An SNP locus related to the strength of the porcine immune system, related molecular markers and their applications
By detecting and screening the SNP loci at chromosome 40842218bp of the International Pig Reference Genome Version 11.1, the GG genotype pig is preferred as the parent, and the frequency of dominant alleles is increased generation by generation, the problem of the strength of the immune system in pig breeding is solved, the percentage content of CD4-CD8+CD3+ mononuclear T cells in pigs is improved, and the pig's disease resistance and economic benefits are enhanced.
Patent Information
- Application Number
- CN202411524747.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-10-30
- Publication Date
- 2025-07-18
- Estimated Expiration
- 2044-10-30
AI Technical Summary
Existing pig breeding technology is difficult to effectively improve the strength of pigs' immune system, especially the percentage of CD4-CD8+CD3+ mononuclear T cells, affecting pigs' disease resistance.
By detecting the SNP loci at chromosome 40842218bp in the pig genome version 11.1 version 7 of the International Pig Reference Genome 11.1, the pigs with the International Pig Reference Genome 11.1 version 7, using relevant SNP molecular markers, screening and improving the immune traits of pigs, and preferring pigs with GG genotypes are breeded as parents, increasing the frequency of dominant alleles generation by generation, and increasing the percentage content of CD4-CD8+CD3+mononuclear T cells in pigs.
It significantly improves the immunity of pigs, enhances the disease resistance of pigs, and improves the economic benefits of pig farms.
Smart Images

Figure BDA0005108911170000021 
Figure BDA0005108911170000031 
Figure BDA0005108911170000032
Abstract
Description
Technical Field
[0001] The present invention belongs to the fields of molecular biotechnology and molecular marker technology. Specifically, the present invention relates to an SNP locus related to the strength of the pig immune system, related molecular markers and their applications. Background Art
[0002] In the breeding process of pigs, the strength of the immune system is an important consideration factor. The CD4-CD8+CD3+ mononuclear T cells of pigs, as a key component of the immune system, are closely related to the disease resistance ability of pigs. When dealing with virus, bacteria and parasite infections, CD4-CD8+CD3+ mononuclear T cells play a crucial role in the anti-infection immunity of pigs. Therefore, in the pig breeding program, selecting individuals with a strong immune system and a strong response of CD4-CD8+CD3+ mononuclear T cells can improve the disease resistance ability of the offspring of breeding pigs. Summary of the Invention
[0003] In order to overcome the deficiencies of the prior art, the purpose of the present invention is to provide an SNP locus related to the strength of pig immunity or the percentage content of CD4-CD8+CD3+ mononuclear T cells in blood routine, and to develop an SNP molecular marker related to this locus.
[0004] The purpose of the present invention also lies in: providing the application of substances for detecting the polymorphism or genotype of the SNP locus in the pig genome in any of the following: (1) identifying or assisting in identifying the percentage content of CD4-CD8+CD3+ mononuclear T cells in pig blood routine; (2) screening or improving pig immune traits; (3) pig breeding.
[0005] Another purpose of the present invention is to provide a primer composition and a kit for identifying the above SNP molecular marker.
[0006] The purpose of the present invention also lies in: providing the application of the above primer pair and kit, and providing a genetic improvement method for molecular marker-assisted breeding to improve pig immune traits.
[0007] The present invention is implemented as follows:
[0008] Use of a reagent for detecting SNP loci related to the strength of the pig immune system in identifying the percentage content of CD4-CD8+CD3+ mononuclear T cells in the blood routine of pigs. The SNP locus corresponds to the 40,842,218th bp on chromosome 7 of the international pig reference genome version 11.1 and is located within the CLIC5 gene. The polymorphism of the bases at this locus affects the percentage content of CD4-CD8+CD3+ mononuclear T cells in the blood routine of pigs. The percentage content of CD4-CD8+CD3+ mononuclear T cells in pigs with the GG genotype at the SNP locus is higher than that in pigs with the AG genotype and the AA genotype. The percentage content of CD4-CD8+CD3+ mononuclear T cells in pigs with the AG genotype at the SNP locus is higher than that in pigs with the AA genotype.
[0009] Use of a reagent for detecting SNP loci related to the strength of the pig immune system in screening pigs with high percentage content of CD4-CD8+CD3+ mononuclear T cells in the blood routine. The SNP locus corresponds to the 40,842,218th bp on chromosome 7 of the international pig reference genome version 11.1 and is located within the CLIC5 gene. The polymorphism of the bases at this locus affects the percentage content of CD4-CD8+CD3+ mononuclear T cells in the blood routine of pigs. The percentage content of CD4-CD8+CD3+ mononuclear T cells in pigs with the GG genotype at the SNP locus is higher than that in pigs with the AG genotype and the AA genotype. The percentage content of CD4-CD8+CD3+ mononuclear T cells in pigs with the AG genotype at the SNP locus is higher than that in pigs with the AA genotype.
[0010] Use of a reagent for detecting SNP loci related to the strength of the pig immune system in the genetic breeding of pigs with high percentage content of CD4-CD8+CD3+ mononuclear T cells in the blood routine. The SNP locus corresponds to the 40,842,218th bp on chromosome 7 of the international pig reference genome version 11.1 and is located within the CLIC5 gene. The polymorphism of the bases at this locus affects the percentage content of CD4-CD8+CD3+ mononuclear T cells in the blood routine of pigs. The percentage content of CD4-CD8+CD3+ mononuclear T cells in pigs with the GG genotype at the SNP locus is higher than that in pigs with the AG genotype and the AA genotype. The percentage content of CD4-CD8+CD3+ mononuclear T cells in pigs with the AG genotype at the SNP locus is higher than that in pigs with the AA genotype.
[0011] Use of a reagent for detecting SNP molecular markers related to the strength of the pig immune system in identifying the trait of the percentage content of CD4-CD8+CD3+ mononuclear T cells in the blood routine of pigs, characterized in that: the nucleotide sequence of the SNP molecular marker is
[0012]
[0013] This SNP locus is named the (G / A) locus. The nucleotide type of the (G / A) locus can be G or A, and the genotypes can be GG, AG, or AA. The percentage content of CD4 - CD8+CD3+ mononuclear T cells in the blood routine of pigs with the GG genotype is higher than that of pigs with the AG genotype and pigs with the AA genotype. The percentage content of CD4 - CD8+CD3+ mononuclear T cells in the blood routine of pigs with the AG genotype is higher than that of pigs with the AA genotype.
[0014] Application of a reagent for detecting an SNP molecular marker related to the strength of the pig immune system in screening pigs with a high percentage content of CD4 - CD8+CD3+ mononuclear T cells in the blood routine, wherein the nucleotide sequence of the SNP molecular marker is
[0015]
[0016]
[0017] This SNP locus is named the (G / A) locus. The nucleotide type of the (G / A) locus can be G or A, and the genotypes can be GG, AG, or AA. The percentage content of CD4 - CD8+CD3+ mononuclear T cells in the blood routine of pigs with the GG genotype is higher than that of pigs with the AG genotype and pigs with the AA genotype. The percentage content of CD4 - CD8+CD3+ mononuclear T cells in the blood routine of pigs with the AG genotype is higher than that of pigs with the AA genotype.
[0018] Application of a reagent for detecting an SNP molecular marker related to the strength of the pig immune system in genetic breeding to improve the percentage content of CD4 - CD8+CD3+ mononuclear T cells in the blood routine of pigs, wherein the nucleotide sequence of the SNP molecular marker is
[0019]
[0020] This SNP locus is named the (G / A) locus. The nucleotide type of the (G / A) locus can be G or A, and the genotypes can be GG, AG, or AA. The percentage content of CD4 - CD8+CD3+ mononuclear T cells in the blood routine of pigs with the GG genotype is higher than that of pigs with the AG genotype and pigs with the AA genotype. The percentage content of CD4 - CD8+CD3+ mononuclear T cells in the blood routine of pigs with the AG genotype is higher than that of pigs with the AA genotype.
[0021] A method for detecting the strength of a pig's immune system, comprising the following steps: detecting the SNP locus located at position 40,842,218 bp on chromosome 7 of the international pig reference genome version 11.1, within the CLIC5 gene; identifying whether the single nucleotide at the said SNP locus is A or G; determining the genotype of the pig to be tested; analyzing and judging that the percentage content of CD4 - CD8+CD3+ mononuclear T cells in the blood routine of pigs with the GG genotype at the said SNP locus is higher than that of pigs with the AG genotype and the AA genotype; and the percentage content of CD4 - CD8+CD3+ mononuclear T cells in the blood routine of pigs with the AG genotype is higher than that of pigs with the AA genotype.
[0022] A primer composition for identifying SNP loci related to the strength of a pig's immune system, comprising an upstream primer and a downstream primer, and their nucleotide sequences are as follows:
[0023] Upstream primer: 5’-TGCTTTACTTCTGCCTTAGAGCAAT-3’;
[0024] Downstream primer: 5’-TCCTCCTCTTGCCAACCCAC-3’;
[0025] The said SNP locus corresponds to position 40,842,218 bp on chromosome 7 of the international pig reference genome version 11.1, within the CLIC5 gene. The percentage content of CD4 - CD8+CD3+ mononuclear T cells in the blood routine of pigs with the GG genotype at this SNP locus is higher than that of pigs with the AG genotype and the AA genotype; and the percentage content of CD4 - CD8+CD3+ mononuclear T cells in the blood routine of pigs with the AG genotype is higher than that of pigs with the AA genotype.
[0026] The application of the foregoing primer composition in identifying the trait of the percentage content of CD4 - CD8+CD3+ mononuclear T cells in the blood routine of pigs.
[0027] The application of the foregoing primer composition in screening pigs with a high percentage content of CD4 - CD8+CD3+ mononuclear T cells in the blood routine.
[0028] The application of the foregoing primer composition in improving the genetic assistant breeding of the trait of the percentage content of CD4 - CD8+CD3+ mononuclear T cells in the blood routine of pigs.
[0029] A kit for identifying SNP loci related to the strength of a pig's immune system, and the said kit includes the foregoing primer composition.
[0030] Preferably, the foregoing kit further includes at least one of PCR reaction buffer, Taq DNA polymerase, and dNTPs.
[0031] We found through experiments that the G / A site at position 40842218 of chromosome 7 of pigs has a significant effect on the percentage of CD4-CD8+CD3+ mononuclear T cells in pig blood routine tests. The nucleotide sequence of this site is
[0032] This SNP site is named as (G\A) site. The nucleotide type of the (G\A) site can be G or A, and the genotype can be GG, AA or AG. The GG genotype is a homozygous form in which the nucleotide of the (G\A) site is G. The AA genotype is a homozygous form in which the nucleotide of the (G\A) site is A. The AG genotype is a heterozygous form in which the nucleotide of the (G\A) site is G and A.
[0033] Based on the SNP site, the present invention provides a method for identifying or assisting in identifying the percentage content of CD4-CD8+CD3+monocyte T cells in pig blood routine, and the present invention provides a method for screening the percentage content of CD4-CD8+CD3+monocyte T cells in pig blood routine.
[0034] According to the genotype identification or auxiliary identification, the percentage content of CD4-CD8+CD3+ mononuclear T cells in the blood routine of the screened pig includes at least one of the following:
[0035] (1) The percentage of CD4-CD8+CD3+monocyte T cells in the blood of pigs with a genotype of GG at the SNP site is greater than the percentage of CD4-CD8+CD3+monocyte T cells in the blood of pigs with a genotype of AA or AG at the SNP site.
[0036] (2) The percentage of CD4-CD8+CD3+monocyte T cells in the blood of pigs with AG genotype at the SNP site is greater than the percentage of CD4-CD8+CD3+monocyte T cells in the blood of pigs with AA genotype at the SNP site.
[0037] The present invention can be used for breeding pigs with strong immunity in pig breeding. Gene fragments are amplified by PCR, and the deoxyribonucleotide type at position 40842218 of chromosome 7 is sequenced to detect the genotype of the SNP site in the pig genome to be tested. Pigs with a genotype of GG at the SNP site of the pig genome are selected as parents for breeding to obtain piglets with stronger immunity or a higher percentage of CD4-CD8+CD3+monocyte T cells in blood routine.
[0038] The present invention provides a primer composition for detecting the polymorphism or genotype of the SNP site at position 40842218 of chromosome 7 in the pig genome, and also provides a kit including the primer composition. The primer composition can be used for:
[0039] (1) Products for identifying or assisting in the identification of the percentage content of CD4 - CD8+CD3+ mononuclear T cells in porcine blood routine;
[0040] (2) Products for improving porcine immune traits;
[0041] (3) Products for porcine breeding.
[0042] The present invention solves the problem of improving porcine immunity by means of molecular breeding. By preferentially selecting the advantageous alleles of the above SNPs, the frequency of advantageous alleles can be increased generation by generation, the percentage content of conventional CD4 - CD8+CD3+ mononuclear T cells in pigs can be increased, the genetic improvement and breeding of pigs can be accelerated, and the economic benefits of pig farms can be improved. Detailed implementation manners
[0043] The present invention will be further described in detail below in conjunction with the specific implementation manners. The examples given are only for clarifying the present invention, rather than limiting the scope of the present invention. The following examples can be used as a guide for those of ordinary skill in the art to make further improvements, and do not limit the present invention in any way.
[0044] The experimental methods in the examples are all conventional methods unless otherwise specified, and are carried out according to the techniques or conditions described in the literature in this field or according to the product instructions. The materials, reagents, etc. used in the examples can be obtained from commercial sources unless otherwise specified.
[0045] All animals in the examples are from the experimental base pig farm of this research laboratory. The F2 generation individuals of the Damin hybrid pigs obtained by crossing Large White pigs and Min pigs are used as experimental samples in the examples. The F2 generation individuals are the first-generation hybrid population obtained by crossing Large White boars and Min sows, and the second-generation offspring obtained by self-crossing the first-generation hybrid population.
[0046] The percentage content of CD4 - CD8+CD3+ mononuclear T cells in porcine blood routine in the examples is the percentage content of CD4 - CD8+CD3+ mononuclear T cells in porcine blood routine at 240 days of age of pigs.
[0047] In order to establish a method for assisting in the identification of the percentage content of CD4 - CD8+CD3+ mononuclear T cells in porcine blood routine, the following experiments were carried out.
[0048] I. Screening of the SNP locus at position 40842218 of G / A on porcine chromosome 7
[0049] Ear tissue samples were collected from 30 Damin hybrid pigs respectively, and genomic DNA was extracted. Using
[0050] Forward primer: 5’-TGCTTTACTTCTGCCTTAGAGCAAT-3’
[0051] Downstream primer: 5’-TCCTCCTCTTGCCAACCCAC-3’;
[0052] As an amplification primer, the genomic DNA of the pig to be tested was used as the template DNA for PCR amplification to obtain a PCR product, which was then sequenced. Alignment was performed using Seqman software to obtain a polymorphic site, named the (G\A) site, located at nucleotide position 40842218 on chromosome 7 of the pig. The nucleotide types at the (G\A) site are G or A, and the genotypes are GG, AA, or AG. The GG genotype is a homozygote with the nucleotide at the (G\A) site being G. The AA genotype is a homozygote with the nucleotide at the (G\A) site being A. The AG genotype is a heterozygote with the nucleotides at the (G\A) site being G and A.
[0053] II. Correlation analysis between the (G\A) site at nucleotide position 40842218 on chromosome 7 of the pig and the percentage content of CD4-CD8+CD3+ mononuclear T cells in pig blood routine
[0054] To determine whether the G / A site at nucleotide position 40842218 on chromosome 7 of the pig is correlated with the percentage content of CD4-CD8+CD3+ mononuclear T cells in pig blood routine, 489 individuals of the F2 generation of Damin pigs were used as experimental materials. According to the above experimental method, the upstream and downstream primers were used to amplify the pig genome and then sequenced to determine whether the (G\A) site of each individual was of the GG genotype, AA genotype, or AG genotype. The percentage content of CD4-CD8+CD3+ mononuclear T cells in the blood routine of each individual was measured, and correlation analysis was performed.
[0055] 1. Genotype
[0056] The GG genotype is a homozygote with the nucleotide at position 40842218 on chromosome 7 of the pig being G;
[0057] The AA genotype is a homozygote with the nucleotide at position 40842218 on chromosome 7 of the pig being A;
[0058] The AG genotype is a heterozygote with the nucleotides at position 40842218 on chromosome 7 of the pig being A and G.
[0059] Containing the nucleotide sequence at position 40842218 on chromosome 7 of the pig is
[0060]
[0061] This SNP site is named the (G\A) site. The nucleotide types at the (G\A) site can be G or A, and the genotypes can be GG, AA, or AG. The GG genotype is a homozygote with the nucleotide at the (G\A) site being G. The AA genotype is a homozygote with the nucleotide at the (G\A) site being A. The AG genotype is a heterozygote with the nucleotides at the (G\A) site being G and A.
[0062] The genotyping results of the (G / A) locus for 489 experimental pigs showed that: 157 pigs had the GG genotype, 79 pigs had the AA genotype, and 253 pigs had the AG genotype. The genotypic frequencies and allele frequencies of the pig (G / A) locus in the tested pig population are shown in Table 1:
[0063] Table 1. Genotypic Frequencies and Allele Frequencies of the Pig (G / A) Locus in the Tested Pig Population
[0064]
[0065] As can be seen from Table 1, the genotypic frequency of the AG heterozygous type was significantly higher than that of the GG homozygous type and the AA homozygous type, and the G allele was the dominant allele.
[0066] 2. Association Analysis between Pig Genotype and the Percentage of CD4 - CD8+CD3+ Mononuclear T Cells in Pig Blood Routine
[0067] Collect pig anticoagulated blood, use the three - color fluorescence antibody staining method, separate and identify cell subsets by flow cytometry, and calculate the percentage of CD4 - CD8+CD3+ mononuclear T cells. The measured data are shown in Table 2.
[0068] Table 2: Genotypes of the (G / A) Locus and the Percentage of CD4 - CD8+CD3+ Mononuclear T Cells in Pig Blood Routine for 489 F2 Generation Individuals of Crossbred Large White Pigs and Min Pigs
[0069]
[0070]
[0071] The SAS software was used for the association analysis between genotype and phenotype, and Duncan's multiple test was used for significance testing (P < 0.05). The data were expressed as mean ± standard error, and P < 0.05 was determined as significantly different. The results are shown in Table 3. The SNP (G / A) locus had a significant effect on the percentage of CD4 - CD8+CD3+ mononuclear T cells in pig blood routine. The percentage of CD4 - CD8+CD3+ mononuclear T cells in pigs with the GG genotype was significantly greater than that in pigs with the AG genotype, and the percentage of CD4 - CD8+CD3+ mononuclear T cells in pigs with the AG genotype was greater than that in pigs with the AA genotype. Therefore, in actual pig breeding, pigs with the GG genotype have stronger immunity.
[0072] Table 3. Single - Nucleotide Polymorphism at Position 40842218 on Chromosome 7 of Pigs and the Percentage of CD4 - CD8+CD3+ Mononuclear T Cells in Pig Blood Routine
[0073]
[0074] Note: In the table, different lowercase letters indicate significant differences (P<0.05), and the same letters indicate no significant differences (P>0.05). The values are presented as mean ± standard error.
[0075] In summary, by determining the genotype of the (G / A) locus at position 40842218 on porcine chromosome 7, we can assist in identifying the percentage content of CD4-CD8+CD3+ mononuclear T cells in porcine blood routine: the percentage content of CD4-CD8+CD3+ mononuclear T cells in pigs with the GG genotype is greater than that in pigs with the AG genotype or AA genotype, and the percentage content of CD4-CD8+CD3+ mononuclear T cells in pigs with the AG genotype is greater than that in pigs with the AA genotype.
[0076] III. A method for assisting in identifying the percentage content of CD4-CD8+CD3+ mononuclear T cells in porcine blood routine
[0077] Collect ear tissue samples from the pigs to be tested and extract genomic DNA. Using the genomic DNA of the pigs to be tested as a template, perform PCR amplification with the upstream primer: 5’-TGCTTTACTTCTGCCTTAGAGCAAT-3’ and the downstream primer: 5’-TCCTCCTCTTGCCAACCCAC-3’ to obtain a PCR product, and sequence the PCR product to obtain the genotype of the SNP (G / A) locus of the pigs to be tested.
[0078] The percentage content of CD4-CD8+CD3+ mononuclear T cells in pigs to be tested with the GG genotype is greater than or assist in being greater than that in pigs to be tested with the AG or AA genotype. The percentage content of CD4-CD8+CD3+ mononuclear T cells in pigs to be tested with the AG genotype is greater than or assist in being greater than that in pigs to be tested with the AA genotype.
[0079] IV. The present invention provides an SNP molecular marker that can effectively increase the percentage content of CD4-CD8+CD3+ mononuclear T cells in porcine blood routine. Using this SNP molecular marker for marker-assisted selection can accelerate the breeding process of related excellent traits. If all individuals with the AG genotype and AA genotype in pigs are selected and bred into GG-type individuals, the percentage content of CD4-CD8+CD3+ mononuclear T cells in pigs will be increased. In the SNP molecular marker individuals, through the dominant allele GG of this SNP in the pig population, the self-immunity of pigs can be improved, thereby increasing the enterprise's income.
[0080] The above embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications made without departing from the spirit and principle of the present invention shall be regarded as equivalent replacement methods and are all included in the protection scope of the present invention.
Claims
1. Use of a reagent for detecting SNP loci related to the strength of the porcine immune system in identifying the percentage content of CD4 - CD8+CD3+ mononuclear T cells in porcine blood routine, characterized in that: The SNP locus corresponds to position 40842218 bp on chromosome 7 of the international porcine reference genome version 11.1 and is located within the CLIC5 gene; the polymorphism of the bases at this locus affects the percentage content of CD4 - CD8+CD3+ mononuclear T cells in porcine blood routine; The percentage content of CD4 - CD8+CD3+ mononuclear T cells in the blood routine of pigs with the GG genotype at the SNP locus is higher than that of pigs with the AG genotype and the AA genotype; The percentage content of CD4 - CD8+CD3+ mononuclear T cells in the blood routine of pigs with the AG genotype at the SNP locus is higher than that of pigs with the AA genotype.
2. Use of a reagent for detecting SNP loci related to the strength of the porcine immune system in screening pigs with high percentage content of CD4 - CD8+CD3+ mononuclear T cells in blood routine, characterized in that: The SNP locus corresponds to position 40842218 bp on chromosome 7 of the international porcine reference genome version 11.1 and is located within the CLIC5 gene; the polymorphism of the bases at this locus affects the percentage content of CD4 - CD8+CD3+ mononuclear T cells in porcine blood routine; The percentage content of CD4 - CD8+CD3+ mononuclear T cells in the blood routine of pigs with the GG genotype at the SNP locus is higher than that of pigs with the AG genotype and the AA genotype; The percentage content of CD4 - CD8+CD3+ mononuclear T cells in the blood routine of pigs with the AG genotype at the SNP locus is higher than that of pigs with the AA genotype.
3. Use of a reagent for detecting SNP loci related to the strength of the porcine immune system in improving the genetic breeding of the percentage content of CD4 - CD8+CD3+ mononuclear T cells in porcine blood routine, characterized in that: The SNP locus corresponds to position 40842218 bp on chromosome 7 of the international porcine reference genome version 11.1 and is located within the CLIC5 gene; the polymorphism of the bases at this locus affects the percentage content of CD4 - CD8+CD3+ mononuclear T cells in porcine blood routine; The percentage content of CD4 - CD8+CD3+ mononuclear T cells in the blood routine of pigs with the GG genotype at the SNP locus is higher than that of pigs with the AG genotype and the AA genotype; The percentage content of CD4 - CD8+CD3+ mononuclear T cells in the blood routine of pigs with the AG genotype at the SNP locus is higher than that of pigs with the AA genotype.
4. Use of a reagent for detecting SNP molecular markers related to the strength of the porcine immune system in identifying the trait of the percentage content of CD4 - CD8+CD3+ mononuclear T cells in porcine blood routine, characterized in that: The nucleotide sequence of the SNP molecular marker is TGCTTTACTTCTGCCTTAGAGCAATAGATTATTCTCTGTGTGCTCTCCCACATGTGTCCTGTGCTTCTAACAATAAACTTTGTACCTCTTTTTTACTGCCTTTGCTCCTTGAAACATGCTTGCTTTCAACAGAGGCCAAGAATCGGGGCAATTCTACTTCTAGCCTCTAGCTGGTCTAGTGGCTTGGACTCCTGGCTTTCATCCAGGCTGTCCAGGTTCAATTCCTGAGCAGAGAGTTAAGATCCCCTTCAAGACATCACGCACTGCTGCCTCTCCAAAATCAGGCTGTATCGATTCTACT(G\A)CATGAGACGTTTTGGTTTCTGTTTCCAAACTACTGGGAAATGCTGGGTTAAATAAGGTTCAAGGTTGCTTGATGGAGTTTCCTGCCCTTTTATAGGCTAATATGCACGTGGGTTGGCAAGAGGAGGA The SNP locus related to the strength of the porcine immune system is named the (G\A) locus. The nucleotide type of the (G\A) locus can be G or A, and the genotypes can be GG, AG or AA; the percentage content of CD4-CD8+CD3+ mononuclear T cells in the blood routine of pigs with the GG genotype is higher than that of pigs with the AG genotype and pigs with the AA genotype; the percentage content of CD4-CD8+CD3+ mononuclear T cells in the blood routine of pigs with the AG genotype is higher than that of pigs with the AA genotype.
5. Use of a reagent for detecting SNP molecular markers related to the strength of the porcine immune system in screening pigs with a high percentage content of CD4-CD8+CD3+ mononuclear T cells in the blood routine, characterized in that: The nucleotide sequence of the said SNP molecular marker is TGCTTTACTTCTGCCTTAGAGCAATAGATTATTCTCTGTGTGCTCTCCCACATGTGTCCTGTGCTTCTAACAATAAACTTTGTACCTCTTTTTTACTGCCTTTGCTCCTTGAAACATGCTTGCTTTCAACAGAGGCCAAGAATCGGGGCAATTCTACTTCTAGCCTCTAGCTGGTCTAGTGGCTTGGACTCCTGGCTTTCATCCAGGCTGTCCAGGTTCAATTCCTGAGCAGAGAGTTAAGATCCCCTTCAAGACATCACGCACTGCTGCCTCTCCAAAATCAGGCTGTATCGATTCTACT(G\A)CATGAGACGTTTTGGTTTCTGTTTCCAAACTACTGGGAAATGCTGGGTTAAATAAGGTTCAAGGTTGCTTGATGGAGTTTCCTGCCCTTTTATAGGCTAATATGCACGTGGGTTGGCAAGAGGAGGA The SNP locus related to the strength of the porcine immune system is named the (G\A) locus. The nucleotide type of the (G\A) locus can be G or A, and the genotypes can be GG, AG or AA; the percentage content of CD4 - CD8+CD3+ mononuclear T cells in the blood routine of pigs with the GG genotype is higher than that of pigs with the AG genotype and pigs with the AA genotype; the percentage content of CD4 - CD8+CD3+ mononuclear T cells in the blood routine of pigs with the AG genotype is higher than that of pigs with the AA genotype.
6. Application of a reagent for detecting SNP molecular markers related to the strength of the porcine immune system in improving the genetic breeding of the percentage content trait of CD4 - CD8+CD3+ mononuclear T cells in the blood routine of pigs, characterized in that: The nucleotide sequence of the SNP molecular marker described is TGCTTTACTTCTGCCTTAGAGCAATAGATTATTCTCTGTGTGCTCTCCCACATGTGTCCTGTGCTTCTAACAATAAACTTTGTACCTCTTTTTTACTGCCTTTGCTCCTTGAAACATGCTTGCTTTCAACAGAGGCCAAGAATCGGGGCAATTCTACTTCTAGCCTCTAGCTGGTCTAGTGGCTTGGACTCCTGGCTTTCATCCAGGCTGTCCAGGTTCAATTCCTGAGCAGAGAGTTAAGATCCCCTTCAAGACATCACGCACTGCTGCCTCTCCAAAATCAGGCTGTATCGATTCTACT(G\A)CATGAGACGTTTTGGTTTCTGTTTCCAAACTACTGGGAAATGCTGGGTTAAATAAGGTTCAAGGTTGCTTGATGGAGTTTCCTGCCCTTTTATAGGCTAATATGCACGTGGGTTGGCAAGAGGAGGA The SNP locus related to the strength of the porcine immune system is named the (G\A) locus. The nucleotide type of the (G\A) locus can be G or A, and the genotypes can be GG, AG or AA; the percentage content of CD4-CD8+CD3+ mononuclear T cells in the blood routine of pigs with the GG genotype is higher than that of pigs with the AG genotype and pigs with the AA genotype; the percentage content of CD4-CD8+CD3+ mononuclear T cells in the blood routine of pigs with the AG genotype is higher than that of pigs with the AA genotype.
7. A method for identifying the percentage content ratio of CD4-CD8+CD3+ mononuclear T cells in porcine blood routine, characterized in that, It includes the following steps: detecting the SNP locus of pigs located at 40,842,218 bp on chromosome 7 of the international porcine reference genome version 11.1 and within the CLIC5 gene; identifying whether the single nucleotide of the said SNP locus is A or G; determining the genotype of the tested pigs; analyzing and judging that the percentage content of CD4-CD8+CD3+ mononuclear T cells in the blood routine of pigs with the GG genotype at the said SNP locus is higher than that of pigs with the AG genotype and pigs with the AA genotype; the percentage content of CD4-CD8+CD3+ mononuclear T cells in the blood routine of pigs with the AG genotype is higher than that of pigs with the AA genotype.
8. Use of a primer composition for identifying SNP sites related to the strength of the porcine immune system in identifying the trait of the percentage content of CD4-CD8+CD3+ mononuclear T cells in the blood routine of pigs, characterized in that, The said primer composition includes an upstream primer and a downstream primer, and their nucleotide sequences are as follows: Upstream primer: 5’-TGCTTTACTTCTGCCTTAGAGCAAT-3’; Downstream primer: 5’-TCCTCCTCTTGCCAACCCAC-3’; The described SNP locus corresponds to the 40,842,218 bp position on chromosome 7 of the international pig reference genome version 11.1, and is located within the CLIC5 gene. The percentage of CD4-CD8+CD3+ mononuclear T cells in the blood routine of pigs with the GG genotype at this SNP locus is higher than that of pigs with the AG genotype and the AA genotype; the percentage of CD4-CD8+CD3+ mononuclear T cells in the blood routine of pigs with the AG genotype is higher than that of pigs with the AA genotype.
9. Use of a primer composition for identifying SNP loci related to the strength of the porcine immune system in screening pigs with a trait of a high percentage of CD4 - CD8+CD3+ mononuclear T cells in blood routine, characterized in that, The described primer composition includes a forward primer and a reverse primer, and their nucleotide sequences are as follows: Forward primer: 5’-TGCTTTACTTCTGCCTTAGAGCAAT-3’; Reverse primer: 5’-TCCTCCTCTTGCCAACCCAC-3’; The described SNP locus corresponds to the 40,842,218 bp position on chromosome 7 of the international pig reference genome version 11.1, and is located within the CLIC5 gene. The percentage of CD4-CD8+CD3+ mononuclear T cells in the blood routine of pigs with the GG genotype at this SNP locus is higher than that of pigs with the AG genotype and the AA genotype; the percentage of CD4-CD8+CD3+ mononuclear T cells in the blood routine of pigs with the AG genotype is higher than that of pigs with the AA genotype.
10. Use of a primer composition for identifying SNP loci related to the strength of the pig immune system in improving genetic assisted breeding of the trait of the percentage content of CD4-CD8+CD3+ mononuclear T cells in the blood routine of pigs, characterized in that The described primer composition includes a forward primer and a reverse primer, and their nucleotide sequences are as follows: Forward primer: 5’-TGCTTTACTTCTGCCTTAGAGCAAT-3’; Reverse primer: 5’-TCCTCCTCTTGCCAACCCAC-3’; The described SNP locus corresponds to the 40,842,218 bp position on chromosome 7 of the international pig reference genome version 11.1, and is located within the CLIC5 gene. The percentage of CD4-CD8+CD3+ mononuclear T cells in the blood routine of pigs with the GG genotype at this SNP locus is higher than that of pigs with the AG genotype and the AA genotype; the percentage of CD4-CD8+CD3+ mononuclear T cells in the blood routine of pigs with the AG genotype is higher than that of pigs with the AA genotype.