Positive quality control product for detecting large fragment deletion of breast cancer and ovarian cancer genes and preparation method of positive quality control product
By developing recombinant plasmid-positive quality control products containing genes related to breast and ovarian cancer, the problem that the test results are susceptible to samples is solved, more accurate quality control effects are achieved, and the preparation and preservation process of quality control products is simplified.
Patent Information
- Application Number
- CN202510410379.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-04-02
- Publication Date
- 2025-06-13
AI Technical Summary
When the prior art detects the deletion of large fragments of genes related to breast and ovarian cancer, the results are susceptible to the residue of inhibitors after nucleic acid extraction of the sample and the concentration of nucleic acid to be amplified, and the positive quality control of human genome is difficult to obtain and easy to degrade.
A positive quality control product for recombinant plasmids containing BRCA1/BRCA2/ATM/PALB2, a genetic gene associated with breast and ovarian cancer was developed. The recombinant plasmid was detected by fluorescence quantitative polymerase chain reaction (qPCR) technology, and the recombinant plasmid was constructed using RNase P and plant sequences to provide stable quality control product.
This positive quality control product can perform quality control more accurately and specifically, simplifies the preparation process, and is easy to preserve and replicate, and is suitable for the field of genetic disease detection based on qPCR methods.
Smart Images

Figure CN120138154A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the fields of biotechnology and medical technology, and specifically to a positive control product for detecting large fragment deletions of breast cancer and ovarian cancer genes and a preparation method thereof. Background Art
[0002] In biological detection, the importance of positive control cannot be ignored. It can be used to verify the sensitivity and specificity of the detection system and ensure that the detection system can correctly identify the target substance.
[0003] Breast cancer and ovarian cancer are malignant tumors that seriously threaten the health of women in China, with certain hereditary and familial aggregation characteristics. Currently, about 20 genetic susceptibility genes related to breast cancer and ovarian cancer are known, among which the breast cancer susceptibility gene (BRCA) has the most significant impact. Germline mutations of the BRCA gene (including BRCA1 and BRCA2) are the core risk factors for familial breast cancer, ovarian cancer and other tumors. The cumulative risks of ovarian cancer in germline mutation carriers during their lifetime reach 54% and 23% respectively. In the population, especially in high-risk groups with a family history of tumors, BRCA gene detection can play a preventive management role. Currently, for the treatment of patients with BRCA1 / 2 gene mutations, the corresponding targeted drug PARP inhibitor has been marketed. Therefore, the detection of this gene has important reference significance for clinical medication guidance. In addition, for high-risk groups of ovarian malignant tumors, genes that need to be detected also include ATM, PALB2, STK11, etc.
[0004] Fluorescent quantitative polymerase chain reaction (qPCR) is a method in DNA amplification reactions that detects the total amount of products after each polymerase chain reaction cycle with fluorescent chemicals. By designing primer probes for the deletion regions of the target gene, measuring the Ct value of the unknown sample, and calculating the copy number of the target gene in the sample, the deletion situation of the gene can be determined. This method has the advantages of high sensitivity, simple operation, and good specificity. However, when using the qPCR method to detect large fragment deletions of breast cancer and ovarian cancer genes, the experimental results will be affected by factors such as the residual inhibitors after sample nucleic acid extraction and the concentration of nucleic acid to be amplified. Therefore, a stable positive control is needed as a reference. Currently, using human genome positive control has problems such as difficult acquisition and easy degradation during storage. Therefore, a new positive control is needed to avoid the above problems.
[0005] In view of this, the present invention uses qPCR detection technology to develop a positive control product for detecting large fragment deletions of breast cancer and ovarian cancer related genes (BRCA1 / BRCA2 / ATM / PALB2), which is simple to obtain and easy to store, and can provide stable quality control for experiments. Summary of the Invention
[0006] To solve the above problems, an object of the present invention is to provide a positive control product for detecting large - fragment deletions of breast cancer and ovarian cancer genes and a preparation method thereof.
[0007] To achieve the above object, the present invention provides the following technical solutions:
[0008] An object of the present invention is to provide a positive control product for detecting large - fragment deletions of breast cancer and ovarian cancer genes. Specifically, 4 positive control products for detecting large - fragment deletions of genes to be detected are prepared. The positive control product contains recombinant plasmids of genes to be detected. The genes to be detected include breast cancer and ovarian cancer - related genetic genes BRCA1 / BRCA2 / ATM / PALB2. The recombinant plasmid of the gene to be detected is a recombinant plasmid containing four gene fragments: the first exon of the gene to be detected, a plant sequence, the last exon of the gene, and RNase P.
[0009] Furthermore, the fragment sequence of the BRCA1 gene recombinant plasmid is as shown in SEQ ID NO.1. The fragment sequence of the BRCA1 gene recombinant plasmid consists of the following sequence fragments: RNase P sequence, BRCA1 intron 22 + exon 23 partial sequence, plant sequence, BRCA1 exon 1 + intron 1 partial sequence, RNase P sequence.
[0010] Furthermore, the fragment sequence of the BRCA2 gene recombinant plasmid is as shown in SEQ ID NO.2. The fragment sequence of the BRCA2 gene recombinant plasmid consists of the following sequence fragments: RNase P sequence, BRCA2 intron26 + exon27 partial sequence, plant sequence, BRCA2 exon1 + intron1 partial sequence, RNase P sequence.
[0011] Furthermore, the fragment sequence of the ATM gene recombinant plasmid is as shown in SEQ ID NO.3. The fragment sequence of the ATM gene recombinant plasmid consists of the following sequence fragments: RNase P sequence, ATM exon 62 + exon 63 partial sequence, plant sequence, ATM exon 2 + intron 2 partial sequence, RNase P sequence.
[0012] Furthermore, the fragment sequence of the PALB2 gene recombinant plasmid is as shown in SEQ ID NO.4. The fragment sequence of the PALB2 gene recombinant plasmid consists of the following sequence fragments: RNase P sequence, PALB2 intron 12 + exon 13 partial sequence, plant sequence, PALB2 exon 1 + intron1 partial sequence, RNase P sequence.
[0013] The RNase P sequence is as shown in SEQ ID NO.40.
[0014] SEQ ID NO.40:
[0015] GCGGAGGGAAGCTCATCAGTGGGGCCACGAGCTGAGTGCGTCCTGTCACTCCACTCCCATGTCCCTTGGGAAGGTCTGAGACTAGGG
[0016] Another object of the present invention is to provide a method for preparing a positive control product for detecting large fragment deletions of breast cancer and ovarian cancer genes, comprising the following steps:
[0017] S1: Extract wild-type human peripheral whole blood genomic DNA;
[0018] S2: Extract positive plasmids;
[0019] S2-1: Design and synthesize primers for the RNase P, the first exon and the last exon fragments of the genes to be detected (the genes to be detected include BRCA1, BRCA2, ATM, PALB2), and the plant fragment, which need to be ligated to the recombinant plasmids of the four genes to be detected. The upstream and downstream of the primers should be added with corresponding homologous arm sequences according to the preset ligation order. The primer sequences are as follows:
[0020] S2-2: Perform PCR amplification of the target fragments contained in the primers in step S2-1 and gel recovery. Among them, the amplification of the genes to be detected and RNase P uses the human genomic DNA extracted in step S1 as a template, and the plant sequence is synthesized by Sangon Biotech (Shanghai) Co., Ltd. and ligated to the T vector as a template. The synthesized plant sequence is as shown in SEQ ID NO.5:
[0021]
[0022] S2-3: Connect to construct the recombinant plasmid of the gene to be detected and transform it into the host bacterium, and select single colonies for PCR electrophoresis verification;
[0023] S2-4: Use first-generation sequencing technology to confirm the PCR products of the colonies;
[0024] S2-5: Extract the positive plasmid from the positive host bacterium;
[0025] S3: Use the qPCR method to calculate the corresponding gene copy number in the recombinant plasmid of the gene to be detected through CopyCaller v2.1;
[0026] S4: Verification of the repeatability and stability of the positive control product;
[0027] During the preparation process, amplification primers for the first exon and the last exon fragments of the 4 genes BRCA1 / BRCA2 / ATM / PALB2 insertion fragments were designed and synthesized.
[0028] Furthermore, the primers for RNase P, the last exon and the first exon fragments, and the plant fragment to be ligated for the recombinant plasmid of the BRCA1 gene are as shown in Table 1 below. The upstream and downstream of the primers should be added with the corresponding homologous arm sequences according to the preset ligation order:
[0029] Table 1
[0030] Primer Name Primer Sequence Number RNaseP-F CATCTAGATATCGGATCCGCGGAGGGAAGCTCATCAGTGG SEQ ID NO.6 RNase P-R GCCCTAGGAGTGACTCCTGGTGCCCTAGTCTCAGACCTTC SEQ ID NO.7 BRCA1(intron22+exon23)-F TGAGACTAGGGCACCAGGAGTCACTCCTAGGGCCTCTTCA SEQ ID NO.8 BRCA1(intron22+exon23)-R CAAGCCTATAACTCTTTGTAAGCTCATTCTTGGGGTCCTG SEQ ID NO.9 Plant Fragment-F GAATGAGCTTACAAAGAGTTATAGGCTTGGATTAAACGAG SEQ ID NO.10 Plant Fragment-R CGGAAACCAAGGAACCCCAGAAGTTTTCACAATCGGACCT SEQ ID NO.11 BRCA1(exon1+intron1)-F GTGAAAACTTCTGGGGTTCCTTGGTTTCCGTGGCAACGGA SEQ ID NO.12 BRCA1(exon1+intron1)-R ATGAGCTTCCCTCCGCAGTAAATTTAAGATTTGGAAGGTT SEQ ID NO.13 RNase P-F CTTAAATTTACTGCGGAGGGAAGCTCATCAGTGGGGCCAC SEQ ID NO.14 RNase P-R ACCATGATTACGCCAAGCTTCCCTAGTCTCAGACCTT SEQ ID NO.15
[0031] Furthermore, the primers for RNase P, the last exon and the first exon fragments, and the plant fragment to be ligated for the recombinant plasmid of the BRCA2 gene are as shown in Table 2 below. The upstream and downstream of the primers should be added with the corresponding homologous arm sequences according to the preset ligation order:
[0032] Table 2
[0033]
[0034]
[0035] Furthermore, the primers for RNase P, the last exon and the first exon fragments, and the plant fragment to be ligated for the recombinant plasmid of the ATM gene are as shown in Table 3 below. The upstream and downstream of the primers should be added with the corresponding homologous arm sequences according to the preset ligation order:
[0036] Table 3
[0037] Primer Name Primer Sequence Sequence Number RNase P-F CATCTAGATATCGGATCCGCGGAGGGAAGCTCATCAGTGG SEQ ID NO.6 RNase P-R AGTATTACAAGGTTGGACCCTAGTCTCAGACCTTCCCAAG SEQ ID NO.24 ATM(exon 62+exon 63)-F AAGGTCTGAGACTAGGGTCCAACCTTGTAATACTGGAAT SEQ ID NO.25 ATM(exon 62+exon 63)-R ATCCAAGCCTATAACTAGAGTGAAAGCAGAGATGTTCCTTA SEQ ID NO.26 Plant Fragment-F AACATCTCTGCTTTCACTCTAGTTATAGGCTTGGATTAAAC SEQ ID NO.27 Plant fragment - R AGAACACACATCACTGTAACCCCAGAAGTTTTCACAATCG SEQ ID NO.28 ATM (exon 2 + intron 2) - F TGAAAACTTCTGGGGTTACAGTGATGTGTGTTCTGAAATTGTG SEQ ID NO.29 ATM (exon 2 + intron 2) - R GAGCTTCCCTCCGCAGCCAGGAATGCTGGGT SEQ ID NO.30 RNaseP - F CACCCAGCATTCCTGGCTGCGGAGGGAAGCTCATCAGTGG SEQ ID NO.31 RNaseP - R ACCATGATTACGCCAAGCTTCCCTAGTCTCAGACCTT SEQ ID NO.15
[0038] Furthermore, the primers for RNase P, the last exon and the first exon fragments, and the plant fragments to be ligated to the designed and synthesized PALB2 gene recombinant plasmid are as shown in Table 4 below. The upstream and downstream of the primers should be added with corresponding homologous arm sequences according to the preset ligation order:
[0039] Table 4
[0040] Primer name Primer sequence Sequence number RNase P - F CATCTAGATATCGGATCCGCGGAGGGAAGCTCATCAGTGG SEQ ID NO.6 RNase P - R CTCTCCAAAGAGTATTATCCCTAGTCTCAGACCTTCCCA SEQ ID NO.32 PALB2 (intron 12 + exon 13) - F GAAGGTCTGAGACTAGGGATAATACTCTTTGGAGAGCTGG SEQ ID NO.33 PALB2 (intron 12 + exon 13) - R AATCCAAGCCTATAACTCACTTTACCCTAACTTATGAATA SEQ ID NO.34 Plant fragment - F ATAAGTTAGGGTAAAGTGAGTTATAGGCTTGGATTAAACGA SEQ ID NO.35 Plant fragment - R AGTGCGCGATCAGCTGAAACCCCAGAAGTTTTCACAATC SEQ ID NO.36 PALB2 (exon 1 + intron1) - F TGAAAACTTCTGGGGTTTCAGCTGATCGCGCACTGAGGGT SEQ ID NO.37 PALB2 (exon 1 + intron1) - R TGATGAGCTTCCCTCCGCCATGCTACTAGACAAGTTGCCA SEQ ID NO.38 RNase P - F ACTTGTCTAGTAGCATGGCGGAGGGAAGCTCATCAGTGG SEQ ID NO.39 RNase P - R ACCATGATTACGCCAAGCTTCCCTAGTCTCAGACCTT SEQ ID NO.15
[0041] Compared with the prior art, the beneficial effects of the present invention are as follows:
[0042] The positive control products provided by the present invention respectively contain 4 genetic genes of breast cancer and ovarian cancer, and can perform quality control more accurately and specifically;
[0043] The present invention constructs recombinant plasmids by using the genetic genes of breast cancer and ovarian cancer, RNase P, and plant sequences, which can be used as stable quality control products for detecting large fragment deletions of breast cancer and ovarian cancer genes. By inserting the human genomic RNaseP sequence into the plasmid vector at a fragment ratio of 2:1, and using the fluorescence quantitative qPCR method to verify the copy number of the gene to be detected, so as to judge whether the obtained plasmid can be used as a positive control product for detection, and complete the quality inspection of the positive control product itself; the preparation method provided by the present invention is simple and easy to operate, and has good stability. The positive control product obtained by using this preparation method can be used as a positive internal standard quality control substance for detecting large fragment deletions of breast cancer and ovarian cancer genes, monitoring the whole experimental process, and improving the accuracy of experimental and detection results.
[0044] The positive control products prepared by the present invention are easy to store and replicate, are applicable to the field of genetic disease detection based on the qPCR method, and are helpful for large-scale popularization and use. Description of the Drawings
[0045] Figure 1 Sequencing results at the BRCA1 Exon1 qPCR primer probe in Example 1;
[0046] Figure 2 Sequencing results at the BRCA1 Exon23 qPCR primer probe in Example 1;
[0047] Figure 3 Detection result diagram of BRCA1 Exon 1 in Example 1;
[0048] Figure 4 Detection result diagram of BRCA1 Exon23 in Example 1;
[0049] Figure 5 Sequencing results at the PALB2 Exon1 qPCR primer probe in Example 2;
[0050] Figure 6 Sequencing results at the PALB2 Exon13 qPCR primer-probe in Example 2;
[0051] Figure 7 Detection result diagram of PALB2 Exon 1 in Example 2;
[0052] Figure 8 Detection result diagram of PALB2 Exon 13 in Example 2;
[0053] Figure 9 Sequencing results at the ATM Exon2 qPCR primer-probe in Example 3;
[0054] Figure 10 Sequencing results at the ATM Exon63 qPCR primer-probe in Example 3;
[0055] Figure 11 Detection result diagram of ATM Exon 2 in Example 3;
[0056] Figure 12 Detection result diagram of ATM Exon63 in Example 3;
[0057] Figure 13 Sequencing results at the BRCA2 Exon1 qPCR primer-probe in Example 4;
[0058] Figure 14 Sequencing results at the BRCA2 Exon27 qPCR primer-probe in Example 4;
[0059] Figure 15 Detection result diagram of BRCA2 Exon 1 in Example 4;
[0060] Figure 16 Detection result diagram of BRCA2 Exon27 in Example 4. Detailed implementation manners
[0061] Next, the technical solutions in the embodiments of the present invention will be clearly and completely described in conjunction with the accompanying drawings in the embodiments of the present invention. Obviously, the described embodiments are only a part of the embodiments of the present invention, rather than all the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative efforts shall fall within the protection scope of the present invention.
[0062] Unless otherwise specified, the technical means used in the examples are all conventional methods. Reagents and consumables involved in the examples can be obtained from commercial sources without special instructions. In the following fluorescence quantitative PCR experiments of the examples, two repeated tests were set, and the results were averaged. The construction processes of the four plasmids designed in the present invention are the same. The following examples are detailed descriptions of the construction of the four positive plasmids.
[0063] Example 1
[0064] 1. Construction method of BRCA1 positive plasmid
[0065] S101: Extract genomic DNA from the whole blood of 2 cases of wild-type human peripheral blood, and the extraction process is carried out according to the operation manual of (Tiangen, DP304);
[0066] S102: Construct positive plasmid;
[0067] S102-1: Primer design and synthesis. BRCA1 exon1-F2R2 and BRCA1-Exon1 probe2 are primer-probe combinations for detecting BRCA1 exon1, and BRCA1 exon23-F1R1 and BRCA1-Exon23 probe1 are primer-probe combinations for detecting BRCA1 exon23. The following primers and probes are synthesized by Sangon Biotech (Shanghai) Co., Ltd.
[0068] F1: As shown in sequence SEQ ID NO.6; R1: As shown in sequence SEQ ID NO.7;
[0069] F2: As shown in sequence SEQ ID NO.8; R2: As shown in sequence SEQ ID NO.9;
[0070] F3: As shown in sequence SEQ ID NO.10; R3: As shown in sequence SEQ ID NO.11;
[0071] F4: As shown in sequence SEQ ID NO.12; R4: As shown in sequence SEQ ID NO.13;
[0072] F5: As shown in sequence SEQ ID NO.14; R5: As shown in sequence SEQ ID NO.15.
[0073] BRCA1-Exon1 F2 5’-CGTGAGCTCGCTGAGACTTC-3’
[0074] BRCA1-Exon1 R2 5’-GCCAGTACCCCAGAGCAT-3’
[0075] BRCA1-Exon1 probe2(FAM) 5’-CCCTGCGCTCAGGAGGCCTT-3’
[0076] BRCA1-exon23 F1 5’-CAATTGGGCAGATGTGTGAGG-3’
[0077] BRCA1-exon23 R1 5’-CCTGTGGCTCTGTACCTGTG-3’
[0078] BRCA1-exon23 probe1(FAM) 5’-CCAACACCCACTCTCGGGTCAC-3’。
[0079] Among them: The primer pairs F1 and R1 amplify the RNase P DNA fragment; the primer pairs F2 and R2 amplify a partial DNA fragment of BRCA1 intron22-exon23; the primer pairs F3 and R3 amplify the DNA fragment of plant papain; the primer pairs F4 and R4 amplify a partial DNA fragment of BRCA1 exon1+intron1. The primer pairs F5 and R5 amplify the RNase P DNA fragment.
[0080] S102-2: Amplification of the target fragment and gel extraction and recovery;
[0081] Amplify the fragment to be inserted into the vector according to the above primers. The amplification system and procedure are carried out according to the operation manual of Phanta SE Super-Fidelity DNA Polymerase (Novoprotein, 7E702K3), and the PCR product is subjected to gel extraction and recovery according to the operation manual of SanPrep Column DNA Gel Extraction Kit (Sangon Biotech, B518131-0100). Among them, the amplification of the gene to be detected and RNase P uses the human genomic DNA extracted in step S101 as the template, and the plant sequence is synthesized by Sangon Biotech and ligated to the T vector as the template, as shown in SEQ ID NO.5.
[0082] S102-3: Ligation to construct a recombinant plasmid. According to -Basic Seamless Cloning and Assembly Kit (TransGen Biotech, CU201-02) operation manual, carry out the ligation reaction of the obtained gene fragment with the PUC57 vector.
[0083] S102-4: Extract the positive plasmid in the positive host bacteria:
[0084] Transfer the recombinant plasmid obtained in S102-3 into Trans1-T1 Phage Resistant Chemically Competent Cell (TransGen Biotech, CD501-02) according to the instruction manual. After overnight culture, spread the cells on a plate to obtain monoclonal strains. After expanding the culture of the monoclonal bacteria, perform colony PCR electrophoresis verification using the universal primers M13F and M13R on the plasmid. Send the strains with positive electrophoresis verification to Sangon Biotech (Shanghai) Co., Ltd. for first-generation sequencing. The test results are shown in Figure 1 and Figure 2 . Confirm that the vector construction is successful and there are no mutations at the qPCR primer-probe sites. After determining the positive host bacteria, extract the plasmid, add 50% glycerol to the bacterial solution, and store it at -80°C.
[0085] 2. Verification of the repeatability and stability of the positive control
[0086] (I) Fluorescent quantitative PCR system and conditions:
[0087] After diluting the plasmid DNA extracted in step S102-4 above to 0.5 ng, further dilute it to 10 -5 as samples for qPCR fluorescence quantification. Use BRCA1 exon1-F2R2, BRCA1-Exon1 probe2 and BRCA1 exon23-F1R1, BRCA1-Exon23 probe1 as the primer-probes for detecting BRCA1 exon23 in the fluorescence quantitative PCR amplification, and detect the copy numbers of BRCA 1 gene exon 1 and exon 23. Each sample is tested in four replicates, and samples with known BRCA1 gene copy numbers are detected (where 2000 plasmid is the constructed 1-copy positive control, GM14626 is a 1-copy sample, S9020240518282 is a 3-copy sample, and sample1-8 are cell lines with 2 copies) to verify the accuracy of the system test results. The reaction systems are shown in Tables 5 and 6:
[0088] Table 5. System 1 - GC content of the amplified fragment < 59%
[0089]
[0090] Table 6. System 2 - GC content of the amplified fragment > 59%
[0091]
[0092]
[0093] (2) qPCR for specific reactions
[0094] In the qPCR procedure for specific reactions, the experimental instrument used was: Applied Biosystems TM 7500 Real-Time Fluorescent Quantitative PCR System.
[0095] Table 7. Real-Time Fluorescent Quantitative PCR Procedure
[0096]
[0097] (3) Obtaining the detection results
[0098] The detection results obtained from the above steps are shown in Tables 8 and 9:
[0099] Table 8. BRCA1 exon1 Detection Results Table
[0100] SampleName Target Reference CNCalculated CNPredicted Confidence Z-score 2000 plasmid exon RNaseP 1.18 1 >0.99 2.85 GM14626 exon RNaseP 1.72 2 >0.99 1.91 S9020240518282 exon RNaseP 3.06 3 0.99 0.00 Sample1 exon RNaseP 2.06 2 >0.99 0.61 Sample2 exon RNaseP 2.02 2 >0.99 0.15 Sample3 exon RNaseP 2.02 2 >0.99 0.22 Sample4 exon RNaseP 1.99 2 >0.99 0.06 Sample5 exon RNaseP 2.01 2 >0.99 0.11 Sample6 exon RNaseP 1.96 2 >0.99 0.03 Sample7 exon RNaseP 1.92 2 >0.99 0.06 Sample8 exon RNaseP 1.98 2 >0.99 0.05
[0101] Table 9. BRCA1 exon 23 Detection Results Table
[0102] SampleName Target Reference CNCalculated CNPredicted Confidence Z-score 2000 plasmid exon RNaseP 1.07 1 >0.99 0.86 GM14626 exon RNaseP 2.02 2 >0.99 0.08 S9020240518282 exon RNaseP 2.61 3 0.82 1.96 Sample1 exon RNaseP 2.08 2 >0.99 0.33 Sample2 exon RNaseP 1.98 2 >0.99 0.03 Sample3 exon RNaseP 1.90 2 >0.99 0.24 Sample4 exon RNaseP 1.99 2 >0.99 0.05 Sample5 exon RNaseP 1.90 2 >0.99 0.36 Sample6 exon RNaseP 1.94 2 >0.99 0.09 Sample7 exon RNaseP 2.02 2 >0.99 0.05 Sample8 exon RNaseP 2.03 2 >0.99 0.09
[0103] From Figure 3 、 Figure 4 and Tables 8 and 9, it can be seen that the qPCR experimental results for the copy number detection of the positive control product, samples, and cell lines are all consistent with the expectations, indicating that the BRCA1 positive control product prepared by the method provided in the present invention can be used as a positive control product for the detection of large fragment deletions of the BRCA1 gene in breast cancer and ovarian cancer.
[0104] Example 2
[0105] 1. Construction method of PALB2 positive plasmid
[0106] S201: The same as Example S101;
[0107] S202: Construct a positive plasmid;
[0108] S202-1: Primer design and synthesis. PALB2 Exon1-F2R1 and PALB2 Exon1-probe2 are the primer-probe combinations for detecting PALB2 exon1, and PALB2 Exon13-F4R4 and PALB2 Exon13-probe4 are the primer-probe combinations for detecting PALB2 exon13. The following primers and probes were synthesized by Sangon Biotech (Shanghai) Co., Ltd.
[0109] F1: As shown in sequence SEQ ID NO.6; R1: As shown in sequence SEQ ID NO.32;
[0110] F2: as shown in SEQ ID NO.33; R2: as shown in SEQ ID NO.34;
[0111] F3: as shown in SEQ ID NO.35; R3: as shown in SEQ ID NO.36;
[0112] F4: as shown in SEQ ID NO.37; R4: as shown in SEQ ID NO.38;
[0113] F5: as shown in SEQ ID NO.39; R5: as shown in SEQ ID NO.15.
[0114] PALB2 Exon1-F2 TGCTCTTTTCGTTCTGTCGC
[0115] PALB2 Exon1-R1 CTTTTCCTTCTCCTCACAGCT
[0116] PALB2 Exon1-probe2(FAM)CTGCCCGATGGACGAGCCTC
[0117] PALB2 Exon13-F4 GAACAATTGCCATTTGGGACT
[0118] PALB2 Exon13-R4 TCTGTACCCGACCATTTCAC
[0119] PALB2 Exon13-probe4(FAM)CTTCTCGGTCAGTGTACTGCCCTC.
[0120] Wherein: The F1R1 primer pair amplifies the RNaseP DNA fragment; the F2R2 primer pair amplifies a partial DNA fragment of PALB2 intron12-exon13; the F3R3 primer pair amplifies the DNA fragment of plant papain; the F4R4 primer pair amplifies a partial DNA fragment of PALB2 exon1+intron1; the F5R5 primer pair amplifies the RNaseP DNA fragment.
[0121] S202-2: Amplification of the target fragment and gel extraction and recovery; the same as S102-2 in Example 1.
[0122] S202-3: The same as S102-3 in Example 1.
[0123] S202-4: Extract the positive plasmid in the positive host bacteria:
[0124] Same as S102-4 in Example 1. For the first-generation sequencing detection results, please refer to Figure 5 and Figure 6 , to confirm that the vector construction is successful and there are no mutations at the qPCR primer-probe sites.
[0125] 2. Verification of the repeatability and stability of the PALB2 positive control
[0126] (I) Fluorescent quantitative PCR system and conditions
[0127] After diluting the plasmid DNA to 0.5 ng, it was further diluted to 10 -5 as samples for qPCR fluorescence quantification. Using PALB2Exon1-F2R1, PALB2 Exon1-probe2, PALB2 Exon13-F4R4, and PALB2 Exon13-probe4 as the primer-probes for fluorescence quantitative PCR amplification respectively, to detect the copy numbers of exon1 and exon13 of PALB2. Four replicates were made for each sample, and samples with known PALB2 gene copy numbers were detected (where sample1-8 are cell lines with 2 copies, and sample9-10 are the constructed positive plasmids) to verify the accuracy of the system detection results. The reaction system is as follows:
[0128] Table 10. GC content of the PALB2 exon1 amplification fragment is 60%
[0129]
[0130]
[0131] Table 11. GC content of the PALB2 exon13 amplification fragment is 49% 2 mM MgCL 2
[0132]
[0133] (II) qPCR for specific reactions
[0134] In the qPCR program for specific reactions, the experimental instrument used is: Applied Biosystems TM 7500 Real-Time Fluorescent Quantitative PCR System. The real-time fluorescent quantitative PCR program is shown in Table 7.
[0135] (III) Obtaining the detection results
[0136] For the detection results obtained from the above steps, the specific detection results are shown in Table 12 and Table 13:
[0137] Table 12. Detection result table of PALB2 exon1
[0138] SampleName Target Reference CNCalculated CNPredicted Confidence Z-score Sample1 exon RNaseP 1.92 2 >0.99 0.06 Sample10 exon RNaseP 1.0 1 >0.99 0.15 Sample11 exon RNaseP 1.76 2 >0.99 1.85 Sample2 exon RNaseP 2.05 2 >0.99 0.45 Sample3 exon RNaseP 1.96 2 >0.99 0.03 Sample4 exon RNaseP 2.02 2 >0.99 0.27 Sample5 exon RNaseP 1.96 2 >0.99 0.03 Sample6 exon RNaseP 1.97 2 >0.99 0.03 Sample7 exon RNaseP 2.05 2 >0.99 0.72 Sample8 exon RNaseP 1.96 2 >0.99 0.02 Sample9 exon RNaseP 1.05 1 >0.99 1.11
[0139] Table 13. Detection Results Table of PALB2 exon13
[0140] SampleName Target Reference CNCalculated CNPredicted Confidence Z-score Sample1 exon RNaseP 1.89 2 >0.99 0.06 Sample10 exon RNaseP 1.19 1 0.99 1.48 Sample11 exon RNaseP 2.34 2 0.84 1.87 Sample2 exon RNaseP 1.93 2 >0.99 0.04 Sample3 exon RNaseP 1.84 2 >0.99 0.11 Sample4 exon RNaseP 1.82 2 >0.99 0.3 Sample5 exon RNaseP 1.83 2 >0.99 0.2 Sample6 exon RNaseP 1.86 2 >0.99 0.16 Sample7 exon RNaseP 1.94 2 >0.99 0.02 Sample8 exon RNaseP 1.95 2 >0.99 0.03 Sample9 exon RNaseP 1.33 1 <0.50 3.11
[0141] From Figure 7 、 Figure 8 and the detection results in Table 12 and Table 13, it can be seen that the qPCR experimental results are consistent with the expectations for the copy number detection results of PALB2 positive control products, samples, and cell lines, indicating that the PALB2 positive control products prepared by this method can be used as positive control products for the detection of large fragment deletions of the PALB2 gene in breast cancer and ovarian cancer.
[0142] Example 3
[0143] 1. Construction Method of ATM Positive Plasmid
[0144] S301: The same as Example S101;
[0145] S302: Construct positive plasmid;
[0146] S302-1: Primer design and synthesis. ATM Exon2-F1R1 and ATM Exon2-probe1(FAM) are primer-probe combinations for detecting ATM exon2, and ATM Exon63-F1R1 and ATM Exon63-probe1(FAM) are primer-probe combinations for detecting ATM Exon63. The following primers and probes are synthesized by Sangon Biotech (Shanghai) Co., Ltd.
[0147] F1: As shown in sequence SEQ ID NO.6; R1: As shown in sequence SEQ ID NO.24;
[0148] F2: As shown in sequence SEQ ID NO.25; R2: As shown in sequence SEQ ID NO.26;
[0149] F3: As shown in sequence SEQ ID NO.27; R3: As shown in sequence SEQ ID NO.28;
[0150] F4: As shown in sequence SEQ ID NO.29; R4: As shown in sequence SEQ ID NO.30;
[0151] F5: As shown in sequence SEQ ID NO.31; R5: As shown in sequence SEQ ID NO.15.
[0152] RnaseP-F 5’-CGGAGGGAAGCTCATCAG-3’
[0153] RnaseP-R 5’-CCCTAGTCTCAGACCTTCCCA-3’
[0154] RnaseP-Probe(HEX)5’-CCACGAGCTGAGTGCGTCCTGTC-3’
[0155] ATM Exon2-F1 5’-TGTTCTGAAATTGTGAACCATGAG-3’
[0156] ATM Exon2-R1 5’-CGTTCTGTAGCTCTATCATGTTCT-3’
[0157] ATM Exon2-probe1(FAM)5’-TCTGCTTATCTGCTGCCGTCAACT-3’
[0158] ATM Exon63-F1 5’-TGAAAGGAGTGGAAGAAGGCA-3’
[0159] ATM Exon63-R1 5’-GGTCTATGGCCTGCTGTATGA-3’
[0160] ATM Exon63-probe1(FAM)5’-TTCACTTGTCCACCAACACTGAGCA-3’.
[0161] Among them, the F1R1 primer pair amplifies the RnaseP DNA fragment; the F2R2 primer pair amplifies a partial DNA fragment of ATM Intron 62 + Exon 63; the F3R3 primer pair amplifies the DNA fragment of plant papain; the F4R4 primer pair amplifies a partial DNA fragment of ATM Exon 2 + Intron 2. The F5R5 primer pair amplifies the RnaseP DNA fragment.
[0162] S302-2: Amplification of the target fragment and gel extraction and recovery; the same as S102-2 in Example 1;
[0163] S302-3: The same as S102-3 in Example 1.
[0164] S302-4: Extract the positive plasmid in the positive host bacteria:
[0165] The same as S102-4 in Example 1, and for the first-generation sequencing test results, please refer to Figure 9 and Figure 10, confirm that the vector construction is successful and there are no mutations at the qPCR primer-probe sites.
[0166] 2. Verification of the repeatability and stability of the ATM positive control
[0167] (I) Fluorescent quantitative PCR system and conditions
[0168] After diluting the plasmid DNA to 0.5 ng, further dilute it to 10 -5 as samples for qPCR fluorescence quantification. Using ATM Exon2-F1R1 and ATM Exon2-probe1, ATM Exon63-F1R1 and ATM Exon63-probe1 as the primer-probes for fluorescence quantitative PCR amplification respectively, detect the copy numbers of Exon2 and Exon63 of ATM. Each sample is made into four replicates, and samples with known ATM gene copy numbers are detected (where sample1-8 are negative cell line samples with 2 copies, sample9 is a random sample, and sample10 is the constructed and diluted ATM-1 plasmid) to verify the accuracy of the system detection results. The reaction system is as follows:
[0169] Table 14. GC content of the ATM Exon2 amplification fragment is 40% and 2 mM MgCL 2
[0170]
[0171] Table 15. GC content of the ATM exon 63 amplification fragment is 49% and 2 mM MgCL 2
[0172]
[0173]
[0174] (III) qPCR for specific reactions
[0175] In the qPCR program for specific reactions, the experimental instrument used is: Applied Biosystems TM 7500 Real-Time Fluorescent Quantitative PCR System. The real-time fluorescent quantitative PCR program is shown in Table 7.
[0176] (IV) Obtaining the detection results
[0177] For the specific detection results obtained in the above steps, please refer to Table 16 and Table 17:
[0178] Table 16. ATM Exon2 detection result table
[0179] Sample target reference CNCalculated CNPredicted Confidence |Z-Score| Sample1 exon RNaseP 1.95 2 >0.99 0.08 Sample10 exon RNaseP 0.95 1 >0.99 0.0 Sample2 exon RNaseP 2.01 2 >0.99 0.1 Sample3 exon1 RNaseP 1.99 2 >0.99 0.04 Sample4 exon RNaseP 1.97 2 >0.99 0.04 Sample5 exon RNaseP 2.05 2 >0.99 0.4 Sample6 exon RNaseP 1.94 2 >0.99 0.2 Sample7 exon RNaseP 2.06 2 >0.99 0.63 Sample8 exon RNaseP 2.02 2 >0.99 0.09 Sample9 exon RNaseP 1.85 2 >0.99 1.47
[0180] Table 17. Detection Results Table of ATM Exon63
[0181] Sample target reference CNCalculated CNPredicted Confidence |Z-Score| Sample1 exon RNaseP 2.01 2 >0.99 0.06 Sample10 exon RNaseP 0.85 1 >0.99 0.0 Sample2 exon RNaseP 1.97 2 >0.99 0.04 Sample3 exon RNaseP 2.02 2 >0.99 0.16 Sample4 exon RNaseP 1.97 2 >0.99 0.03 Sample5 exon RNaseP 1.99 2 >0.99 0.04 Sample6 exon RNaseP 2.01 2 >0.99 0.15 Sample7 exon RNaseP 2.07 2 >0.99 0.38 Sample8 exon RNaseP 2.07 2 >0.99 0.44 Sample9 exon RNaseP 1.68 2 >0.99 1.93
[0182] From Figure 11 、 Figure 12 and the detection results in Table 16 and Table 17, it can be seen that the qPCR experimental results of the copy number detection of ATM positive control products, samples and cell lines are all consistent with the expectations, indicating that the ATM positive control products prepared by this method can be used as positive control products for the detection of large fragment deletions of the ATM gene in breast cancer and ovarian cancer.
[0183] Example 4
[0184] 1. Construction Method of BRCA2 Positive Plasmid
[0185] S401: The same as Example S101;
[0186] S402: Construct positive plasmid;
[0187] S402-1: Primer design and synthesis. RnaseP-FR and RnaseP Probe (HEX) are primer-probe combinations for detecting RnaseP, BRCA2 Exon1-F1R1 and BRCA2 Exon1-probe1 (FAM) are primer-probe combinations for detecting BRCA2 Exon1, and BRCA2 Exon27-F1R1 and BRCA2 Exon27-probe1 (FAM) are primer-probe combinations for detecting BRCA2 Exon27. The following primers and probes are synthesized by Sangon Biotech (Shanghai) Co., Ltd.
[0188] F1: As shown in sequence SEQ ID NO.6; R1: As shown in sequence SEQ ID NO.16;
[0189] F2: As shown in sequence SEQ ID NO.17; R2: As shown in sequence SEQ ID NO.18;
[0190] F3: As shown in sequence SEQ ID NO.19; R3: As shown in sequence SEQ ID NO.20;
[0191] F4: As shown in sequence SEQ ID NO.21; R4: As shown in sequence SEQ ID NO.22;
[0192] F5: As shown in sequence SEQ ID NO.23; R5: As shown in sequence SEQ ID NO.15.
[0193] RnaseP-F: 5’-CGGAGGGAAGCTCATCAG-3’
[0194] RnaseP-R: 5’-CCCTAGTCTCAGACCTTCCCA-3’
[0195] RnaseP-Probe(HEX): 5’-CCACGAGCTGAGTGCGTCCTGTC-3’
[0196] BRCA2 Exon1-F1: 5’-GAGCCGCTGTGGCACT-3’
[0197] BRCA2 Exon1-R1: 5’-GCCGGTCACAAATCTGTCC-3’
[0198] BRCA2 Exon1-probe1(FAM): 5’CTCTGCTGCGCCTCGGGTGTCT-3’
[0199] BRCA2 Exon27-F1: 5’-GACTGCCTTTACCTCCACCT-3’
[0200] BRCA2 Exon27-R1: 5’-GTATTTGGTGCCACAACTCCTT-3’
[0201] BRCA2 Exon27-probe1(FAM): 5’-TCTCCGGCTGCACAGAAGGCAT-3’.
[0202] Among them, the F1R1 primer pair amplifies the RnaseP DNA fragment; the F2R2 primer pair amplifies a partial DNA fragment of BRCA2 Intron26 and Exon27; the F3R3 primer pair amplifies the DNA fragment of plant papain; the F4R4 primer pair amplifies a partial DNA fragment of BRCA2 Exon1; the F5R5 primer pair amplifies the RnaseP DNA fragment.
[0203] S402-2: Amplification of the target fragment and gel extraction and recovery; the same as S102-2 in Example 1.
[0204] S402-3: The same as S102-3 in Example 1.
[0205] S402-4: Extract the positive plasmid from the positive host bacteria: the same as S102-4 in Example 1, perform first-generation sequencing, and the detection results can be seen in Figure 13 and Figure 14 . Confirm that the vector construction is successful and there are no mutations at the qPCR primer probe.
[0206] 2. Verification of Repeatability and Stability of BRCA2 Positive Control
[0207] (I) Fluorescent Quantitative PCR System and Conditions
[0208] After diluting the plasmid DNA to 0.5 ng, it was further diluted to 10 -5 as samples for qPCR fluorescence quantification. Using BRCA2Exon1-F1R1, BRCA2 Exon1-probe1, BRCA2 Exon27-F1R1, and BRCA2 Exon27-probe1 as primer probes for fluorescence quantitative PCR amplification respectively, the copy numbers of Exon1 and Exon27 of BRCA2 were detected. Four replicates were made for each sample, and samples with known BRCA2 gene copy numbers were detected (where sample1-8 were negative cell line samples with 2 copies, negative sample was a random negative 2-copy sample, and BRCA2-1 and BRCA2-2 were constructed and diluted BRCA2 plasmids) to verify the accuracy of the system detection results. The reaction system is as follows:
[0209] Table 18. GC content of BRCA2 Exon 1 amplification fragment is 65%
[0210]
[0211] Table 19. GC content of BRCA2 Exon27 amplification fragment is 49%
[0212]
[0213] (II) qPCR for Specific Reactions
[0214] In the qPCR program for specific reactions, the experimental instrument used was: Applied Biosystems TM 7500 Real-Time Fluorescent Quantitative PCR System. The real-time fluorescent quantitative PCR program is shown in Table 7.
[0215] (III) Obtaining Detection Results
[0216] For the specific detection results obtained in the above steps, please refer to Table 20 and Table 21.
[0217] Table 20. BRCA2 exon1 Detection Results Table
[0218]
[0219]
[0220] Table 21. BRCA2 Exon27 Detection Results Table
[0221] Sample Target Reference CNCalculated CNPredicted Confidence |Z-Score| BRCA2-1 exon RNaseP 1.3 1 0.9 4.46 BRCA2-2 exon RNaseP 1.38 1 <0.50 5.53 Negativesample exon RNaseP 1.77 2 >0.99 1.27 Sample1 exon RNaseP 1.87 2 >0.99 0.18 Sample2 exon RNaseP 1.87 2 >0.99 0.23 Sample3 exon RNaseP 1.95 2 >0.99 0.03 Sample4 exon RNaseP 1.97 2 >0.99 0.06 Sample5 exon RNaseP 1.94 2 >0.99 0.03 Sample6 exon RNaseP 1.93 2 >0.99 0.03 Sample7 exon RNaseP 2.03 2 >0.99 0.3 Sample8 exon RNaseP 2.11 2 >0.99 1.2
[0222] From Figure 15 、 Figure 16 、the test results in Table 20 and Table 21, it can be seen that the qPCR experimental results for the copy number detection of BRCA2 positive control products, samples and cell lines are all consistent with the expectations, indicating that the BRCA2 positive control products prepared by this method can be used as positive control products for the detection of large fragment deletions of the BRCA2 gene in breast cancer and ovarian cancer.
[0223] It should be noted that in this article, relational terms such as first and second are only used to distinguish one entity or operation from another entity or operation, and do not necessarily require or imply any such actual relationship or order between these entities or operations. Moreover, the term "comprising", "including" or any other variant thereof is intended to cover non-exclusive inclusion, so that a process, method, article or device comprising a series of elements not only includes those elements, but also includes other elements not expressly listed, or also includes elements inherent to such process, method, article or device.
[0224] It should be noted that the above content only illustrates the technical idea of the present invention and cannot be used to limit the protection scope of the present invention. For those of ordinary skill in the art, without departing from the principle of the present invention, several improvements and refinements can be made, and these improvements and refinements all fall within the protection scope of the claims of the present invention.
Claims
1. A positive quality control product for detecting large gene deletions in breast cancer and ovarian cancer, characterized in that: The positive quality control product comprises a recombinant plasmid of a gene to be detected, wherein the recombinant plasmid of the gene to be detected is a recombinant plasmid comprising four gene fragments, namely, the first exon, the plant sequence, the last exon, and RNase P of the gene to be detected; the genes to be detected include BRCA1, BRCA2, ATM, and PALB2.
2. A positive quality control product for detecting large gene deletions in breast cancer and ovarian cancer according to claim 1, characterized in that: The fragment sequence of the BRCA1 gene recombinant plasmid is shown in SEQ ID NO.
1.
3. A positive quality control product for detecting large gene deletions in breast cancer and ovarian cancer according to claim 1, characterized in that: The fragment sequence of the BRCA2 gene recombinant plasmid is shown in SEQ ID NO.
2.
4. A positive quality control product for detecting large gene deletions in breast cancer and ovarian cancer according to claim 1, characterized in that: The fragment sequence of the ATM gene recombinant plasmid is shown in SEQ ID NO.
3.
5. A positive quality control product for detecting large gene deletions in breast cancer and ovarian cancer according to claim 1, characterized in that: The fragment sequence of the PALB2 gene recombinant plasmid is shown in SEQ ID NO.
4.
6. A method for preparing a positive quality control product for detecting large gene deletions in breast cancer and ovarian cancer, characterized in that: The following steps are involved: S1: Extract wild-type human peripheral whole blood genomic DNA; S2: Extract positive plasmid; S2-1: Design and synthesize primers for RNase P, the first exon and the last exon fragment of the gene sequence to be detected, and the plant sequence required for connecting the recombinant plasmids of the four genes to be detected. The upstream and downstream of the primers should add corresponding homology arm sequences according to the preset connection order; the genes to be detected include BRCA1, BRCA2, ATM, and PALB2, and the plant sequence is shown in SEQ ID NO.5; S2-2: PCR amplification of the target fragment contained in the primers and gel recovery, wherein the amplification of the gene to be detected and RNase P uses the human genomic DNA extracted in step S1 as a template, and the plant sequence is artificially synthesized and connected to the T vector as a template; S2-3: Connect and construct the recombinant plasmid of the gene to be tested and transform it into the host bacteria, select a single colony for PCR electrophoresis verification; S2-4: Confirm the PCR products of the colonies using first-generation sequencing technology; S2-5: Extract the positive plasmid in the positive host bacteria; S3: Use the qPCR method to calculate the corresponding gene copy number in the recombinant plasmid of the gene to be detected through CopyCaller v2.1; S4: Verification of repeatability and stability of positive quality control products; The four gene recombinant plasmids to be detected are the gene recombinant plasmids to be detected as described in any one of claims 1 to 5.
7. The method for preparing a positive quality control product for detecting large gene deletions in breast cancer and ovarian cancer according to claim 6, characterized in that: The primer pair for the last exon fragment of the BRCA1 gene sequence is shown in SEQ ID NO.8 and SEQ ID NO.9, and the primer pair for the first exon fragment of the BRCA1 gene sequence is shown in SEQ ID NO.12 and SEQ ID NO.
13.
8. The method for preparing a positive quality control product for detecting large gene deletions in breast cancer and ovarian cancer according to claim 6, characterized in that: The primer pair for the last exon fragment of the BRCA2 gene sequence is shown in SEQ ID NO.17 and SEQ ID NO.18, and the primer pair for the first exon fragment of the BRCA2 gene sequence is shown in SEQ ID NO. SEQ ID NO.21 and SEQ ID NO.22 are shown.
9. The method for preparing a positive quality control product for detecting large gene deletions in breast cancer and ovarian cancer according to claim 6, characterized in that: The primer pair for the last exon fragment of the ATM gene sequence is shown in SEQ ID NO.25 and SEQ ID NO.26, and the primer pair for the first exon fragment of the ATM gene sequence is shown in SEQ ID NO.29 and SEQ ID NO.
30.
10. The method for preparing a positive quality control product for detecting large gene deletions in breast cancer and ovarian cancer according to claim 6, characterized in that: The primer pair for the last exon fragment of the PALB2 gene sequence is shown in SEQ ID NO.33 and SEQ ID NO.34, and the primer pair for the first exon fragment of the PALB2 gene sequence is shown in SEQ ID NO.37 and SEQ ID NO.38.