Composition for detecting ovarian cancer and application thereof

Abstract

The invention provides a composition for detecting ovarian cancer and application thereof, the composition comprises nucleic acid for detecting the methylation state of a target gene, and the target gene is one or more than two of a TFAP2E gene, a WNT10A gene and an IFFO1 gene. The invention also provides a kit comprising the composition, and application of the composition in preparation of the kit for in-vitro detection of ovarian cancer.

Description

Technical Field

[0001] The present application belongs to the field of molecular biology and relates to gene detection, and specifically to a nucleic acid composition for detecting methylation of ovarian cancer-related genes and its corresponding kit and use. Background Art

[0002] Ovarian cancer is one of the common gynecological malignancies, with a mortality rate that ranks first among female reproductive tract malignancies. It is a malignant tumor that seriously threatens women's health. Ovarian cancer has a high heterogeneity, with about 90% belonging to epithelial ovarian cancer, of which about 70% are serous and have a poor prognosis. The 5-year survival rate of patients with early (stage I) ovarian cancer exceeds 90%. However, early ovarian cancer has no obvious clinical symptoms, and most patients are difficult to detect in time at an early stage; 60%-70% are already in the late stage when diagnosed. The 5-year survival rate of stage I ovarian cancer can be as high as 90%, stage II is about 80%, and the 5-year survival rate of stage III / IV patients is only 30% to 40%. Therefore, it is of great significance to find a reliable method for early detection of ovarian cancer.

[0003] Currently, there are several main tests for ovarian cancer: transvaginal ultrasound (TVUS), which uses ultrasonic echoes to transmit imaging images, can help identify potential ovarian hyperplasia and determine whether they are solid hyperplasia or cysts (cysts are non-cancerous, fluid-filled sacs). If a solid mass is found, the doctor may request a biopsy to determine whether the mass is benign or malignant. However, the disadvantage of B-ultrasound is that it is non-specific, and the diagnostic accuracy is low for those with a diameter of less than 2 cm or atypical. Although CT scan is currently the best method for diagnosing the location, size, range, and nature of ovarian cancer, some tumors still cannot be qualitatively judged. CA-125 blood test is also a commonly used method for ovarian cancer screening and monitoring. Many ovarian cancer patients will have elevated CA-125 levels in the blood, but not every ovarian cancer patient has elevated CA-125 levels in the blood. According to the Ovarian Cancer Research Fund Alliance (OCRFA), about 80% of patients with advanced ovarian cancer have high CA-125 levels, while 50% of patients have high CA-125 levels in the early stages of the disease. In addition, patients with other diseases such as pelvic inflammatory disease and endometriosis may also have elevated levels of CA-125 in the blood. And there are some disadvantages of the CA-125 blood test: 1) Lack of specificity: The specificity of the CA-125 blood test is relatively low, that is, it may produce false positive results in non-cancer situations. Other diseases, such as endometriosis, uterine fibroids, pelvic inflammatory disease, and some benign ovarian tumors may also cause elevated CA-125. 2) Inability to detect early: The CA-125 blood test is not sensitive in detecting early ovarian cancer. In the early stages, ovarian cancer may not cause a significant increase in CA-125 levels, so the test has limited screening capabilities for early ovarian cancer. 3) Not suitable for all people: The CA-125 blood test is mainly suitable for patients who have been diagnosed with ovarian cancer or high-risk people with a family history of ovarian cancer. For low-risk people, such as generally healthy women, the test is not part of routine screening. 4) No definitive diagnostic value: CA-125 blood test cannot be used as the sole basis for diagnosing ovarian cancer, and it needs to be combined with other examinations and evaluation results to make a final diagnosis. It is only used as an auxiliary tool and cannot determine whether one has ovarian cancer alone. Magnetic resonance imaging (MRI) is also a commonly used detection method. It is very advantageous in observing the depth of endometrial lesions invading the myometrium and the boundary between cervical tumors and the bladder or rectum. It plays an important role in the diagnosis and differential diagnosis of pelvic lesions of ovarian cancer. However, the cost of MRI is also higher than that of CT. Patients with intrauterine contraceptive devices must have MRI removed before they can undergo MRI. There are also some disadvantages: 1) High cost: MRI equipment and operating costs are high, which may limit the use of some patients. Not suitable for early diagnosis. 2) Long time: MRI examinations usually take a long time, and one examination may last from 30 minutes to 1 hour.For some patients, the need to remain still in a small space may not be easy. 3) Limitations on specific populations: Because MRI uses a strong magnetic field, it may not be suitable for some patients with metal objects such as pacemakers, artificial joints, and iron vascular clips. Pregnant women should also avoid MRI examinations in early pregnancy. 4) Unable to provide a definite diagnosis: MRI can show ovarian masses and abnormalities, but cannot provide a definite diagnosis. The final diagnosis requires a comprehensive consideration of clinical history, symptoms, other imaging examinations, and possible tissue biopsy results.

[0004] Recent studies have shown that epigenetics plays an important role in the occurrence and development of cancer. As an important mechanism of epigenetics, the regulation of DNA methylation in various cancers has been studied in depth. Research data show that the regulation of gene methylation is related to biological mechanisms such as chromatin structure and gene expression regulation; changes in cellular gene methylation occur in the early stages of tumor formation and throughout the occurrence and development of cancer; methylation of tumor suppressor genes is an important molecular mechanism for the transformation of precancerous lesions into malignant tumor cells. However, there is currently a lack of detection technology, methods and products for methylation gene detection in ovarian cancer. Therefore, there is currently a demand for methylation gene markers with high sensitivity and specificity for ovarian cancer detection. Summary of the invention

[0005] In view of the defects of the above existing detection methods, the purpose of this application is to provide a new biomolecular marker with great diagnostic value for early ovarian cancer, and a corresponding early screening method. The specific technical solution of this application is as follows:

[0006] 1. A composition for in vitro detection of ovarian cancer, comprising:

[0007] Nucleic acid used to detect the methylation status of the target gene,

[0008] Wherein, the methylation state of the target gene is characterized by the methylation of the target sequence of the target gene,

[0009] Wherein, the target gene is one or more of the TFAP2E gene, the WNT10A gene and the IFFO1 gene.

[0010] 2. The composition according to item 1, wherein the target genes are TFAP2E gene, WNT10A gene and IFFO1 gene.

[0011] 3. The composition according to item 1, wherein the target sequence of the TFAP2E gene is as shown in any one of SEQ ID NOs: 1-12 or the target sequence of the TFAP2E gene includes a sequence as shown in any one of SEQ ID NOs: 1-12;

[0012] Preferably, the target sequence of the TFAP2E gene includes a sequence as shown in any one of SEQ ID NOs: 1-4 and any one of SEQ ID NOs: 5-8, or the target sequence of the TFAP2E gene includes a sequence as shown in any one of SEQ ID NOs: 1-4 and any one of SEQ ID NOs: 9-12, or the target sequence of the TFAP2E gene includes a sequence as shown in any one of SEQ ID NOs: 5-8 and any one of SEQ ID NOs: 9-12, or the target sequence of the TFAP2E gene includes a sequence as shown in any one of SEQ ID NOs: 1-4 and any one of SEQ ID NOs: 5-8 and any one of SEQ ID NOs: 9-12.

[0013] 4. The composition according to item 1, wherein the target sequence of the WNT10A gene is as shown in any one of SEQ ID NOs: 13-24 or the target sequence of the WNT10A gene comprises a sequence as shown in any one of SEQ ID NOs: 13-24;

[0014] Preferably, the target sequence of the WNT10A gene includes a sequence as shown in any one of SEQ ID NOs: 13-16 and any one of SEQ ID NOs: 17-20, or the target sequence of the WNT10A gene includes a sequence as shown in any one of SEQ ID NOs: 13-16 and any one of SEQ ID NOs: 21-24, or the target sequence of the WNT10A gene includes a sequence as shown in any one of SEQ ID NOs: 17-20 and any one of SEQ ID NOs: 21-24, or the target sequence of the WNT10A gene includes a sequence as shown in any one of SEQ ID NOs: 13-16 and any one of SEQ ID NOs: 17-20 and any one of SEQ ID NOs: 21-24.

[0015] 5. The composition according to item 1, wherein the target sequence of the IFFO1 gene is as shown in any one of SEQ ID NOs: 25-36 or the target sequence of the IFFO1 gene includes a sequence as shown in any one of SEQ ID NOs: 25-36;

[0016] Preferably, the target sequence of the IFFO1 gene includes a sequence as shown in any one of SEQ ID NOs:25-28 and any one of SEQ ID NOs:29-32, or the target sequence of the IFFO1 gene includes a sequence as shown in any one of SEQ ID NOs:25-28 and any one of SEQ ID NOs:33-36, or the target sequence of the IFFO1 gene includes a sequence as shown in any one of SEQ ID NOs:29-32 and any one of SEQ ID NOs:33-36, or the target sequence of the IFFO1 gene includes a sequence as shown in any one of SEQ ID NOs:25-28 and any one of SEQ ID NOs:29-32 and any one of SEQ ID NOs:33-36.

[0017] 6. The composition according to any one of items 1 to 5, wherein the nucleic acid for detecting the methylation status of the target gene comprises:

[0018] The primer is a fragment of at least 9 nucleotides in the target sequence of the target gene, and the fragment contains at least one CpG dinucleotide sequence.

[0019] 7. The composition according to any one of items 1 to 6, wherein the nucleic acid for detecting the methylation status of the target gene comprises:

[0020] A probe, wherein the probe is a fragment of at least 15 nucleotides that hybridizes to the target sequence of the target gene under moderately stringent or stringent conditions,

[0021] The fragment comprises at least one CpG dinucleotide sequence.

[0022] 8. The composition according to any one of items 1 to 7, further comprising:

[0023] A reagent that converts unmethylated cytosine base at position 5 of the target sequence of the target gene into uracil.

[0024] 9. The composition according to any one of items 1 to 8, wherein the nucleic acid for detecting the methylation status of the target gene further comprises:

[0025] Blockers that preferentially bind to target sequences in their unmethylated state.

[0026] 10. The composition according to item 9, wherein

[0027] The fragment of at least 9 nucleotides is a sequence of SEQ ID NO:37 and SEQ ID NO:38, or a sequence of SEQ ID NO:40 and SEQ ID NO:41, or a sequence of SEQ ID NO:43 and SEQ ID NO:44, or a sequence of SEQ ID NO:46 and SEQ ID NO:47, or a sequence of SEQ ID NO:49 and SEQ ID NO:50, a sequence of SEQ ID NO:52 and SEQ ID NO:53, or a sequence of SEQ ID NO:55 and SEQ ID NO:56, or a sequence of SEQ ID NO:58 and SEQ ID NO:59, or a sequence of SEQ ID NO:61 and SEQ ID NO:62;

[0028] The fragment of at least 15 nucleotides is a sequence of SEQ ID NO:39, or a sequence of SEQ ID NO:42, or a sequence of SEQ ID NO:45, or a sequence of SEQ ID NO:48, or a sequence of SEQ ID NO:51, or a sequence of SEQ ID NO:54, or a sequence of SEQ ID NO:57, or a sequence of SEQ ID NO:60, or a sequence of SEQ ID NO:63.

[0029] 11. An oligonucleotide for in vitro detection of ovarian cancer, comprising:

[0030] A fragment of at least 9 nucleotides of a sequence as shown in any one of SEQ ID NOs: 1-12 or a complementary sequence thereof and comprising at least one CpG dinucleotide sequence; and / or

[0031] A fragment of at least 9 nucleotides of a sequence as shown in any one of SEQ ID NOs: 13-24 or a complementary sequence thereof and comprising at least one CpG dinucleotide sequence; and / or

[0032] A fragment of at least 9 nucleotides of a sequence as shown in any one of SEQ ID NOs: 25-36 or a complementary sequence thereof and comprising at least one CpG dinucleotide sequence.

[0033] 12. The oligonucleotide according to item 11, further comprising:

[0034] A fragment that hybridizes to at least 15 nucleotides of the sequence as shown in any one of SEQ ID NOs: 1-12 or its complementary sequence under moderately stringent or stringent conditions and comprises at least one CpG dinucleotide sequence; and / or

[0035] A fragment that hybridizes to at least 15 nucleotides of the sequence as shown in any one of SEQ ID NOs: 13-24 or its complementary sequence under moderately stringent or stringent conditions and contains at least one CpG dinucleotide sequence; and / or

[0036] A fragment that hybridizes to at least 15 nucleotides of the sequence as shown in any one of SEQ ID NOs: 25-36 or its complementary sequence under moderately stringent or stringent conditions and contains at least one CpG dinucleotide sequence.

[0037] 13. The oligonucleotide according to item 11, further comprising:

[0038] Blockers that preferentially bind to target sequences in their unmethylated state.

[0039] 14. An oligonucleotide for in vitro detection of ovarian cancer, comprising:

[0040] Sequences of SEQ ID NO:37 and SEQ ID NO:38.

[0041] 15. The oligonucleotide according to item 14, further comprising:

[0042] Sequence of SEQ ID NO:39.

[0043] 16. An oligonucleotide for in vitro detection of ovarian cancer, comprising:

[0044] Sequences of SEQ ID NO:40 and SEQ ID NO:41.

[0045] 17. The oligonucleotide according to item 16, further comprising:

[0046] Sequence of SEQ ID NO:42.

[0047] 18. An oligonucleotide for in vitro detection of ovarian cancer, comprising:

[0048] Sequences of SEQ ID NO:43 and SEQ ID NO:44.

[0049] 19. The oligonucleotide according to item 18, further comprising:

[0050] Sequence of SEQ ID NO:45.

[0051] 20. An oligonucleotide for in vitro detection of ovarian cancer, comprising:

[0052] Sequences of SEQ ID NO:46 and SEQ ID NO:47.

[0053] 21. The oligonucleotide according to item 20, further comprising:

[0054] Sequence of SEQ ID NO:48.

[0055] 22. An oligonucleotide for in vitro detection of ovarian cancer, comprising:

[0056] Sequences of SEQ ID NO:49 and SEQ ID NO:50.

[0057] 23. The oligonucleotide according to item 22, further comprising:

[0058] Sequence of SEQ ID NO:51.

[0059] 24. An oligonucleotide for in vitro detection of ovarian cancer, comprising:

[0060] Sequences of SEQ ID NO:52 and SEQ ID NO:53.

[0061] 25. The oligonucleotide according to item 24, further comprising:

[0062] Sequence of SEQ ID NO:54.

[0063] 26. An oligonucleotide for in vitro detection of ovarian cancer, comprising:

[0064] Sequences of SEQ ID NO:55 and SEQ ID NO:56.

[0065] 27. The oligonucleotide according to item 26, further comprising:

[0066] Sequence of SEQ ID NO:57.

[0067] 28. An oligonucleotide for in vitro detection of ovarian cancer, comprising:

[0068] Sequences of SEQ ID NO:58 and SEQ ID NO:59.

[0069] 29. The oligonucleotide according to item 28, further comprising:

[0070] Sequence of SEQ ID NO:60.

[0071] 30. An oligonucleotide for in vitro detection of ovarian cancer, comprising:

[0072] Sequences of SEQ ID NO:61 and SEQ ID NO:62.

[0073] 31. An oligonucleotide according to item 30, further comprising:

[0074] Sequence of SEQ ID NO:63.

[0075] 32. A kit comprising the composition according to any one of items 1 to 10 or the oligonucleotide according to any one of items 11 to 31.

[0076] 33. A kit according to item 32, further comprising at least one other component selected from the group consisting of:

[0077] Nucleoside triphosphates, DNA polymerase and buffer required for the function of the DNA polymerase.

[0078] 34. A kit according to item 32 or 33, wherein the samples used for detection in the kit include: cell lines, histological sections, tissue biopsy / paraffin-embedded tissue, body fluids, feces, colon effluent, urine, plasma, serum, whole blood, separated blood cells, cells separated from blood, or a combination thereof.

[0079] 35. The kit according to any one of items 32 to 34, further comprising: instructions.

[0080] 36. Use of the composition according to any one of Items 1 to 10 or the oligonucleotide according to any one of Items 11 to 31 for preparing a kit for in vitro detection of ovarian cancer.

[0081] 37. The use according to item 36, wherein the kit for detecting ovarian cancer in vitro detects ovarian cancer by a method comprising the following steps:

[0082] 1) separating a DNA sample including a target sequence of a target gene or a fragment thereof from a biological sample to be tested;

[0083] 2) determining the methylation status of the target sequence of the target gene;

[0084] 3) The state of the biological sample is judged by the detection result of the methylation state of the target sequence of the target gene, thereby realizing in vitro detection of ovarian cancer.

[0085] 38. The use according to item 37, wherein the method comprises the steps of:

[0086] Extracting genomic DNA from the biological sample to be tested;

[0087] Treat the extracted genomic DNA with a reagent to convert the unmethylated cytosine base at position 5 into uracil or other bases;

[0088] contacting the DNA sample treated with the reagent with a DNA polymerase and a primer of a target sequence of a target gene to perform a DNA polymerization reaction;

[0089] detecting the amplified product with a probe; and

[0090] Based on the presence or absence of the amplification product, the methylation status of at least one CpG dinucleotide of the target sequence of the target gene is determined.

[0091] 39. The use according to item 38, wherein the reagent is a bisulfite reagent.

[0092] 40. Use of one or more of the TFAP2E gene, the WNT10A gene, and the IFFO1 gene in the preparation of a kit for in vitro detection of ovarian cancer.

[0093] 41. The use according to item 40, wherein the target sequence of the TFAP2E gene is as shown in any one of SEQ ID NOs: 1-12 or the target sequence of the TFAP2E gene comprises a sequence as shown in any one of SEQ ID NOs: 1-12;

[0094] Preferably, the target sequence of the TFAP2E gene includes a sequence as shown in any one of SEQ ID NOs: 1-4 and any one of SEQ ID NOs: 5-8, or the target sequence of the TFAP2E gene includes a sequence as shown in any one of SEQ ID NOs: 1-4 and any one of SEQ ID NOs: 9-12, or the target sequence of the TFAP2E gene includes a sequence as shown in any one of SEQ ID NOs: 5-8 and any one of SEQ ID NOs: 9-12, or the target sequence of the TFAP2E gene includes a sequence as shown in any one of SEQ ID NOs: 1-4 and any one of SEQ ID NOs: 5-8 and any one of SEQ ID NOs: 9-12.

[0095] 42. The use according to item 40, wherein the target sequence of the WNT10A gene is as shown in any one of SEQ ID NOs: 13-24 or the target sequence of the WNT10A gene comprises a sequence as shown in any one of SEQ ID NOs: 13-24;

[0096] Preferably, the target sequence of the WNT10A gene includes a sequence as shown in any one of SEQ ID NOs: 13-16 and any one of SEQ ID NOs: 17-20, or the target sequence of the WNT10A gene includes a sequence as shown in any one of SEQ ID NOs: 13-16 and any one of SEQ ID NOs: 21-24, or the target sequence of the WNT10A gene includes a sequence as shown in any one of SEQ ID NOs: 17-20 and any one of SEQ ID NOs: 21-24, or the target sequence of the WNT10A gene includes a sequence as shown in any one of SEQ ID NOs: 13-16 and any one of SEQ ID NOs: 17-20 and any one of SEQ ID NOs: 21-24.

[0097] 43. The use according to item 40, wherein the target sequence of the IFFO1 gene is as shown in any one of SEQ ID NOs: 25-36 or the target sequence of the IFFO1 gene comprises a sequence as shown in any one of SEQ ID NOs: 25-36;

[0098] Preferably, the target sequence of the IFFO1 gene includes a sequence as shown in any one of SEQ ID NOs:25-28 and any one of SEQ ID NOs:29-32, or the target sequence of the IFFO1 gene includes a sequence as shown in any one of SEQ ID NOs:25-28 and any one of SEQ ID NOs:33-36, or the target sequence of the IFFO1 gene includes a sequence as shown in any one of SEQ ID NOs:29-32 and any one of SEQ ID NOs:33-36, or the target sequence of the IFFO1 gene includes a sequence as shown in any one of SEQ ID NOs:25-28 and any one of SEQ ID NOs:29-32 and any one of SEQ ID NOs:33-36.

[0099] This application has the following beneficial effects:

[0100] The present application screened out genes that can sensitively and specifically detect ovarian cancer-related markers TFAP2E, WNT10A and IFFO1, and determined target sequences where abnormal methylation of related markers occurs, and can sensitively and specifically detect the methylation status of the gene. The composition described in the present application is used for screening of asymptomatic people in a non-invasive manner, has the characteristics of being non-invasive, and can achieve real-time monitoring.

[0101] Therefore, the present application provides a composition, a kit and a detection method that can be used for in vitro detection of ovarian cancer, which can detect ovarian cancer conveniently, quickly and effectively and has important clinical application value. DETAILED DESCRIPTION

[0102] The present application is described in detail below. Although specific embodiments of the present application are shown, it should be understood that the present application can be implemented in various forms and should not be limited by the embodiments described herein. On the contrary, these embodiments are provided to enable a more thorough understanding of the present application and to fully convey the scope of the present application to those skilled in the art.

[0103] Unless otherwise indicated, the implementation of this application will adopt conventional molecular biology (including recombinant technology), microbiology, cell biology, biochemistry and genetics techniques, which are all within the scope of conventional technical means in this area. Such techniques are described in detail in the literature such as Molecular Cloning: A Laboratory Manual, Second Edition (Sambrook et al., 1989); Oligonucleotide Synthesis (MJ Gait, 1984 edition); Animal Cell Culture (RI Freshney, 1987 edition); Methods in Enzymology series (American Academic Press Co., Ltd.); Current Protocols in Molecular Biology (FM Ausubel et al., 1987 edition, and regular updates); PCR: The Polymerase Chain Reaction (Mullis et al., 1994 edition). The primers, probes, blockers and kits used in this application can be prepared using standard techniques known in the art.

[0104] Unless otherwise defined, technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs.

[0105] definition

[0106] The term "precancerous cell" as used herein refers to a cell that is in the early stages of transformation into a cancer cell or that is prone to transformation into a cancer cell. Such a cell may exhibit one or more phenotypic traits characteristic of a cancer cell.

[0107] "Stringent hybridization conditions" and "high stringency" in this application refer to the conditions under which a probe hybridizes to its target sequence, typically in a complex mixture of nucleic acids. Stringent conditions are sequence-dependent and are different in different environments. Longer sequences hybridize specifically at higher temperatures. For detailed guidance on nucleic acid hybridization, refer to Tijssen, Biochemistry and Molecular Biology Techniques - Nucleic Acid Probe Hybridization, "A Review of Hybridization Principles and Nucleic Acid Assay Strategies". Generally, stringent conditions are about 5-10°C below the melting point (Tm) of the specific nucleic acid at a defined ionic strength pH. At the temperature of Tm (at a defined ionic strength, pH and nucleic acid concentration), 50% of the probes complementary to the target hybridize to the target sequence in a balanced manner. Stringent conditions can also be achieved by adding destabilizers. For selective or specific hybridization, the positive signal is twice the background hybridization, preferably 10 times. Exemplary stringent hybridization conditions are as follows: hybridization in a solution of 50% formamide, 5x SSC and 1% SDS at 42°C, or hybridization in a solution of 5x SSC and 1% SDS at 65°C, followed by washing in a solution of 0.2x SSC and 0.1% SDS at 65°C.

[0108] Furthermore, nucleic acids that do not hybridize under stringent conditions are still substantially similar if the polypeptides encoded by the nucleic acids are substantially similar. In this case, the nucleic acids are typically hybridized under moderately stringent hybridization conditions. As an example, "moderately stringent hybridization conditions" include hybridization in a solution of 40% formamide, 1M sodium chloride and 1% SDS at 37°C, and washing in a solution of 1xSSC at 45°C. Guidance for achieving conditions that achieve the same stringency is readily apparent to one of ordinary skill in the art. For PCR, a temperature of around 36°C is typically suitable for low stringency amplification, while the annealing temperature ranges from 32°C to 48°C based on the length of the primers. For highly stringent PCR amplification, it is generally at 62°C, while the annealing temperature for highly stringent hybridization ranges from 50°C to 65°C based on the length and specificity of the primers. Cycling conditions for high stringency and low stringency amplifications typically include a denaturation phase at 90-95° C. for 30 seconds to 2 minutes, an annealing phase for 30 seconds to 2 minutes, and an extension phase for 1 to 2 minutes at about 72° C. Tools and guidance for low and high stringency amplification reactions are available in the art.

[0109] " oligonucleotide " in the present application refers to the molecule consisting of two or more nucleotides, preferably the molecule consisting of more than three nucleotides, and its accurate size can rely on many factors, and these factors in turn are determined by the final function and purpose of the oligonucleotide. In some embodiments, oligonucleotide can include a length of 10 nucleotides to 100 nucleotides. In some embodiments, oligonucleotide can include a length of 10 nucleotides to 30 nucleotides, or can have a length of 20 and 25 nucleotides. In some specific embodiments, oligonucleotides shorter than these lengths are also suitable.

[0110] The application's "primer" means an oligonucleotide that can be used as a starting point for synthesis when placed under conditions that induce the synthesis of a primer extension product complementary to a nucleic acid chain, i.e., in the presence of nucleotides and an inducer such as a DNA or RNA polymerase and at a suitable temperature and pH, whether it is naturally occurring or synthetically produced in a purified restriction digest. Primers can be single-stranded or double-stranded, and must be long enough to induce the synthesis of a desired extension product in the presence of an inducer. The exact length of a primer depends on a variety of factors, including temperature, primer source, and the method used. For example, for diagnostic and prognostic applications, an oligonucleotide primer typically contains at least or more than about 9, 10, or 15, or 20, or 25 or more nucleotides, but it can contain fewer nucleotides or more nucleotides. Factors involved in determining the appropriate length of a primer are well known to those skilled in the art.

[0111] The "primer pair" of the present application refers to a primer pair that hybridizes to opposite strands of a target DNA molecule or to a target DNA region flanking a nucleotide sequence to be amplified.

[0112] As used herein, a "primer site" refers to a region of a target DNA or other nucleic acid to which a primer hybridizes.

[0113] The "probe" of the present application, when referring to a nucleic acid sequence, is used in its usual sense to refer to a selected nucleic acid sequence that can hybridize with a target sequence under specified conditions and can be used to detect the presence of the target sequence. The probe is a single-stranded or double-stranded DNA with a length ranging from tens to hundreds or even thousands of base pairs, which can utilize the high accuracy of molecular denaturation, renaturation and complementary base pairing to hydrogen bond (hybridize) with complementary non-labeled single-stranded DNA or RNA in the sample to be tested to form a double-stranded complex (hybrid). It should be understood by those skilled in the art that in some cases, the probe can also be used as a primer, and the primer can be used as a probe.

[0114] "DNA methylation" of the present application refers to the addition of a methyl group to the 5th position of cytosine (C), which is usually (but not necessarily) in the case of a CpG (guanine after cytosine) dinucleotide. As a relatively stable modification state, under the action of DNA methyltransferase, it can be inherited to the newborn daughter DNA along with the replication process of DNA, which is an important epigenetic mechanism. During DNA methylation, methylation of the gene promoter region can lead to transcriptional silencing of tumor suppressor genes, so it is closely related to the occurrence of tumors. Abnormal methylation includes hypermethylation of tumor suppressor genes and DNA repair genes, hypomethylation of repetitive sequence DNA, and loss of imprinting of certain genes, which are related to the occurrence of various tumors. As used herein, "increased methylation level" or "significant methylation level" refers to the presence of at least one methylated cytosine nucleotide in a DNA sequence, wherein the corresponding C in a normal control sample (e.g., a DNA sample extracted from a non-cancerous cell or tissue sample or a DNA sample treated for methylation of DNA residues) is unmethylated, and in certain embodiments, at least 2, 3, 4, 5, 6, 7, 8, 9, 10 or more Cs may be methylated, wherein the Cs at these positions in the control DNA sample are unmethylated.

[0115] In embodiments, a variety of different methods can be used to detect DNA methylation changes. The method for detecting DNA methylation includes, for example, utilizing southern or polymerase chain reaction (PCR) analysis of methylation-sensitive restriction endonuclease (MSRE) assay, methylation-specific or methylation-sensitive PCR (MS-PCR), methylation-sensitive single nucleotide primer extension (Ms-SnuPE), high resolution melting (HRM) analysis, bisulfite sequencing, pyrophosphate sequencing, methylation-specific single-stranded conformation analysis (MS-SSCA), combined bisulfite restriction analysis (COBRA), methylation-specific denaturing gradient gel electrophoresis (MS-DGGE), methylation-specific melting curve analysis (MS-MCA), methylation-specific denaturing high performance liquid chromatography (MS-DHPLC), methylation-specific microarray (MSO). These determinations can be PCR analysis, quantitative analysis using fluorescent labels or southern imprint analysis.

[0116] A "methylation assay" as used herein refers to any assay that determines the methylation status of one or more CpG dinucleotide sequences within a DNA sequence.

[0117] "Detection" as used herein refers to any process of observing a marker or marker change in a biological sample (e.g., a change in the methylation state of a marker or the expression level of a nucleic acid or protein sequence), regardless of whether the marker or marker change is actually detected. In other words, the act of detecting a marker or marker change in a sample is "detection", even if the marker is determined to be absent or below a sensitivity level. Detection can be a quantitative, semi-quantitative, or non-quantitative observation, and can be based on comparison with one or more control samples. It should be understood that detecting ovarian cancer disclosed herein includes detecting precancerous cells that begin to develop into ovarian cancer cells or are about to develop into ovarian cancer cells, or have an increased tendency to develop into ovarian cancer cells. Detecting ovarian cancer can also include detecting a possible probability of death or a possible prognosis of a disease condition.

[0118] "Homology", "identity" and "similarity" of the present application refer to the sequence similarity between two nucleic acid molecules. "Homology", "identity" or "similarity" can be determined by comparing the positions in each sequence, and the sequences can be aligned for the purpose of comparison. When equivalent positions in the compared sequences are occupied by the same base, the molecules are identical at that position; when equivalent sites are occupied by the same or similar amino acid (for example, similar in spatial properties or charged properties) residues, the molecules can be said to be homologous (similar) at that position. The expression of homology / similarity or identity percentage refers to the function of the number of identical or similar amino acids at the positions shared by the compared sequences. "Unrelated" or "non-homologous" sequences share less than 40% identity, preferably less than 25% identity with the sequences of the present application. When comparing two sequences, the absence of residues (amino acids or nucleic acids) or the presence of extra residues also reduces identity and homology / similarity. In a specific embodiment, two or more sequences or subsequences are considered to be substantially or significantly homologous, similar or identical if their sequences are about 60%, or about 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more identical over a specified region, as determined using the BLAST or BLAST 2.0 sequence comparison algorithm with the default parameters described below or by manual alignment and visual inspection provided online by, for example, the National Center for Biotechnology Information (NCBI). This definition also relates to or can be used to test the complement of a sequence. Thus, to the extent permitted by the context of the present invention, for example, if the nucleotide sequence can be predicted to occur naturally in a DNA duplex, or can occur naturally in the form of one or both of the complementary strands, then the nucleotide sequence that is complementary to a specified target sequence or a variant thereof is itself considered to be "similar" to the target sequence, and when referring to "similar" nucleic acid sequences, single-stranded sequences, their complementary sequences, double-stranded strand complexes, sequences that can encode the same or similar polypeptide products, and any allowed variants of any of the above. Circumstances in which similarity must be limited to the analysis of a single nucleic acid strand sequence can include, for example, the detection and quantification of the expression of a specific RNA sequence or coding sequence in a cell. This definition also includes sequences with deletions and / or additions, as well as sequences with substitutions.In embodiments, the identity or similarity can be over a region that is at least about 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 10, 21, 22, 23, 24, 25, or more nucleotides in length, or over a region that is more than about 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or more than about 100 nucleotides in length.

[0119] "Amplification" herein refers to the process of obtaining multiple copies of a specific locus of a nucleic acid, such as genomic DNA or cDNA. Amplification can be achieved using any of a variety of known means, including but not limited to polymerase chain reaction (PCR), transcription-based amplification, and strand displacement amplification (SDA).

[0120] The "fluorescence-based real-time PCR" of this application refers to a method in which a fluorescent group is added to the PCR reaction system, the entire PCR process is monitored in real time using the accumulation of fluorescent signals, and finally the unknown template is quantitatively analyzed using a standard curve. In this PCR technology, there is a very important concept, the cycle threshold, also known as the Ct value. C stands for Cycle, t stands for threshold, and the meaning of the Ct value is: the number of cycles experienced when the fluorescent signal in each reaction tube reaches the set threshold. For example, the method for setting the fluorescence threshold is as follows: the fluorescent signal of the first 15 cycles of the PCR reaction is used as the fluorescent background signal, and the default (default) setting of the fluorescence threshold is 10 times the standard deviation of the fluorescent signal of 3-15 cycles.

[0121] The "cut off value of real-time PCR" in this application refers to a critical Ct value for judging the positive or negative of a sample for a certain biomarker. According to certain specific real-time methods of this application, "the critical Ct value (Cut Off value) is obtained based on a certain amount of sample data and statistical processing", and the critical Ct value may vary according to the required sensitivity or specificity requirements.

[0122] The "sensitivity" in this application refers to the proportion of cancer detected from a certain cancer sample, and its calculation formula is: Sensitivity = (detected cancer / all cancers), while "specificity" refers to the proportion of normal detected in a certain normal human sample, and its calculation formula is: Specificity = (detected negative / total negative).

[0123] The "label" or "detectable part" of the present application is a component that can be detected by spectroscopic, photochemical, biochemical, immunochemical, chemical or other physical means. For example, useful labels include 32P, fluorescent dyes, electron-dense reagents, enzymes (e.g., enzymes commonly used in ELISA), biotin, digoxigenin or haptens and proteins that can be prepared to be detectable, for example, by incorporating a radioactive label into a peptide or for detecting antibodies that specifically react with a peptide.

[0124] Nucleic acid molecules can be detected using a variety of different methods. Nucleic acid detection methods include, for example, PCR and nucleic acid hybridization (e.g., Southern blot, Northern blot or in situ hybridization). Specifically, oligonucleotides (e.g., oligonucleotide primers) capable of amplifying target nucleic acids can be used for PCR reactions. PCR methods generally include the following steps: obtaining a sample, separating nucleic acids (e.g., DNA, RNA or both) from the sample, and contacting the nucleic acid with one or more oligonucleotide primers, which specifically hybridize with the template nucleic acid under conditions that enable template nucleic acid amplification to occur. In the presence of template nucleic acid, an amplification product is produced. The conditions for nucleic acid amplification and amplification product detection are known to those skilled in the art. A variety of improvements to basic PCR techniques have been developed, including, but not limited to, anchored PCR, RACE PCR, RT-PCR and ligase chain reaction (LCR). The primer pairs in the amplification reaction must anneal to the relative strands of the template nucleic acid, and should be kept at a suitable distance from each other so that the polymerase can effectively polymerize across the region and make it possible to easily detect the amplification product, for example, using electrophoresis. For example, a computer program such as OLIGO (Molecular Biology Insights Inc., Cascade, Colo.) can be used to design oligonucleotide primers to assist in designing primers with similar melting temperatures. Typically, oligonucleotide primers are 9-30 or 40 or 50 nucleotides in length (e.g., 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 nucleotides in length), but oligonucleotide primers can be longer or shorter, as long as appropriate amplification conditions are used.

[0125] Detection of the amplification product or hybridization complex is usually achieved using a detectable label. The term "label", when referring to nucleic acids, is intended to include direct labeling of nucleic acids by coupling (i.e., physically linking) a detectable substance to the nucleic acid, and indirect labeling of nucleic acids by reacting with another reagent directly labeled with a detectable substance. Detectable substances include various enzymes, prosthetic groups, fluorescent materials, luminescent materials, bioluminescent materials, and radioactive materials. Examples of suitable enzymes include horseradish peroxidase, alkaline phosphatase, β-galactosidase, or acetylcholinesterase; examples of suitable prosthetic group complexes include avidin streptavidin / biotin and avidin / biotin; examples of suitable fluorescent materials include umbelliferone, fluorescein, fluorescein isothiocyanate, rhodamine, dichlorotriazinylamine fluorescein, dansyl chloride, or phycoerythrin; examples of luminescent materials include luminol; examples of bioluminescent materials include luciferase, luciferin, and aequorin. Examples of indirect labeling include end-labeling of a nucleic acid with biotin, such that the nucleic acid can be detected using fluorescently labeled streptavidin.

[0126] Overview

[0127] On the one hand, the present application provides a composition for in vitro detection of ovarian cancer, the composition comprising a nucleic acid for detecting the methylation state within a target sequence of a target gene, wherein the methylation state of the target gene is characterized by the methylation of the target sequence of the target gene, wherein the target gene is one or more of the TFAP2E gene, the WNT10A gene, and the IFFO1 gene.

[0128] The present application provides a group of target sequences of target genes that are abnormally methylated in ovarian cancer, including target sequences of one or more genes among TFAP2E gene, WNT10A gene, and IFFO1 gene. The target sequence of TFAP2E gene is as shown in any one of SEQ ID NOs: 1-12 or includes a sequence as shown in any one of SEQ ID NOs: 1-12, the target sequence of WNT10A gene is as shown in any one of SEQ ID NOs: 13-24 or includes a sequence as shown in any one of SEQ ID NOs: 13-24, and the target sequence of IFFO1 gene is as shown in any one of SEQ ID NOs: 25-36 or includes a sequence as shown in any one of SEQ ID NOs: 25-36.

[0129] In some specific embodiments, the target sequence of the TFAP2E gene is as shown in any one of SEQ ID NOs: 1-4 or includes a sequence as shown in any one of SEQ ID NOs: 1-4; the target sequence of the WNT10A gene is as shown in any one of SEQ ID NOs: 13-16 or includes a sequence as shown in any one of SEQ ID NOs: 13-16; the target sequence of the IFFO1 gene is as shown in any one of SEQ ID NOs: 25-28 or includes a sequence as shown in any one of SEQ ID NOs: 25-28.

[0130] In a specific embodiment, the target sequence of the TFAP2E gene is shown in SEQ ID NO: 1 (TFAP2E-1).

[0131] In a specific embodiment, the target sequence of the TFAP2E gene is shown in SEQ ID NO: 5 (TFAP2E-2).

[0132] In a specific embodiment, the target sequence of the TFAP2E gene is shown in SEQ ID NO: 9 (TFAP2E-3).

[0133] In a specific embodiment, the target sequence of the WNT10A gene is shown in SEQ ID NO: 13 (WNT10A-1).

[0134] In a specific embodiment, the target sequence of the WNT10A gene is shown in SEQ ID NO: 17 (WNT10A-2).

[0135] In a specific embodiment, the target sequence of the WNT10A gene is shown in SEQ ID NO: 21 (WNT10A-3).

[0136] In a specific embodiment, the target sequence of the IFFO1 gene is shown in SEQ ID NO:25 (IFFO1-1).

[0137] In a specific embodiment, the target sequence of the IFFO1 gene is shown in SEQ ID NO: 29 (IFFO1-2).

[0138] In a specific embodiment, the target sequence of the IFFO1 gene is shown in SEQ ID NO:33 (IFFO1-3).

[0139] Those skilled in the art can also understand that the target sequences of the TFAP2E gene, WNT10A gene, and IFFO1 gene are not limited to the specific sequences listed above. The target sequence of the TFAP2E gene should include a sequence that contains one or two or three or more nucleotide mutations compared to the sequence shown in any one of SEQ ID NOs: 1-12, but is still substantially functionally the same as the sequence shown in any one of SEQ ID NOs: 1-12, and also includes a sequence that has 95%, 96%, 97%, 98% or 99% sequence identity compared to the sequence shown in any one of SEQ ID NOs: 1-12, and also includes a sequence that deletes one or more nucleotides, adds one or more nucleotides, or replaces one or more nucleotides based on the nucleotide sequence shown in any one of SEQ ID NOs: 1-12 but has 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity with the nucleotide sequence shown in any one of SEQ ID NOs: 1-12. The target sequence of the WNT10A gene should include a sequence comprising one, two or three or more nucleotide mutations compared to the sequence shown in any one of SEQ ID NOs: 13-24, but having substantially the same essential function as the sequence, and also includes a sequence having 95%, 96%, 97%, 98% or 99% sequence identity compared to the sequence shown in any one of SEQ ID NOs: 13-24, and also includes a sequence having 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity to the nucleotide sequence shown in any one of SEQ ID NOs: 13-24 by deleting one or more nucleotides, adding one or more nucleotides, or replacing one or more nucleotides. The target sequence of the IFFO1 gene should cover a sequence that contains one, two or three or more nucleotide mutations compared to the sequence shown in any one of SEQ ID NOs: 25-36, but is still substantially functionally identical to the sequence, and also includes a sequence with 95%, 96%, 97%, 98% or 99% sequence identity compared to the sequence shown in any one of SEQ ID NOs: 25-36, and also includes a sequence that deletes one or more nucleotides, adds one or more nucleotides, or replaces one or more nucleotides on the basis of the nucleotide sequence shown in any one of SEQ ID NOs: 25-36 but has 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity with the nucleotide sequence shown in any one of SEQ ID NOs: 25-36.

[0140] The target sequence (5'-3') of the TFAP2E gene (TFAP2E-1) is as follows:

[0141] CCAGCCCAGTGGGGAGTGAATTAGCGCCCTCCTTCGTCCTCGGCCCTTCCGACGGCACGAGGAACTCCTGTC CTGCCCCACAGACCTTCGGCCT (SEQ ID NO: 1)

[0142] The complementary sequence (5'-3') of the target sequence of the TFAP2E gene (TFAP2E-1) is as follows:

[0143] AGGCCGAAGGTCTGTGGGGCAGGACAGGAGTTCCTCGTGCCGTCGGAAGGGCCGAGGACGAAGGAGGGCG CTAATTCACTCCCCACTGGGCTGG(SEQ ID NO:2)

[0144] The target sequence of the TFAP2E gene (TFAP2E-1) after bisulfite treatment (5'-3') is as follows:

[0145] TTAGTTTAGTGGGGAGTGAATTAGCGTTTTTTTTCGTTTCGGTTTTTCGACGGTACGAGGAATTTTTGTTTT GTTTTATAGATTTTCGGTTT (SEQ ID NO: 3)

[0146] The complementary sequence of the target sequence of the TFAP2E gene (TFAP2E-1) after bisulfite treatment (5'-3') is as follows:

[0147] AGGTCGAAGGTTTGTGGGGTAGGATAGGAGTTTTTCGTGTCGTCGGAAGGGTCGAGGACGAAGGAGGGCGT TAATTTATTTTTTATTGGGTTGG(SEQ ID NO:4)

[0148] The target sequence (5'-3') of the TFAP2E gene (TFAP2E-2) is as follows:

[0149] CCTTGGCCCTCCGCGGTCACTGCGGGATTCGGCGTTTGCCGCCAGCCCAGTGGGGAGTGAATTAGCGCCCTCC TTCGTCCTCGGCCCTTCC (SEQ ID NO: 5)

[0150] The complementary sequence (5'-3') of the target sequence of the TFAP2E gene (TFAP2E-2) is as follows:

[0151] GGAAGGGCCGAGGACGAAGGAGGGCGCTAATTCACTCCCCACTGGGCTGGCGGCAACGCCGAATCCCGCA GTGACCGCGGAGGGCCAAGG(SEQ ID NO:6)

[0152] The target sequence of the TFAP2E gene (TFAP2E-2) after bisulfite treatment (5'-3') is as follows:

[0153] TTTTGGTTTTTCGCGGTTATTGCGGGATTCGGCGTTGTCGTTAGTTTAGTGGGGAGTGAATTAGCGTTTTTT TCGTTTTCGGTTTTTTT (SEQ ID NO:7)

[0154] The complementary sequence of the target sequence of the TFAP2E gene (TFAP2E-2) after bisulfite treatment (5'-3') is as follows:

[0155] GGAAGGGTCGAGGACGAAGGAGGGCGTTAATTTATTTTTTATTGGGTTGGCGGTAACGTCGAATTTCGTAG TGATCGCGGAGGGTTAAGG(SEQ ID NO:8)

[0156] The target sequence (5'-3') of the TFAP2E gene (TFAP2E-3) is as follows:

[0157] TCACTGCGGGATTCGGCGTTTGCCGCCAGCCCAGTGGGGAGTGAATTAGCGCCCTCCTTCGTCCTCGGCCCTT CCGACGGCACGAGGAACTCCTGTCCTGCC (SEQ ID NO: 9)

[0158] The complementary sequence (5'-3') of the target sequence of the TFAP2E gene (TFAP2E-3) is as follows:

[0159] GGCAGGACAGGAGTTCCTCGTGCCGTCGGAAGGGCCGAGGACGAAGGAGGGCGCTAATTCACTCCCCACT GGGCTGGCGGCAACGCCGAATCCCGCAGTGA (SEQ ID NO: 10)

[0160] The target sequence of the TFAP2E gene (TFAP2E-3) after bisulfite treatment (5'-3') is as follows:

[0161] TTATTGCGGGATTCGGCGTTGTCGTTAGTTTAGTGGGGAGTGAATTAGCGTTTTTTTTCGTTTTCGGTTTTTTC GACGGTACGAGGAATTTTTGTTTTGTT (SEQ ID NO: 11)

[0162] The complementary sequence of the target sequence of the TFAP2E gene (TFAP2E-3) after bisulfite treatment (5'-3') is as follows:

[0163] GGTAGGATAGGAGTTTTTCGTTGTCGTCGGAAGGGTCGAGGACGAAGGAGGGCGTTAATTTATTTTTTATTGG GTTGGCGGTAACGTCGAATTTCGTAGTGA (SEQ ID NO: 12)

[0164] The target sequence (5'-3') of the WNT10A gene (WNT10A-1) is as follows:

[0165] CTATGGGCGAGCTGCTGCAGTGCGGCTGCCAGGCGCCCCGCGGGCGGGCCCCTCCCCGGCCCTCCGGCCTG CCCGGCACC (SEQ ID NO: 13)

[0166] The complementary sequence (5'-3') of the target sequence of the WNT10A gene (WNT10A-1) is as follows:

[0167] GGTGCCGGGCAGGCCGGAGGGCCGGGGAGGGGCCCGCCCGCGGGGCGCCTGGCAGCCGCACTGCAGCAGCTCGCCCATAG(SEQ ID NO:14)

[0168] The target sequence of the WNT10A gene (WNT10A-1) after bisulfite treatment (5'-3') is as follows:

[0169] TTATGGGCGAGTTGTTGTAGTGCGGTTGTTAGGCGTTTCGCGGGCGGGTTTTTTTTCGGTTTTTCGGTTTGTT CGGTATT(SEQ ID NO:15)

[0170] The complementary sequence of the target sequence of the WNT10A gene (WNT10A-1) after bisulfite treatment (5'-3') is as follows:

[0171] GGTGTCGGGTAGGTCGGAGGGTCGGGGAGGGGTTCGTTCGCGGGGCGTTTGGTAGTCGTATTGTAGTAGTT CGTTTATAG(SEQ ID NO:16)

[0172] The target sequence (5'-3') of the WNT10A gene (WNT10A-2) is as follows:

[0173] GCTGCAGTGCGGCTGCCAGGCGCCCCGCGGGCGGGCCCCTCCCCGGCCCTCCGGCCTGCCCGGCACCCCCG GACCCCCTGGC (SEQ ID NO: 17)

[0174] The complementary sequence (5'-3') of the target sequence of the WNT10A gene (WNT10A-2) is as follows:

[0175] GCCAGGGGGTCCGGGGGTGCCGGGCAGGCCGGAGGGCCGGGGAGGGGCCCGCCCGCGGGGCGCCTGGCAG CCGCACTGCAGC (SEQ ID NO: 18)

[0176] The target sequence of the WNT10A gene (WNT10A-2) after bisulfite treatment (5'-3') is as follows:

[0177] GTTGTAGTGCGGTTGTTAGGCGTTTCGCGGGCGGGTTTTTTTTCGGTTTTTCGGTTTGTTCGGTATTTTCGGA TTTTTTGGT (SEQ ID NO: 19)

[0178] The complementary sequence of the target sequence of the WNT10A gene (WNT10A-2) after bisulfite treatment (5'-3') is as follows:

[0179] GTTAGGGGGTTCGGGGGTGTCGGGTAGGTCGGAGGGTCGGGGAGGGGTTCGTTCGCGGGGGCGTTTGGTAGT CGTATTGTAGT(SEQ ID NO:20)

[0180] The target sequence (5'-3') of the WNT10A gene (WNT10A-3) is as follows:

[0181] TCACGCAGGCCTGTTCTATGGGCGAGCTGCTGCAGTGCGGCTGCCAGGCGCCCCGCGGGCGGGCCCCTCCC CGGCCCTCC (SEQ ID NO: 21)

[0182] The complementary sequence (5'-3') of the target sequence of the WNT10A gene (WNT10A-3) is as follows:

[0183] GGAGGGCCGGGGAGGGGCCCGCCCGCGGGGCGCCTGGCAGCCGCACTGCAGCAGCTCGCCCATAGAACAG GCCTGCGTGA (SEQ ID NO: 22)

[0184] The target sequence of the WNT10A gene (WNT10A-3) after bisulfite treatment (5'-3') is as follows:

[0185] TTACGTAGGTTTGTTTTATGGGCGAGTTGTTGTAGTGCGGTTGTTAGGCGTTTCGCGGGCGGGTTTTTTTTCG GTTTTTT (SEQ ID NO: 23)

[0186] The complementary sequence of the target sequence of the WNT10A gene (WNT10A-3) after bisulfite treatment (5'-3') is as follows:

[0187] GGAGGGTCGGGGAGGGGTTCGTTCGCGGGGCGTTTGGTAGTCGTATTGTAGTAGTTCGTTTATAGAATAGG TTTGCGTGA (SEQ ID NO: 24)

[0188] The target sequence (5'-3') of the first fragment of the IFFO1 gene (IFFO1-1) is as follows:

[0189] CCCAGCTGCAGCCCCAGGGGCCGGATGGGGCTGACGAAGCCGGTCTGCACTGCCTGGTCGCGACGACCCAG GCCCCGCCG(SEQ ID NO:25)

[0190] The complementary sequence (5'-3') of the target sequence of the first fragment (IFFO1-1) of the IFFO1 gene is as follows:

[0191] CGGCGGGGCCTGGGTCGTCGCGACCAGGCAGTGCAGACCGGCTTCGTCAGCCCCATCCGGCCCCTGGGGCT GCAGCTGGG (SEQ ID NO: 26)

[0192] The target sequence of the IFFO1 gene (IFFO1-1) after bisulfite treatment (5'-3') is as follows:

[0193] TTTAGTTGTAGTTTTAGGGGTCGGATGGGGTTGACGAAGTCGGTTTGTATTGTTTGGTCGCGACGATTTAGG TTTCGTCG(SEQ ID NO:27)

[0194] The complementary sequence of the target sequence of the IFFO1 gene (IFFO1-1) after bisulfite treatment (5'-3') is as follows:

[0195] CGGCGGGGTTTGGGTCGTCGCGATTAGGTAGTGTAGATCGGTTTCGTTAGTTTTATTCGGTTTTTGGGGTTGT AGTTGGG (SEQ ID NO: 28)

[0196] The target sequence (5'-3') of the IFFO1 gene (IFFO1-2) is as follows

[0197] AGGGGCCGGATGGGGCTGACGAAGCCGGTCTGCACTGCCTGGTCGCGACGACCCAGGCCCCGCCGGCCCTG CTTACCCTCCTCCAG (SEQ ID NO: 29)

[0198] The complementary sequence (5'-3') of the target sequence of the IFFO1 gene (IFFO1-2) is as follows:

[0199] CTGGAGGAGGGTAAGCAGGGCCGGCGGGGCCTGGGTCGTCGCGACCAGGCAGTGCAGACCGGCTTCGTCA GCCCCATCCGGCCCCT (SEQ ID NO: 30)

[0200] The target sequence of the IFFO1 gene (IFFO1-2) after bisulfite treatment (5'-3') is as follows:

[0201] AGGGGTCGGATGGGGTTGACGAAGTCGGTTTGTATTGTTTGGTCGCGACGATTTAGGTTTCGTCGGTTTTGTTTATTTTTTTTTAG(SEQ ID NO:31)

[0202] The complementary sequence of the target sequence of the IFFO1 gene (IFFO1-2) after bisulfite treatment (5'-3') is as follows:

[0203] TTGGAGGAGGGTAAGTAGGGTCGGCGGGGTTTGGGTCGTCGCGATTAGGTAGTGTAGATCGGTTTCGTTTAG TTTTATTCGGTTTTT (SEQ ID NO: 32)

[0204] The target sequence (5'-3') of the IFFO1 gene (IFFO1-3) is as follows

[0205] ACGAAGCCGGTCTGCACTGCCTGGTCGCGACGACCCAGGCCCCGCCGGCCCTGCTTACCCTCCTCCAGCGCT TGCTGCAGTTGC (SEQ ID NO: 33)

[0206] The complementary sequence (5'-3') of the target sequence of the IFFO1 gene (IFFO1-3) is as follows:

[0207] GCAACTGCAGCAAGCGCTGGAGGAGGGTAAGCAGGGCCGGCGGGGCCTGGGTCGTCGCGACCAGGCAGTG CAGACCGGCTTCGT(SEQ ID NO:34)

[0208] The target sequence of the IFFO1 gene (IFFO1-3) after bisulfite treatment (5'-3') is as follows:

[0209] ACGAAGTCGGTTTTGTATTGTTTGGTCGCGACGATTTAGGTTTCGTCGGTTTTGTTTATTTTTTTTTAGCGTTTG TTGTAGTTGT(SEQ ID NO:35)

[0210] The complementary sequence of the target sequence of the IFFO1 gene (IFFO1-3) after bisulfite treatment (5'-3') is as follows:

[0211] GTAATTGTAGTAAGCGTTGGAGGAGGGTAAGTAGGGTCGGCGGGGTTTGGGTCGTCGCGATTAGGTAGTGT AGATCGGTTTCGT(SEQ ID NO:36)

[0212] The target sequences and related sequences of TFAP2E gene, WNT10A gene and IFFO1 gene are shown in Table 1:

[0213] Table 1 Target sequences and related sequences of each gene

[0214]

[0215]

[0216] Preferably, the nucleic acid used to detect the methylation state of the target gene includes a fragment of at least 9 nucleotides in the target sequence of the target gene, wherein the fragment contains at least one CpG dinucleotide sequence. In certain preferred embodiments, if the sample DNA to be tested is converted using bisulfite, the nucleic acid used to detect the methylation state of the target gene includes a fragment of at least 9 nucleotides in the sequence after bisulfite conversion of the target sequence of the target gene, preferably a fragment of at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22 or more nucleotides, wherein the fragment of the nucleotide contains at least one CpG dinucleotide sequence.

[0217] More preferably, the nucleic acid used to detect the methylation status of the target gene includes a fragment of at least 15 nucleotides in the target sequence of the target gene that hybridizes under moderate stringency or stringent conditions, wherein the fragment of the nucleotide contains at least one CpG dinucleotide sequence. In certain preferred embodiments, if the test sample DNA is converted using bisulfite, the nucleic acid used to detect the methylation status of the target gene includes a fragment of at least 15 nucleotides in the sequence after bisulfite conversion, preferably at least 16, 17, 18, 19, 20, 21, 22 or more nucleotides, hybridized to the target sequence of the target gene under moderate stringency or stringent conditions, wherein the fragment of the nucleotide contains at least one CpG dinucleotide sequence.

[0218] Preferably, the composition further comprises a reagent for converting the unmethylated cytosine base at position 5 of the target sequence of the target gene into uracil. More preferably, the reagent is bisulfite.

[0219] The nucleic acid used to detect the methylation status of the target gene may also include a blocker that preferentially binds to DNA in an unmethylated state.

[0220] Preferably, the composition comprises one or more of the primers and probes shown in Table 2:

[0221] Table 2 Primer and probe sequences used in this application

[0222]

[0223]

[0224] Note: "F" in Table 2 represents forward primer; "R" represents reverse primer; "P" represents probe.

[0225] Preferably, the fluorescent labeling method of the probe sequence used in the present application is as shown in Table 3.

[0226] Table 3 A fluorescent labeling method for the probe sequences used in this application

[0227] Sequence number sequence name 5' labeling 3' labeling SEQ ID NO:39 TFAP2E_1P 5'FAM 3'BHQ3 SEQ ID NO:51 WNT10A_2P 5'VIC 3'BHQ3 SEQ ID NO:57 IFFO1_1P 5'CY51 3'BHQ3

[0228] In certain embodiments, the composition further comprises an agent for converting the unmethylated cytosine base at position 5 of the gene into uracil. Preferably, the agent is bisulfite. Bisulfite modification of DNA is a known tool for assessing the methylation status of CpGs. In the DNA of eukaryotic cells, 5-methylcytosine is the most common covalent base modification. 5-methylcytosine cannot be identified by sequencing because 5-methylcytosine has the same base pairing behavior as cytosine. In addition, during PCR amplification, the epigenetic information carried by 5-methylcytosine is completely lost. The method most commonly used to analyze the presence of 5-methylcytosine in DNA is based on the specific reaction of bisulfite with cytosine; after subsequent alkaline hydrolysis, unmethylated cytosine is converted into uracil, which corresponds to thymine in pairing behavior; but under these conditions, 5-methylcytosine remains unmodified. Thus the original DNA is transformed in this way, so that the 5-methylcytosine, which was originally indistinguishable from cytosine in its hybridization behavior, can now be detected as the only remaining cytosine by conventional known molecular biology techniques, such as by amplification and hybridization. All these techniques are based on different base pairing characteristics and can now be fully utilized. Therefore, typically, the application provides the combined use of bisulfite technology and one or more methylation assays to determine the methylation state of the CpG dinucleotide sequence in the target sequence of the target gene. In addition, the method of the application is suitable for analyzing heterogeneous biological samples, such as low-concentration tumor cells in blood or feces. Therefore, when analyzing the methylation state of the CpG dinucleotide sequence in this sample, those skilled in the art can use quantitative determination methods to determine the methylation level (such as percentage, number, ratio, proportion or degree) of a specific CpG dinucleotide sequence, rather than the methylation state. Accordingly, the term methylation status or methylation state should also be considered to refer to the value reflecting the methylation state of the CpG dinucleotide sequence.

[0229] On the other hand, the present application provides an oligonucleotide for in vitro detection of ovarian cancer, comprising: a fragment of at least 9 nucleotides of a sequence shown in any one of SEQ ID NOs: 1-12 or its complementary sequence and comprising at least one CpG dinucleotide sequence; and / or a fragment of at least 9 nucleotides of a sequence shown in any one of SEQ ID NOs: 13-24 or its complementary sequence and comprising at least one CpG dinucleotide sequence; and / or a fragment of at least 9 nucleotides of a sequence shown in any one of SEQ ID NOs: 25-36 or its complementary sequence and comprising at least one CpG dinucleotide sequence.

[0230] Preferably, the oligonucleotide for in vitro detection of ovarian cancer comprises: a fragment of at least 9 nucleotides in a sequence after bisulfite conversion of a sequence shown in any one of SEQ ID NOs: 1-12 or a complementary sequence thereof; and / or a fragment of at least 9 nucleotides in a sequence after bisulfite conversion of a sequence shown in any one of SEQ ID NOs: 13-24 or a complementary sequence thereof and containing at least one CpG dinucleotide sequence; and / or a fragment of at least 9 nucleotides in a sequence after bisulfite conversion of a sequence shown in any one of SEQ ID NOs: 25-36 or a complementary sequence thereof and containing at least one CpG dinucleotide sequence.

[0231] The oligonucleotides for in vitro detection of ovarian cancer of the present application also include: a fragment that hybridizes to at least 15 nucleotides in a sequence shown in any one of SEQ ID NOs: 1-12 or its complementary sequence under moderately stringent or stringent conditions and contains at least one CpG dinucleotide sequence; and / or a fragment that hybridizes to at least 15 nucleotides in a sequence shown in any one of SEQ ID NOs: 13-24 or its complementary sequence under moderately stringent or stringent conditions and contains at least one CpG dinucleotide sequence; and / or a fragment that hybridizes to at least 15 nucleotides in a sequence shown in any one of SEQ ID NOs: 25-36 or its complementary sequence under moderately stringent or stringent conditions and contains at least one CpG dinucleotide sequence.

[0232] Preferably, the oligonucleotide for in vitro detection of ovarian cancer comprises: a fragment that hybridizes to at least 15 nucleotides in a sequence after bisulfite conversion of a sequence shown in any one of SEQ ID NOs: 1-12 or a complementary sequence thereof under moderately stringent or stringent conditions and comprises at least one CpG dinucleotide sequence; and / or a fragment that hybridizes to at least 15 nucleotides in a sequence after bisulfite conversion of a sequence shown in any one of SEQ ID NOs: 13-24 or a complementary sequence thereof under moderately stringent or stringent conditions and comprises at least one CpG dinucleotide sequence; and / or a fragment that hybridizes to at least 15 nucleotides in a sequence after bisulfite conversion of a sequence shown in any one of SEQ ID NOs: 25-36 or a complementary sequence thereof under moderately stringent or stringent conditions and comprises at least one CpG dinucleotide sequence.

[0233] The oligonucleotide for in vitro detection of ovarian cancer of the present application may also include: a blocker that preferentially binds to DNA in a non-methylated state.

[0234] In a specific embodiment, the oligonucleotide for in vitro detection of ovarian cancer comprises the sequences of SEQ ID NO: 37 and SEQ ID NO: 38. It also comprises the sequence of SEQ ID NO: 39.

[0235] In another specific embodiment, the oligonucleotide for detecting ovarian cancer in vitro comprises the sequences of SEQ ID NO: 40 and SEQ ID NO: 41, and further comprises the sequence of SEQ ID NO: 42.

[0236] In another specific embodiment, the oligonucleotide for detecting ovarian cancer in vitro comprises the sequences of SEQ ID NO: 43 and SEQ ID NO: 44, and further comprises the sequence of SEQ ID NO: 45.

[0237] In another specific embodiment, the oligonucleotide for detecting ovarian cancer in vitro comprises the sequences of SEQ ID NO: 46 and SEQ ID NO: 47. It also comprises the sequence of SEQ ID NO: 48.

[0238] In another specific embodiment, the oligonucleotide for detecting ovarian cancer in vitro comprises the sequences of SEQ ID NO: 49 and SEQ ID NO: 50 and also comprises the sequence of SEQ ID NO: 51.

[0239] In another specific embodiment, the oligonucleotide for detecting ovarian cancer in vitro comprises the sequences of SEQ ID NO: 52 and SEQ ID NO: 53 and further comprises the sequence of SEQ ID NO: 54.

[0240] In another specific embodiment, the oligonucleotide for detecting ovarian cancer in vitro comprises the sequences of SEQ ID NO: 55 and SEQ ID NO: 56 and further comprises the sequence of SEQ ID NO: 57.

[0241] In another specific embodiment, the oligonucleotide for detecting ovarian cancer in vitro comprises the sequences of SEQ ID NO: 58 and SEQ ID NO: 59. It also comprises the sequence of SEQ ID NO: 60.

[0242] In another specific embodiment, the oligonucleotide for detecting ovarian cancer in vitro comprises the sequences of SEQ ID NO: 61 and SEQ ID NO: 62, and further comprises the sequence of SEQ ID NO: 63.

[0243] In another aspect, the present application provides a kit comprising the composition, which further comprises at least one other component selected from the following: nucleoside triphosphates, DNA polymerase, and a buffer required for the function of the DNA polymerase.

[0244] Typically, the kit also includes a container for containing a biological sample from a patient. In addition, the kit also includes instructions for use and interpretation of the test results.

[0245] The present application also relates to the use of the above composition and oligonucleotide in preparing a kit for in vitro detection of ovarian cancer.

[0246] The present application also relates to the use of one or more of the TFAP2E gene, the WNT10A gene, and the IFFO1 gene in the preparation of a kit for in vitro detection of ovarian cancer. The TFAP2E gene, as a transcription factor, can bind to a specific sequence of DNA to regulate the expression of other genes. This regulatory effect plays a key role in cell proliferation, differentiation, migration, and other processes.

[0247] As a member of the Wnt signaling pathway, the WNT10A gene plays a key role in embryonic development, cell proliferation, differentiation, migration, and tissue homeostasis. Specifically, it is involved in regulating a variety of cellular processes, including stem cell maintenance, bone formation, tooth development, etc.

[0248] The IFFO1 gene encodes Intermediate Filament Family Orphan 1, a protein that may be involved in maintaining the structure and function of the cytoskeleton in cells. Intermediate filaments are important components of the cytoskeleton and play an important role in maintaining cell morphology, cell division, signal transduction, and the response of cells to external stimuli.

[0249] In another aspect, the present application provides a method for detecting ovarian cancer in vitro, the method comprising the following steps:

[0250] 1) Isolating the target sequence or fragment thereof of the target gene in the biological sample to be tested;

[0251] 2) determining the methylation status of the target sequence of the target gene;

[0252] 3) The state of the biological sample is judged by the detection result of the methylation state of the target sequence of the target gene, thereby realizing in vitro detection of ovarian cancer.

[0253] According to certain preferred embodiments, the method further comprises the following steps:

[0254] 1) Extracting genomic DNA from the biological sample to be tested;

[0255] 2) treating the DNA sample obtained in step 1) with a reagent to convert the unmethylated cytosine base at position 5 into uracil or other bases, that is, the unmethylated cytosine base at position 5 of the target sequence of the target gene is converted into uracil or other bases, and the converted base is different from the unmethylated cytosine base at position 5 in terms of hybridization performance and is detectable;

[0256] 3) contacting the DNA sample treated in step 2) with a DNA polymerase and a primer of the target sequence of the target gene, so that the treated target sequence of the target gene is amplified to produce an amplification product or is not amplified; if the treated target sequence of the target gene undergoes a DNA polymerization reaction, an amplification product will be produced; if the treated target sequence of the target gene does not undergo a DNA polymerization reaction, it will not be amplified;

[0257] 4) detecting the amplified product with a probe; and

[0258] 5) determining the methylation status of at least one CpG dinucleotide of the target sequence of the target gene based on the presence or absence of the amplification product.

[0259] Preferably, a typical primer includes a fragment of the target sequence of the target gene, and the fragment of the target sequence of the target gene contains a fragment of at least 9 nucleotides that are respectively identical, complementary, or hybridize under moderately stringent or stringent conditions to any one of SEQ ID NOs: 1-12, any one of SEQ ID NOs: 13-24, and any one of SEQ ID NOs: 25-36.

[0260] Preferably, a typical probe includes a fragment of the target sequence of the target gene, and the fragment of the target sequence of the target gene contains a fragment of at least 15 nucleotides that are respectively identical, complementary, or hybridize under moderately stringent or stringent conditions to any one of SEQ ID NOs: 1-12, any one of SEQ ID NOs: 13-24, and any one of SEQ ID NOs: 25-36.

[0261] Preferably, one or more of the primers and probes are as shown in Table 2 above.

[0262] Furthermore, the contacting or amplifying comprises using at least one of the following methods: using a thermostable DNA polymerase as the amplification enzyme, using a polymerase lacking 5'-3' exonuclease activity, using polymerase chain reaction (PCR), and generating amplification product nucleic acid molecules with detectable labels.

[0263] Preferably, the methylation state is determined by PCR, such as "fluorescence-based real-time PCR technology", methylation-sensitive single nucleotide primer extension reaction (Ms-SNuPE), methylation-specific PCR (MSP), and methylated CpG island amplification (MCA) and other determination methods are used to determine the methylation state of at least one CpG dinucleotide of the target sequence of the target gene. Among them, the "fluorescence-based real-time PCR" determination is a high-throughput quantitative methylation determination, which uses fluorescence-based real-time PCR (TaqMan) technology and does not require further operation after the PCR step. In short, the "fluorescence-based real-time PCR" method starts with a mixed sample of genomic DNA, which is converted into a mixed pool of methylation-dependent sequence differences in a sodium bisulfite reaction according to standard operations. Subsequently, fluorescence-based PCR is performed in a "biased" reaction (using PCR primers that overlap known CpG dinucleotides). Sequence differences can be generated at the amplification level and at the fluorescence detection amplification level. The "fluorescence-based real-time PCR" determination can be used as a quantitative test of methylation state in genomic DNA samples, wherein sequence differentiation occurs at the probe hybridization level. In this quantitative mode, in the presence of a fluorescent probe that overlaps a specific CpG dinucleotide, the PCR reaction provides a methylation-specific amplification. The non-biased control for the initial DNA amount is provided by the following reaction: neither the primer nor the probe covers any CpG dinucleotide. The "fluorescence-based real-time PCR" method can be used with any suitable probe, such as "TaqMan", "Lightcycler", etc. The TaqMan probe is a fluorescent reporter (RTSPYL5rter) and a quencher molecule (Quencher) double-labeled, and is designed to be specific to a relatively high GC content region, so that it melts at a temperature of about 10°C higher than the forward or reverse primer in the PCR cycle. This allows the TaqMan probe to remain fully hybridized in the PCR annealing / extension step. When Taq polymerase synthesizes a new chain in PCR, it will eventually encounter the annealed TaqMan probe. The 5' to 3' endonuclease activity of the Taq polymerase will then replace the TaqMan probe by digesting it, thereby releasing the fluorescent reporter molecule for quantitative detection of its now unquenched signal using a real-time fluorescence detection system. Typical reagents for "fluorescence-based real-time PCR" analysis may include, but are not limited to: target sequence PCR primers for target genes; non-specific amplification blockers; TaqMan or Lightcycler probes; optimized PCR buffer and deoxynucleotides; and Taq polymerase, etc.

[0264] In certain preferred embodiments, the methylation state of at least one CpG dinucleotide in the target sequence of the target gene is determined by the critical Ct value of the real-time PCR reaction. By using the method of analyzing DNA in a biological sample by real-time PCR reaction, the methylation state of the target sequence of the target gene can be conveniently detected, and the critical Ct value of the PCR reaction can be used to quickly and conveniently determine whether the sample is positive, thereby providing a non-invasive and rapid in vitro detection method for ovarian cancer.

[0265] The biological sample is selected from the group consisting of cell lines, histological sections, tissue biopsies / paraffin-embedded tissues, body fluids, feces, colon effluent, urine, plasma, serum, whole blood, isolated blood cells, cells isolated from blood, or a combination thereof. The preferred biological sample is plasma.

[0266] The inventors of the present application have found that there are significant differences in the methylation status of the target sequences of the TFAP2E gene, WNT10A gene, and IFFO1 gene in ovarian cancer tissues and the methylation status of the target sequences of the genes in normal tissues: in ovarian cancer tissues, the target sequences of the TFAP2E gene, WNT10A gene, and IFFO1 gene are methylated, while in normal tissues, the target sequences of the TFAP2E gene, WNT10A gene, and IFFO1 gene are not methylated. Therefore, the present application provides a method for in vitro detection of ovarian cancer by detecting the methylation status of one or more gene target sequences of the TFAP2E gene, WNT10A gene, and IFFO1 gene in a sample. The method provided by the present application can detect ovarian cancer non-invasively and quickly.

[0267] Example

[0268] The present application provides a general and / or specific description of the materials and test methods used in the experiments. In the following examples, unless otherwise specified, % means wt%, i.e., weight percentage. The reagents or instruments used without indicating the manufacturer are all conventional reagent products that can be obtained commercially.

[0269] Example 1 Primer and probe test

[0270] First, the sites with low methylation levels were screened in the next-generation sequencing information of 340 healthy white blood cells (WBC) and 102 healthy plasma cfDNA samples. Secondly, the low methylation level sites screened were analyzed in plasma and ovarian cancer tissue, and the sites with differences in 103 ovarian cancer plasma and 102 normal plasma, and in 56 ovarian cancer tissues and 56 adjacent tissues were screened as candidate markers. Then, the candidate markers were traced back to plasma. Finally, the sensitivity and specificity of ovarian cancer tissue and normal plasma were verified, and three specific markers, TFAP2E gene, WNT10A gene, and IFFO1 gene, were determined. Primers and probes were designed according to the target sequences of the above three genes, and the designed primer and probe sequences are shown in Table 2 above.

[0271] Normal human leukocyte cell line DNA is usually in a low / non-methylated state and can be used as a negative control. The amount of DNA used in this embodiment is 15.75 ng / reaction; fully methylated DNA is in a high / fully methylated state and can be used as a positive control. The amount of DNA used in this embodiment is 200 pg / reaction. The DNA sample is first subjected to bisulfite conversion, and the converted BisDNA is used as a template to perform real-time PCR amplification using the above-mentioned primer probe. The β-actin (ACTB) gene is used as an internal reference, and a β-actin gene amplicon is created by using primers complementary to the β-actin gene sequence, and the β-actin gene amplicon is detected with a specific probe. Each sample is subjected to at least one real-time PCR, and in some specific embodiments, two or three real-time PCR tests are performed. The PCR system for the primer probe test is shown in Table 4 below.

[0272] Table 4 PCR system for primer probe test

[0273] Volume (μl) Final concentration Taq DNA Polymerase(Biochain) 1.2 / 4.2×buffer(Biochain) 11.9 1× Forward primer F (10 μM) 1.0 200nM Reverse primer R (10 μM) 1.0 200nM Probe P (10 μM) 1.0 200nM ACTB_F (10μM) 0.5 100nM ACTB_R(10μM) 0.5 100nM ACTB_P (10μM) 0.375 75nM BisDNA 4.0 / H2O 19.05 / Total 50.0 /

[0274] Note: “F” stands for forward primer; “R” stands for reverse primer; “P” stands for probe.

[0275] The PCR amplification program used was: 94°C, 20 min; (93°C, 30 s; 57°C, 35 s—read the fluorescence signal) 45 cycles; 40°C, 5 s.

[0276] The results are shown in Table 5. When BisDNA of fully methylated DNA was used as a template, TFAP2E gene, WNT10A gene, and IFFO1 gene were all effectively amplified; however, when BisDNA of WBC was used as a template, except for the internal reference gene ACTB, the other target genes were not amplified.

[0277] Table 5 Test results of primers and probes for each gene

[0278]

[0279]

[0280] Note: “No Ct” means no Ct value was detected.

[0281] Example 2

[0282] 16 ovarian cancer tissue samples (10 ng / reaction) and 16 normal human plasma samples (3.5 mL) were selected, genomic DNA was extracted, and after conversion to BisDNA by bisulfite, the methylation of TFAP2E, WNT10A and IFFO1 genes was detected according to the PCR reaction system in Tables 6 to 8 and the reaction procedure in Example 1. Finally, the Ct values ​​of real-time PCR for the target sequence of the target gene of 16 ovarian cancer tissues and 16 normal human plasma were measured, and the sensitivity detection results of each gene in ovarian cancer samples and the specificity detection results in benign samples are shown in Tables 9 and 10.

[0283] Table 6 TFAP2E PCR reaction system

[0284] Volume (μl) Final concentration Taq DNA Polymerase(Biochain) 1.2 / 4.2×buffer(Biochain) 11.9 1× TFAP2E_1F (10 μM) 1.0 200nM TFAP2E_1R (10 μM) 1.0 200nM TFAP2E_1P (10 μM) 1.0 200nM TFAP2E_2F (10 μM) 1.0 200nM TFAP2E_2R (10 μM) 1.0 200nM TFAP2E_2P (10 μM) 1.0 200nM TFAP2E_3F (10 μM) 1.0 250nM TFAP2E_3R (10 μM) 1.0 250nM TFAP2E_3P (10 μM) 1.0 250nM ACTB_F (10μM) 0.5 100nM ACTB_R(10μM) 0.5 100nM ACTB_P (10μM) 0.375 75nM BisDNA 4.0 / <![CDATA[H2O]]> 22.525 / Total 50.0 /

[0285] Table 7 WNT10A PCR reaction system

[0286]

[0287]

[0288] Table 8 IFFO1 PCR reaction system

[0289] Volume (μl) Final concentration Taq DNA Polymerase(Biochain) 1.2 / 4.2×buffer(Biochain) 11.9 1× IFFO1_1F (10 μM) 1.0 200nM IFFO1_1R (10 μM) 1.0 200nM IFFO1_1P (10 μM) 1.0 200nM IFFO1_2F (10 μM) 1.0 200nM IFFO1_2R (10 μM) 1.0 200nM IFFO1_2P (10 μM) 1.0 200nM IFFO1_3F (10 μM) 1.0 250nM IFFO1_3R (10 μM) 1.0 250nM IFFO1_3P (10 μM) 1.0 250nM ACTB_F (10μM) 0.5 100nM ACTB_R(10μM) 0.5 100nM ACTB_P (10μM) 0.375 75nM BisDNA 4.0 / <![CDATA[H2O]]> 22.525 / Total 50.0 /

[0290] Note: In Table 6-8, “F” represents forward primer; “R” represents reverse primer; and “P” represents probe.

[0291] Table 9 Sensitivity of each gene in ovarian cancer samples

[0292]

[0293] Table 10 Specific detection of each gene in benign samples

[0294]

[0295] The results in Tables 9 and 10 show that the detection of ovarian cancer tissues and benign samples using TFAP2E gene, WNT10A gene, and IFFO1 gene can achieve good sensitivity and specificity. When interpreting, firstly judge whether the gene test result is positive according to the amplification of the gene (when the marker Ct value is less than 41, the sample is judged to be positive in the gene test result); then judge whether the sample is positive according to the results of the three genes. For each gene, a sequence with the best sensitivity and specificity is selected, namely TFAP2E-1, WNT10A-2, and IFFO1-1. The sensitivity of the three genes detected separately is 87.50%, 81.25%, and 87.50%, respectively; any two of the three genes are positive and are interpreted as positive, and the sensitivity of the final interpretation reaches 100%. At the same time, the methylation of the target gene sequence has good specificity, with the specificity of TFAP2E-1 being 93.75%, the specificity of WNT10A-2 being 93.75%, the specificity of IFFO1-1 being 100%, and the specificity of all three genes being negative being 93.75%.

[0296] Among the above three markers related to ovarian cancer, judging from the test results of tissues, their tissue sensitivity is above 81.25%, and the sensitivity of the combined interpretation of the three genes can reach more than 100%. Judging from the test results of benign tissues, the tissue specificity of single genes is above 93.75%, and the combined interpretation of three genes also reaches more than 93.75%. Under the conditions of small sample size verification, a tissue specificity of 80% is a relatively reasonable and high indicator level. Therefore, the above experimental results show that the three target genes selected in this application are potential markers for detecting methylation of ovarian cancer.

[0297] Example 3

[0298] 37 ovarian cancer plasma samples (3.5 mL) (samples S1-S37) and 33 normal human plasma samples (3.5 mL) (samples S38-S70) were selected, genomic DNA was extracted, and after conversion to BisDNA by bisulfite, methylation detection was performed according to the PCR reaction system in Example 1, and combined with TFAP2E-1, WNT10A-2 and IFFO1-1 genes. Finally, the Ct values ​​of real-time PCR for the target sequence of the target gene of 37 ovarian cancer plasma samples and 33 normal human plasma were measured. According to the positive detection of two of the three genes, it was judged as positive, and the other results were judged as negative. The results are shown in Tables 11 to 13 below. The sensitivity of using TFAP2E-1, WNT10A-2 and IFFO1-1 genes alone to detect ovarian cancer was 75.68%, 78.39% and 73.00%, respectively; the sensitivity of the combined detection of the three genes reached 91.89%, and the specificity was 93.94%.

[0299] Table 11 Sensitivity of each gene in ovarian cancer plasma samples

[0300]

[0301]

[0302]

[0303] Table 12 Specific detection of each gene in normal human plasma samples

[0304]

[0305]

[0306]

[0307] Table 13

[0308]

[0309] The above experimental results show that the methylated DNA of the target gene target sequence is a marker for ovarian cancer. Through the detection of methylated DNA of the target gene target sequence of the present application, non-invasive detection of ovarian cancer in vitro can be achieved, and the detection rate of ovarian cancer can be improved.

[0310] In summary, the present application utilizes the above-mentioned composition, nucleic acid sequence, kit and its use, as well as the above-mentioned detection method, by detecting the methylated nucleic acid sequence of the target sequence of the target gene and its fragments, to realize the in vitro detection of ovarian cancer using the target sequence methylation biomarker of the target gene, thereby effectively improving the sensitivity and specificity of in vitro detection of ovarian cancer.

[0311] The above is only the preferred embodiment of the present application, and does not limit the present application in other forms. Any technician familiar with the profession may use the above disclosed technical content to change or modify it into an equivalent embodiment with equivalent changes. However, any simple modification, equivalent change and modification made to the above embodiment based on the technical essence of the present application without departing from the technical solution of the present application still falls within the protection scope of the technical solution of the present application.

Claims

1. A composition for in vitro detection of ovarian cancer, comprising: Nucleic acid used to detect the methylation status of the target gene, Wherein, the methylation state of the target gene is characterized by the methylation of the target sequence of the target gene, Wherein, the target gene is one or more of the TFAP2E gene, the WNT10A gene and the IFFO1 gene.

2. The composition according to claim 1, wherein The target genes are TFAP2E gene, WNT10A gene and IFFO1 gene.

3. The composition according to claim 1, wherein The target sequence of the TFAP2E gene is as shown in any one of SEQ ID NOs: 1-12 or the target sequence of the TFAP2E gene includes a sequence as shown in any one of SEQ ID NOs: 1-12; Preferably, the target sequence of the TFAP2E gene includes a sequence as shown in any one of SEQ ID NOs: 1-4 and any one of SEQ ID NOs: 5-8, or the target sequence of the TFAP2E gene includes a sequence as shown in any one of SEQ ID NOs: 1-4 and any one of SEQ ID NOs: 9-12, or the target sequence of the TFAP2E gene includes a sequence as shown in any one of SEQ ID NOs: 5-8 and any one of SEQ ID NOs: 9-12, or the target sequence of the TFAP2E gene includes a sequence as shown in any one of SEQ ID NOs: 1-4 and any one of SEQ ID NOs: 5-8 and any one of SEQ ID NOs: 9-12.

4. The composition according to claim 1, wherein The target sequence of the WNT10A gene is as shown in any one of SEQ ID NOs: 13-24 or the target sequence of the WNT10A gene includes a sequence as shown in any one of SEQ ID NOs: 13-24; Preferably, the target sequence of the WNT10A gene includes a sequence as shown in any one of SEQ ID NOs: 13-16 and any one of SEQ ID NOs: 17-20, or the target sequence of the WNT10A gene includes a sequence as shown in any one of SEQ ID NOs: 13-16 and any one of SEQ ID NOs: 21-24, or the target sequence of the WNT10A gene includes a sequence as shown in any one of SEQ ID NOs: 17-20 and any one of SEQ ID NOs: 21-24, or the target sequence of the WNT10A gene includes a sequence as shown in any one of SEQ ID NOs: 13-16 and any one of SEQ ID NOs: 17-20 and any one of SEQ ID NOs: 21-24.

5. The composition according to claim 1, wherein The target sequence of the IFFO1 gene is as shown in any one of SEQ ID NOs: 25-36 or the target sequence of the IFFO1 gene includes a sequence as shown in any one of SEQ ID NOs: 25-36; Preferably, the target sequence of the IFFO1 gene includes a sequence as shown in any one of SEQ ID NOs:25-28 and any one of SEQ ID NOs:29-32, or the target sequence of the IFFO1 gene includes a sequence as shown in any one of SEQ ID NOs:25-28 and any one of SEQ ID NOs:33-36, or the target sequence of the IFFO1 gene includes a sequence as shown in any one of SEQ ID NOs:29-32 and any one of SEQ ID NOs:33-36, or the target sequence of the IFFO1 gene includes a sequence as shown in any one of SEQ ID NOs:25-28 and any one of SEQ ID NOs:29-32 and any one of SEQ ID NOs:33-36.

6. An oligonucleotide for in vitro detection of ovarian cancer, comprising: A fragment of at least 9 nucleotides of a sequence as shown in any one of SEQ ID NOs: 1-12 or a complementary sequence thereof and comprising at least one CpG dinucleotide sequence; and / or A fragment of at least 9 nucleotides of a sequence as shown in any one of SEQ ID NOs: 13-24 or a complementary sequence thereof and comprising at least one CpG dinucleotide sequence; and / or A fragment of at least 9 nucleotides of a sequence as shown in any one of SEQ ID NOs: 25-36 or a complementary sequence thereof and comprising at least one CpG dinucleotide sequence.

7. The oligonucleotide according to claim 6, further comprising: A fragment that hybridizes to at least 15 nucleotides of the sequence as shown in any one of SEQ ID NOs: 1-12 or its complementary sequence under moderately stringent or stringent conditions and comprises at least one CpG dinucleotide sequence; and / or A fragment that hybridizes to at least 15 nucleotides of the sequence as shown in any one of SEQ ID NOs: 13-24 or its complementary sequence under moderately stringent or stringent conditions and contains at least one CpG dinucleotide sequence; and / or A fragment that hybridizes to at least 15 nucleotides of the sequence as shown in any one of SEQ ID NOs: 25-36 or its complementary sequence under moderately stringent or stringent conditions and contains at least one CpG dinucleotide sequence.

8. A kit comprising the composition according to any one of claims 1 to 5 or the oligonucleotide according to claim 6 or 7.

9. Use of the composition according to any one of claims 1 to 5 or the oligonucleotide according to claim 6 or 7 in the preparation of a kit for in vitro detection of ovarian cancer.

10. Use of one or more of the TFAP2E gene, the WNT10A gene, and the IFFO1 gene in the preparation of a kit for in vitro detection of ovarian cancer.

Images