in a recipient plant, thereby obtaining a target plant having reduced drought resistance compared with the recipient plant, thereby reducing drought resistance of the plant;

[0048] X2) A method for cultivating plants with reduced drought resistance, comprising: reducing the content or activity of TaMIP1 protein in a recipient plant, or knocking out the gene encoding the TaMIP1 protein in the recipient plant, or reducing the expression level of the gene encoding the TaMIP1 protein in the recipient plant, to obtain a target plant with reduced drought resistance compared to the recipient plant.

[0049] Wherein, methods X1) and X2) can be implemented by editing the coding gene of TaMIP1 protein. The coding gene can be the nucleic acid molecule described in B1).

[0050] Gene editing of the coding gene by the CRISPR / Cas9 method can be performed by introducing a recombinant vector encoding Cas9 and capable of transcribing sgRNA targeting the coding gene into the recipient plant to screen for the target plant in which the coding gene is edited.

[0051] In one embodiment of the present invention, the target plants are mip1-1, mip1-2 and mip1-6:

[0052] mip1-1: The genome is missing from positions 247 to 417 of SEQ ID No.3, positions 235 to 409 of SEQ ID No.6, and positions 253 to 427 of SEQ ID No.9;

[0053] mip1-2: the genome is missing from positions 247 to 500 of SEQ ID No. 3 and inserting CCGCGGGCCCGCGGATCTATGTGTATGTGCGTGTGTTTTAACCTTTTCACAG, inserting an A between positions 235 and 236 of SEQ ID No. 6, and missing from positions 253 to 428 of SEQ ID No. 9;

[0054] mip1-6: The genome has an A inserted between positions 246-247 of SEQ ID No.3, a G inserted between positions 235-236 of SEQ ID No.6, and lacks positions 210-254 and 428-431 of SEQ ID No.9.

[0055] The recombinant expression vector can be introduced into plant cells by conventional biotechnology methods such as Ti plasmid, plant virus vector, direct DNA transformation, microinjection, electroporation, etc. (Weissbach, 1998, Method for Plant Molecular Biology VIII, Academy Press, New York, pp. 411-463; Geiserson and Corey, 1998, Plant Molecular Biology (2nd Edition).).

[0056] The target plant is understood to include not only the first generation plant in which the TaMIP1 protein or its encoding gene is modified, but also its progeny. For the target plant, the gene can be propagated in the species, and the gene can also be transferred into other varieties of the same species using conventional breeding techniques, especially including commercial varieties. The target plant includes seeds, callus, complete plants and cells.

[0057] The TaMIP1 protein or the substance regulating the content or activity of the TaMIP1 protein also falls within the protection scope of the present invention.

[0058] In the present invention, the plant may be M1) or M2) or M3):

[0059] M1) monocots or dicots;

[0060] M2) Gramineae;

[0061] M3) Wheat.

[0062] Experiments have shown that knocking out the TaMIP1 gene in plants can reduce the drought resistance of plants. The TaMIP1 protein and the gene encoding it in the present invention can regulate the drought resistance of plants and have great production and application potential.

[0063] The present invention is further described in detail below in conjunction with specific embodiments, and the examples provided are only for illustrating the present invention, rather than for limiting the scope of the present invention. The examples provided below can be used as a guide for further improvements by those of ordinary skill in the art, and do not constitute a limitation of the present invention in any way. BRIEF DESCRIPTION OF THE DRAWINGS

[0064] Figure 1 Sequence changes in gene-edited strains.

[0065] Figure 2 The results of drought resistance test. (a) WT and mip1Phenotypes of mutants. (b) Soil water content during drought treatment and rewatering. (c) Survival rate results. DETAILED DESCRIPTION

[0066] The experimental methods in the following examples, unless otherwise specified, are all conventional methods, and are carried out according to the techniques or conditions described in the literature in the art or according to the product instructions. The materials, reagents, instruments, etc. used in the following examples, unless otherwise specified, can all be obtained from commercial sources. The quantitative tests in the following examples were all repeated at least three times, and the results were averaged. In the following examples, unless otherwise specified, the first position of each nucleotide sequence in the sequence table is the 5' terminal nucleotide of the corresponding DNA / RNA, and the last position is the 3' terminal nucleotide of the corresponding DNA / RNA.

[0067] Fielder wheat: gifted by Xin Mingming's laboratory at China Agricultural University. Hexaploid common wheat, bred in the United States in 1974, is commonly used for Agrobacterium-mediated transformation and gene editing receptors. References: Sato K, Abe F, Mascher M, Haberer G, Gundlach H, Spannagl M, Shirasawa K, Isobe S. Chromosome-scale genome assembly of the transformation-amenable common wheat cultivar 'Fielder'. DNA Res. 2021 Jun 25; 28(3): dsab008. doi: 10.1093 / dnares / dsab008. PMID: 34254113; PMCID: PMC8320877.

[0068] Agrobacterium tumefaciens EHA105: Reference: Torisky RS, Kovacs L, Avdiushko S, Newman JD, Hunt AG, Collins GB. Development of a binary vector system for plant transformation based on the supervirulent Agrobacterium tumefaciens strain Chry5. Plant Cell Reports, (1997) 17: 102-108.; available to the public from the Institute of Crop Sciences, Chinese Academy of Agricultural Sciences.

[0069] Example 1: TaMIP1 gene can regulate drought resistance in wheat

[0070] In this example, a gene capable of regulating drought resistance was found in wheat Chinese Spring, which is named TaMIP1 gene. The three TaMIP1 homologous genes are TaMIP1-2A, TaMIP1-2B, and TaMIP1-2D.

[0071] In Chinese spring, the full-length cDNA of TaMIP1-2A gene is shown in SEQ ID No.1 in the sequence list, and the nucleotides at positions 169-1476 are an open reading frame, encoding the TaMIP1-2A protein shown in SEQ ID No.2, and its genomic sequence is shown in SEQ ID No.3; the full-length cDNA of TaMIP1-2B gene is shown in SEQ ID No.4 in the sequence list, and the nucleotides at positions 155-1489 are an open reading frame, encoding the TaMIP1-2B protein shown in SEQ ID No.5, and its genomic sequence is shown in SEQ ID No.6; the full-length cDNA of TaMIP1-2D gene is shown in SEQ ID No.7 in the sequence list, and the nucleotides at positions 173-1504 are an open reading frame, encoding the TaMIP1-2D protein shown in SEQ ID No.8, and its genomic sequence is shown in SEQ ID No.9.

[0072] 1. Preparation of genetically modified wheat

[0073] Using wheat Fielder as the receptor, the TaMIP1 gene was knocked out. The cDNA, genomic sequence and encoded proteins of TaMIP1-2A, TaMIP1-2B, and TaMIP1-2D in Fielder were the same as those in Chinese Spring.

[0074] 1) Construction of recombinant gene editing vector

[0075] 1. Use the online website (http: / / www.e-crisp.org / E-CRISP / ) to predict the editing sites of the TaMIP1 gene.

[0076] 2. According to the TaMIP1 genome, the conserved regions of TaMIP1-2A, TaMIP1-2B and TaMIP1-2D were searched for to design the target sites of TaMIP1 gene. The two target sites were 230-252 and 412-434 of SEQ ID No.3, 219-241 and 404-426 of SEQ ID No.6, and 237-259 and 422-444 of SEQ ID No.9. Then, four primers were designed according to the instructions for use of the vector, specifically: upstream primer F (5'-aataatggtctcAGGCgTGTCTCACACGGCATGTGG-3'), F0 (5'-gTGTCTCACACGGCATGTGGgttttagagctagaaatagc-3') and downstream primer R (5'-ATTATT GGTCTCTAAAC GGGAACAACAGCTCCGTAA-3'), R0(5'-GGGAACAACAGCTCCGTAACGCTTCTTGGTGCC-3').

[0077] 3. Dissolve and mix four primers (TaMIP1-MT1T2 F / F0 / R0 / R), pass the target sequence through T4 DNALigase and endonuclease BasI (both are products of NEB), adopt the method of enzyme cutting and ligation, adopt the Golden gate vector construction method, use pCBC-MT1T2 as the intermediate vector and pBUE414 as the final vector to construct a recombinant vector for editing the TaMIP1 gene, namely the TaMIP1 gene editing wheat vector. The obtained vector can simultaneously transcribe two sgRNAs targeting SEQ ID No.3, 6, and 9.

[0078] 4. After the TaMIP1 gene-edited wheat vector was introduced into Agrobacterium tumefaciens EHA105, wheat Fielder was transformed through Agrobacterium-mediated genetic transformation to obtain gene-edited plants. Specific primers were synthesized for the editing sites, and the target genes were amplified respectively. Then, sequencing was performed to identify the editing status, and transgenic wheat mip1-1, mip1-2 and mip1-6 edited with the TaMIP1 gene were obtained.

[0079] A pair of specific primers F (5′-CCACTACCCCTCATCTTAGCTTC-3′) and R (5′-ATGGGTCATTCAGCATGCTT-3′) for the TaMIP1-2A genome, a pair of specific primers F (5′-CCAGATCGGCCAAGAAAC-3′) and R (5′-AGCAGCAGCTGTTGTCCAG-3′) for the TaMIP1-2B genome, and a pair of specific primers F (5′-CATCTCGCTCCTCTCTGCC-3′) and R (5′-CACCAGCAGCAGCATCAG-3′) for the TaMIP1-2D genome were used for amplification. Sequencing showed that the sequence changes of the three gene-edited strains (mip1-1, mip1-2, and mip1-6) were as follows. Figure 1 As shown, the details are as follows:

[0080] mip1-1: The TaMIP1-2A genome lacks 171 nucleotides (i.e., lacks positions 247-417 of SEQ ID No.3); the TaMIP1-2B genome lacks 175 nucleotides (i.e., lacks positions 235-409 of SEQ ID No.6); the TaMIP1-2D genome lacks 175 nucleotides (i.e., lacks positions 253-427 of SEQ ID No.9).

[0081] mip1-2: The TaMIP1-2A genome deleted 254 nucleotides and inserted 52 nucleotides (i.e., positions 247-500 of SEQ ID No. 3 were deleted and CCGCGGGCCCGCGGATCTATGTGTATGTGCGTGTGTTTTAACCTTTTCACAG was inserted), resulting in a frameshift mutation and premature termination of translation; the TaMIP1-2B genome inserted 1 nucleotide (i.e., an A was inserted between positions 235-236 of SEQ ID No. 6), resulting in a frameshift mutation and premature termination of translation; the TaMIP1-2D genome deleted 176 nucleotides (i.e., positions 253-428 of SEQ ID No. 9 were deleted).

[0082] mip1-6: One nucleotide was inserted into the TaMIP1-2A genome (i.e., an A was inserted between positions 246-247 of SEQ ID No.3), resulting in a frameshift mutation and premature termination of translation; one nucleotide was inserted into the TaMIP1-2B genome (i.e., a G was inserted between positions 235-236 of SEQ ID No.6), resulting in a frameshift mutation and premature termination of translation; the TaMIP1-2D genome lacked two fragments totaling 49 nucleotides (i.e., lacked positions 210-254 and 428-431 of SEQ ID No.9), resulting in a frameshift mutation and premature termination of translation.

[0083] 3. Drought resistance identification

[0084] Wheat to be tested: transgenic recipient wheat Fielder (negative control, WT) and gene-edited lines mip1-1, mip1-2 and mip1-6. The experiment was divided into two groups, drought treatment group and control group.

[0085] 1. Treat the wheat seeds to be tested with 1% hydrogen peroxide for 1 day to break dormancy.

[0086] 2. Select seedlings with consistent germination and growth and plant them in the same plastic box (56cm×38cm×11cm). Sow 30 seeds for each strain. Bury the plastic box in outdoor soil and keep the height of the plastic box at the same level as the ground.

[0087] 3. The seedlings grown to the three-leaf and one-heart stage were subjected to drought treatment (i.e., watering was stopped). After 18 days of drought treatment (i.e., when the phenotypes of wild-type and transgenic wheat plants showed obvious differences), they were re-watered. The survival rate was calculated 3 days after re-watering, and the soil moisture content was measured at each stage. Three independent biological replicates were set up. The seedlings without drought treatment (normal watering) were used as controls.

[0088] The seedling survival rate was calculated according to the following formula: survival rate (%) = number of surviving plants / number of planted plants (30) × 100%.

[0089] The results are as follows Figure 2 As shown in Figure 2, compared with the wild type, the leaves of the gene-edited lines showed obvious wilting under drought stress ( Figure 2 (a). After rehydration, the survival rate of the wild type was significantly higher than that of the mip1 strain ( Figure 2 b, c), indicating that TaMIP1 can regulate drought resistance in wheat seedlings.

[0090] The present invention has been described in detail above. It will be apparent to those skilled in the art that the present invention may be implemented in a wide range under equivalent parameters, concentrations and conditions without departing from the spirit and scope of the present invention and without the need for unnecessary experimentation. Although the present invention provides specific embodiments, it should be understood that further improvements may be made to the present invention. In short, according to the principles of the present invention, this application intends to include any changes, uses or improvements to the present invention, including changes made by conventional techniques known in the art that depart from the scope disclosed in this application. Applications of some of the basic features may be made within the scope of the following appended claims.

Claims

1. Any of the following uses of a protein or a substance for regulating the content or activity of the protein: D1) Regulate plant drought resistance; D2) preparing products for regulating plant drought resistance; D3) Cultivating plants with modified drought resistance; D4) preparing and cultivating drought-resistant modified plant products; The protein is the following A1), A2) or A3): A1) a protein whose amino acid sequence is SEQ ID No. 2, SEQ ID No. 5 or SEQ ID No. 8; A2) a protein having the same function as the amino acid sequence shown in SEQ ID No. 2, SEQ ID No. 5 or SEQ ID No. 8 in the sequence list, after one or more amino acid residues are substituted and / or deleted and / or added; A3) A fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of A1) or A2).

2. The use according to claim 1, characterized in that: The substance is any one of the following B1) to B9): B1) a nucleic acid molecule encoding the protein; B2) an expression cassette containing the nucleic acid molecule described in B1); B3) a recombinant vector containing the nucleic acid molecule described in B1), or a recombinant vector containing the expression cassette described in B2); B4) a recombinant microorganism containing the nucleic acid molecule described in B1), or a recombinant microorganism containing the expression cassette described in B2), or a recombinant microorganism containing the recombinant vector described in B3); B5) a transgenic plant cell line containing the nucleic acid molecule described in B1) or a transgenic plant cell line containing the expression cassette described in B2); B6) transgenic plant tissue containing the nucleic acid molecule described in B1), or transgenic plant tissue containing the expression cassette described in B2); B7) a transgenic plant organ containing the nucleic acid molecule described in B1) or a transgenic plant organ containing the expression cassette described in B2); B8) a nucleic acid molecule that reduces the protein content or activity; B9) An expression cassette, a recombinant vector, a recombinant microorganism, a transgenic plant cell line, a transgenic plant tissue or a transgenic plant organ containing the nucleic acid molecule described in B8).

3. The use according to claim 2, characterized in that: B1) The nucleic acid molecule is the following b11) or b12) or b13) or b14) or b15) or b16): b11) the coding sequence is a cDNA molecule or DNA molecule of positions 169-1476 of SEQ ID No. 1, positions 155-1489 of SEQ ID No. 4, or positions 173-1504 of SEQ ID No. 7 in the sequence listing; b12) cDNA molecules or DNA molecules shown in positions 169-1476 of SEQ ID No. 1, positions 155-1489 of SEQ ID No. 4, or positions 173-1504 of SEQ ID No. 7 in the sequence listing; b13) cDNA molecules or DNA molecules shown in SEQ ID No. 1, SEQ ID No. 4 or SEQ ID No. 7 in the sequence list; b14) a DNA molecule shown in SEQ ID No.3, SEQ ID No.6 or SEQ ID No.9 in the sequence listing; b15) a DNA molecule having 75% or more identity with the nucleotide sequence defined in b11) or b12) or b13) or b14) and encoding the protein; b16) A DNA molecule which hybridizes under stringent conditions with the nucleotide sequence defined in b11) or b12) or b13) or b14) or b15) and encodes the protein.

4. The use according to any one of claims 1 to 3, characterized in that: The substance that regulates the protein content or activity is a substance that reduces the protein content or activity, the substance that regulates plant drought resistance is a substance that reduces plant drought resistance, and the substance that cultivates plants with altered drought resistance is a substance that cultivates plants with reduced drought resistance.

5. The use according to any one of claims 1 to 4, characterized in that: The plant is M1) or M2) or M3): M1) monocots or dicots; M2) Gramineae; M3) Wheat.

6. Any of the following methods: X1) A method for reducing drought resistance of plants, comprising: Reducing the content or activity of the protein described in claim 1 in a recipient plant, or knocking out the gene encoding the protein described in claim 1 in a recipient plant, or reducing the expression level of the gene encoding the protein described in claim 1 in a recipient plant, to obtain a target plant with reduced drought resistance compared with the recipient plant, thereby achieving a reduction in plant drought resistance; X2) A method for cultivating plants with reduced drought resistance, comprising: reducing the content or activity of the protein described in claim 1 in a recipient plant, or knocking out the gene encoding the protein described in claim 1 in the recipient plant, or reducing the expression level of the gene encoding the protein described in claim 1 in the recipient plant, to obtain a target plant with reduced drought resistance compared with the recipient plant.

7. The method according to claim 6, characterized in that: Methods X1) and X2) are achieved by editing the gene encoding the protein described in claim 1.

8. The method according to claim 6 or 7, characterized in that: The plant is M1) or M2) or M3): M1) monocots or dicots; M2) Gramineae; M3) Wheat.

9. The protein according to claim 1 or the substance for regulating the content or activity of the protein according to any one of claims 1 to 3.

Images