Penaeus vannamei Raptor gene SNP molecular marker and application thereof

Abstract

The invention discloses a penaeus vannamei Raptor gene SNP (Single Nucleotide Polymorphism) molecular marker, which comprises a molecular marker D.11926, a molecular marker D.11999, a molecular marker D.12025, a molecular marker D.12026, a molecular marker D.12039, a molecular marker D.12044, a molecular marker D.12063, a molecular marker D.12195, a molecular marker D.12212, a molecular marker D.12241 and a molecular marker D.12349, and the nucleotide sequences are sequentially located at the 69th site, the 142 site, the 168th site, the 169th site, the 182nd site, the 187th site, the 206th site, the 338th site, the 355th site, the 384th site and the 492th site of the nucleotide sequence shown in the sequence 1 of the sequence table. When the molecular marker is used as a functional marker of the nitrite-resistant character of the penaeus vannamei and is applied to breeding of the penaeus vannamei, a penaeus vannamei strain with good nitrite-resistant character can be cultivated.

Description

Technical Field

[0001] The invention belongs to the technical field of whiteleg shrimp breeding, and particularly relates to a whiteleg shrimp Raptor gene SNP molecular marker and application thereof. Background Art

[0002] Litopenaeus vannamei, also known as Penaeus vannamei, stands out in shrimp farming due to its excellent environmental adaptability and tolerance. It is one of the three best varieties with the highest aquaculture output in the world. With the continuous improvement of shrimp farming level and the continuous increase of aquaculture density, the amount of feed input is large, the aquaculture metabolites accumulate, the water exchange volume is small, and the environmental load is large, resulting in frequent fluctuations in water quality factors and poor stability of the aquaculture environment, which affects the ecological aquaculture of Penaeus vannamei. In addition, due to the high protein content of the feed fed to Penaeus vannamei, ammonia nitrogen or organic matter such as residual bait and feces in the shrimp aquaculture water body is degraded and converted into nitrites. The nitrite content in the aquaculture water body increases, and the toxicity of the water body increases, causing certain troubles for the ecological aquaculture of Penaeus vannamei.

[0003] Mammalian target of rapamycin (mTOR) is a serine / threonine protein kinase. mTOR is involved in regulating the growth and homeostasis of organisms and is a key component of the signaling pathway that integrates nutrient utilization, energy status, cellular stressors, and growth factors. mTOR binds to different proteins to form two multi-protein complexes that are very different in structure and function. mTORCl and mTORC2 have obvious differences in upstream pathways, downstream targets, and functions. The reason for the different structures and functions of the two mTORCs is that mTORCl binds to the regulatory-associated protein of rapamycin target protein (Raptor), which plays a key role in the activation of the mTORC1 signaling pathway; while mTORC2 binds to the rapamycin-insensitive component (Rictor). mTORCl can respond to the stimulation of growth factors, amino acids, energy, pressure, oxygen, etc., promote the synthesis of a series of biological molecules such as proteins, lipids and nucleotides, and can also inhibit autophagy, promote anabolism while inhibiting catabolism, and it affects various biological processes of cells. Raptor is a member of the mTORCl protein complex, which is crucial to the entire mTORC l signaling pathway. Raptor directly binds to the mTOR protein and plays a scaffolding role in the mTORCl protein complex. Raptor presents the effector protein downstream of the mTORCl pathway to the catalytic subunit of the mTOR protein, promotes the activity of the mTORCl pathway, and at the same time, Raptor can sense upstream signals and regulate the mTOR signaling pathway. The role of Raptor protein in the mTOR signaling pathway is very important, which involves the transmission of many energy signals in the mTOR pathway.

[0004] The present invention performs nitrite-resistance-associated SNPs marker screening on the nucleotide sequence of the protein Raptor gene, which plays a key role in the activation process of mTORCl binding to rapamycin targeted protein, in order to provide technical support for breeding Litopenaeus vannamei varieties with nitrite-resistance traits, carry out stress-resistant breeding of Litopenaeus vannamei, cultivate and promote new nitrite-resistant varieties, and provide stress-resistant germplasm for Litopenaeus vannamei farming. Summary of the invention

[0005] The purpose of the present invention is to provide a SNP molecular marker of the Raptor gene of whiteleg shrimp, use them as functional markers of the nitrite-nitrogen resistance trait of whiteleg shrimp, and apply them in the breeding of whiteleg shrimp to cultivate whiteleg shrimp strains with good nitrite-nitrogen resistance traits.

[0006] The present invention is achieved by adopting the following technical solutions: A SNP molecular marker of the Raptor gene of white shrimp Penaeus vannamei, comprising molecular marker D.11926 (A>G), molecular marker D.11999 (T>C), molecular marker D.12025 (A>G), molecular marker D.12026 (A>G), molecular marker D.12039 (A>T), molecular marker D.12044 (C>T), molecular marker D.12063 (A>T), molecular marker D.1 2195 (T>G), molecular marker D.12212 (T>A), molecular marker D.12241 (G>A), molecular marker D.12349 (T>C), and are located respectively at the 69th, 142nd, 168th, 169th, 182nd, 187th, 206th, 338th, 355th, 384th, and 492nd bases of the nucleotide sequence shown in Sequence 1 of the sequence listing.

[0007] The polymorphic forms of the molecular marker D.11926, molecular marker D.11999, molecular marker D.12025, molecular marker D.12026, molecular marker D.12039, molecular marker D.12044, molecular marker D.12063, molecular marker D.12195, molecular marker D.12212, molecular marker D.12241, and molecular marker D.12349 are A / G, C / T, A / G, A / C, A / T, C / T, A / T, G / T, A / T, A / G, and C / T, respectively.

[0008] The genotypes of the molecular marker D.11926 include AA genotype, AG genotype and GG genotype; The genotypes of the molecular marker D.11999 include CC genotype, CT genotype and TT genotype; The genotypes of the molecular marker D.12025 include AA genotype, AG genotype and GG genotype; The genotypes of the molecular marker D.12026 include AA genotype, AC genotype and CC genotype; The genotypes of the molecular marker D.12039 include AA genotype, AT genotype and TT genotype; The genotype of the molecular marker D.12044 includes CC genotype and CT genotype; The genotypes of the molecular marker D.12063 include AA genotype, AT genotype and TT genotype; The genotype of the molecular marker D.12195 includes GT genotype and TT genotype; The genotypes of the molecular marker D.12212 include AA genotype, AT genotype and TT genotype; The genotypes of the molecular marker D.12241 include AA genotype, AG genotype and GG genotype; The genotypes of the molecular marker D.12349 include CC genotype, CT genotype and TT genotype.

[0009] The application of the SNP molecular marker of the Raptor gene of the white shrimp is used for the breeding of white shrimp resistant to nitrite nitrogen. Specifically, the genomic DNA of the muscle tissue of the white shrimp to be tested is first extracted, and the obtained genomic DNA is used as a template for PCR amplification and purification of the PCR amplification product, and then the obtained PCR amplification product is sequenced to determine the genotypes of the molecular marker D.11926, molecular marker D.11999, molecular marker D.12025, molecular marker D.12026, molecular marker D.12039, molecular marker D.12044, molecular marker D.12063, molecular marker D.12195, molecular marker D.12212, molecular marker D.12241, and molecular marker D.12349; When the genotype of the molecular marker D.11926 is the dominant genotype of AA genotype, the individual is selected as a reserve parent for breeding of whiteleg shrimp varieties; When the genotype of the molecular marker D.11999 is the dominant genotype of TT, the individual is selected as a reserve parent for breeding of whiteleg shrimp varieties; When the genotype of the molecular marker D.12025 is the dominant genotype of AA genotype, the individual is selected as a reserve parent for breeding of whiteleg shrimp varieties; When the genotype of the molecular marker D.12026 is the dominant genotype of AA genotype, the individual is selected as a reserve parent for breeding of whiteleg shrimp varieties; When the genotype of the molecular marker D.12039 is the dominant genotype of AA genotype, the individual is selected as a reserve parent for breeding of whiteleg shrimp varieties; When the genotype of the molecular marker D.12044 is the dominant genotype CC genotype, the individual is selected as a reserve parent for whiteleg shrimp variety breeding; When the genotype of the molecular marker D.12063 is the dominant genotype of AA genotype, the individual is selected as a reserve parent for breeding of whiteleg shrimp varieties; When the genotype of the molecular marker D.12195 is the dominant genotype of TT, the individual is selected as a reserve parent for breeding of whiteleg shrimp varieties; When the genotype of the molecular marker D.12212 is the dominant genotype of AA genotype or AT genotype, the individual is selected as a reserve parent for breeding of whiteleg shrimp varieties; When the genotype of the molecular marker D.12241 is the dominant genotype of GG, the individual is selected as a reserve parent for breeding of whiteleg shrimp varieties; When the genotype of the molecular marker D.12349 is the dominant genotype of TT, the individual is selected as a reserve parent for breeding of whiteleg shrimp varieties.

[0010] The invention improves the ability of white shrimp to resist nitrite nitrogen by detecting the genotypes at the SNP marker sites of the individual Raptor genes in a population, retaining individuals with favorable genotypes, and eliminating individuals with unfavorable genotypes.

[0011] Furthermore, during the PCR amplification process, the primers used to detect the SNP molecular marker of the Raptor gene of the white shrimp include primer F1, primer R1, and primer R2; The nucleotide sequence of the primer F1 is: TCTGGAGAGGTGAGGTTATGG (as shown in sequence 2 in the sequence list); The nucleotide sequence of the primer R1 is: GCATCCCTGGTATATTTGTTCTCA (as shown in sequence 3 in the sequence list); The nucleotide sequence of the primer R2 is: CATAGACTGTGATGTAACTGTCAG (as shown in sequence 4 in the sequence listing).

[0012] Furthermore, the PCR amplification process is a nested PCR amplification, in which two PCR amplifications are performed, and the amplification system of the first PCR includes 5 μL of 2×Es Taq MasterMix, 0.2 μL of a template with a concentration of 100 ng / μL, 0.4 μL of a primer F1 with a concentration of 10 μmol / L, 0.4 μL of a primer R1 with a concentration of 10 μmol / L, and 4 μL of ddH 2 The amplification system of the second PCR included 25 μL of 2×Es Taq MasterMix, 1 μL of the product of the first PCR amplification diluted 100 times, 2 μL of primer F1 with a concentration of 10 μmol / L, 2 μL of primer R2 with a concentration of 10 μmol / L, and 20 μL of ddH 2 O.

[0013] Furthermore, the amplification program of the first PCR amplification is: S101: pre-denaturation at 94°C for 5 min; S102: denaturation at 94°C for 30 s, annealing at 62°C for 30 s, and extension at 72°C for 30 s, for a total of 35 amplification cycles; S103: post-extension at 72°C for 7 min; The amplification procedure of the second PCR is: S201: pre-denaturation at 94°C for 3 min; S202: denaturation at 94°C for 30 s, annealing at 62°C for 30 s, and extension at 72°C for 30 s, for a total of 35 cycles; S203: Post-extension at 72°C for 7 min.

[0014] Compared with the prior art, this technical solution has the following beneficial effects: 1. The present invention provides a Raptor gene SNP molecular marker associated with the nitrite-nitrogen resistance trait of white shrimp. Among the 11 SNP sites, 3 SNP sites have extremely significant correlation with the nitrite-nitrogen resistance trait of white shrimp, and 8 SNP sites are significantly correlated with the nitrite-nitrogen resistance trait of white shrimp. Four of the SNP sites can be selected as TaggerSNPs.

[0015] 2. The Raptor gene SNP molecular marker provided by the present invention is applied to the breeding of nitrite-resistant whiteleg shrimp. It is not affected by age and gender, and there is no need to conduct large-scale nitrite stress experiments to accurately screen and obtain nitrite-resistant individuals as reserve parents for step-by-step cultivation, thereby realizing molecular-assisted breeding of nitrite-resistant whiteleg shrimp, significantly improving breeding efficiency and accuracy and promoting breeding progress, and providing a good foundation for research on nitrite-resistant whiteleg shrimp variety improvement. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 It is a partial fragment sequence of the product obtained by amplifying the Raptor gene in the embodiment, a represents the 64th to 74th positions, wherein the AA, AG, and GG peak graphs of the D.11926 (A>G) site are shown; b represents the 137th to 147th positions, wherein the CC, CT, and TT peak graphs of the D.11999 (T>C) site are shown; c represents the 163rd to 173rd positions, wherein the AA, AG, and GG peak graphs of the D.12025 (A>G) site and the AA, AC, and CC peak graphs of the D.12026 (A>G) site are shown; d represents the 177th to 187th positions, wherein the AA, AT, and TT peak graphs of the D.12039 (A>T) site are shown.

[0017] Figure 2It is a partial fragment sequence of the product obtained by amplifying the Raptor gene in the embodiment, e represents the 182nd to 192nd positions, wherein the CC and CT peak diagrams of the D.12044 (C>T) site are displayed; f represents the 201st to 211th positions, wherein the AA, AT, and TT peak diagrams of the D.12063 (A>T) site are displayed; g represents the 333rd to 343rd positions, wherein the GT and TT peak diagrams of the D.12195 (T>G) site are displayed; h represents the 350th to 360th positions, wherein the AA, AT, and TT peak diagrams of the D.12212 (T>A) site are displayed.

[0018] Figure 3 It is a partial fragment sequence of the product obtained by amplifying the Raptor gene in the embodiment, i represents the 379th to 389th positions, wherein the AA, AG, and GG peak graphs of the D.12241 (G>A) site are displayed; j represents the 487th to 497th positions, wherein the CC, CT, and TT peak graphs of the D.12349 (T>C) site are displayed.

[0019] Figure 4 It is a linkage analysis map of 11 SNP sites of the Raptor gene of Penaeus vannamei in the Example. DETAILED DESCRIPTION

[0020] The present invention is further described by the following examples, but is not intended to be limiting of the present invention. Specific experimental conditions and methods not specified in the following examples are conventional methods commonly known to those skilled in the art.

[0021] Embodiment: The screening process of the SNP molecular marker of the Raptor gene of the white shrimp of the present invention is as follows: (1) Take several 1000L plastic drums, fill them with 500L of aquaculture water, then add analytically pure sodium nitrite and stir evenly to make the concentration of sodium nitrite in the aquaculture water 757.18mg / L; select 240 whiteleg shrimps weighing about 10g and temporarily culture them for 3 days, then put 30 whiteleg shrimps in each plastic drum for nitrite nitrogen stress experiment. During the whole experiment, the water was kept aerated, the pH value was kept at 8.2±0.3, the temperature was kept at 27±0.5℃, the salinity was kept at 30.0‰, and the dissolved The deoxygenation was maintained at 7-8 mg / L. No feed was given during the experiment to maintain the experimental concentration of nitrite. The water was replaced every 24 hours during the experiment, and the concentration of sodium nitrite was readjusted to 757.18 mg / L. When the white shrimp turned over and did not swim away quickly or had no obvious reaction when touched with a wooden stick, and still turned over, it was considered dead. The dead individuals were recorded after 3 hours of stress, and 51 white shrimp that died 3-12 hours and 56 that survived after 96 hours were selected as samples of the nitrite-sensitive group and nitrite-tolerant group respectively. (2) All samples obtained in step (1) were respectively subjected to the ammonium acetate / isopropanol method to extract total DNA from the muscle tissue of Penaeus vannamei. The quality and integrity of the extracted DNA were detected by ultra-micro UV spectrophotometer and agarose gel electrophoresis. The obtained total DNA was stored at -20 °C for future use. (3) Specific primers were designed based on the nucleotide sequence of a partial DNA fragment of the Raptor gene of Penaeus vannamei, and the following primers were obtained: Primer F1, the sequence of which is: TCTGGAGAGGTGAGGTTATGG; Primer R1, the sequence of which is: GCATCCCTGGTATATTTGTTCTCA; Primer R2, the sequence of which is: CATAGACTGTGATGTAACTGTCAG; (4) The total DNA obtained in step (2) was used as a template, and the primers obtained in step (3) were used to perform nested PCR amplification of the target fragment. In the specific PCR amplification process, two PCR amplifications were performed. The amplification system of the first PCR included 5 μL of 2×Es Taq MasteMix, 0.2 μL of a template with a concentration of 100 ng / μL, 0.4 μL of a primer F1 with a concentration of 10 μmol / L, 0.4 μL of a primer R1 with a concentration of 10 μmol / L, and 4 μL of ddH 2 O; The amplification program of the first PCR amplification is: S101: pre-denaturation at 94°C for 5 min; S102: denaturation at 94°C for 30 s, annealing at 62°C for 30 s, and extension at 72°C for 30 s, for a total of 35 amplification cycles; S103: post-extension at 72°C for 7 min; The amplification system of the second PCR included 25 μL of 2×Es Taq MasterMix, 1 μL of the product of the first PCR amplification diluted 100 times, 2 μL of primer F1 with a concentration of 10 μmol / L, 2 μL of primer R2 with a concentration of 10 μmol / L, and 20 μL of ddH 2 O; The amplification procedure of the second PCR is: S201: pre-denaturation at 94°C for 3 min; S202: denaturation at 94°C for 30 s, annealing at 62°C for 30 s, and extension at 72°C for 30 s, for a total of 35 cycles; S203: post-extension at 72°C for 7 min; (5) The PCR amplification product obtained in step (4) was purified and sequenced after 1% agarose gel electrophoresis, and the sequencing results were compared and analyzed using DNAstar software, including nucleotide sequence comparison and peak analysis, to screen out related SNPs sites; See also Figure 1 to Figure 3 , the nucleotide sequence of the PCR amplification product of one of the samples is shown in Sequence 1 of the sequence table: the 69th position is D.11926 (A>G), the 142nd position is D.11999 (T>C), the 168th position is D.12025 (A>G), the 169th position is recorded as D.12026 (A>G), the 182nd position is D.12039 (A>T), the 187th position is D.12044 (C>T), the 206th position is D.12063 (A>T), the 338th position is D.12195 (T>G), the 355th position is D.12212 (T>A), the 384th position is D.12241 (G>A), and the 492nd position is D.12349 (T>C); (6) Based on the selected SNPs, the white shrimp in the sensitive group and the tolerant group were tested and genotyped according to the above method. The samples of different SNPs in the sensitive group and the tolerant group were counted, and the genotype frequency and allele frequency were calculated. The chi-square analysis was used for independence test. The specific results are shown in Table 1. Table 1 Chi-square analysis results of SNP marker loci

[0022] According to the analysis in Table 1, the dominant type of molecular marker D.11926 (A>G) was AA genotype, the dominant type of molecular marker D.11999 (T>C) was TT genotype, the dominant type of molecular marker D.12025 (A>G) was AA genotype, the dominant type of molecular marker D.12026 (A>G) was AA genotype, the dominant type of molecular marker D.12039 (A>T) was AA genotype, the dominant type of molecular marker D.12044 (C>T) was CC genotype, the dominant type of molecular marker D.12063 (A>T) was AA genotype, the dominant type of molecular marker D.12195 (T>G) was TT genotype, the dominant type of molecular marker D.12212 (T>A) was AA and AT genotypes, the dominant type of molecular marker D.12241 (G>A) was GG genotype, and the dominant type of molecular marker D.12349 (T>C) was TT genotype.

[0023] At the same time, linkage disequilibrium analysis was performed on 11 SNP loci. Figure 4It was found that eight SNP sites, including D.11926 (A>G), D.11999 (T>C), D.12025 (A>G), D.12026 (A>G), D.12039 (A>T), D.12063 (A>T), D.12241 (G>A) and D.12349 (T>C), were completely linked; sites D.12025 (A>G), D.12195 (T>G), D.12212 (T>A) and D.12044 (C>T) can be selected as Tagger SNPs.

[0024] In addition, it should be understood that although the present specification is described according to implementation modes, not every implementation mode contains only one independent technical solution. This description of the specification is only for the sake of clarity. Those skilled in the art should regard the specification as a whole. The technical solutions in each embodiment may also be appropriately combined to form other implementation modes that can be understood by those skilled in the art.

Claims

1. A SNP molecular marker of the Raptor gene of Penaeus vannamei, characterized by: The SNP molecular markers of the Raptor gene of white shrimp include molecular marker D.11926, molecular marker D.11999, molecular marker D.12025, molecular marker D.12026, molecular marker D.12039, molecular marker D.12044, molecular marker D.12063, molecular marker D.12195, molecular marker D.12212, molecular marker D.12241, and molecular marker D.12349, and are sequentially located at the 69th, 142nd, 168th, 169th, 182nd, 187th, 206th, 338th, 355th, 384th, and 492nd bases of the nucleotide sequence shown in sequence 1 of the sequence table.

2. The use of the SNP molecular marker of the Raptor gene of Penaeus vannamei as claimed in claim 1, characterized in that: The SNP molecular marker of the Raptor gene of the white shrimp is used for the breeding of white shrimp resistant to nitrite nitrogen, specifically, the genomic DNA of the muscle tissue of the white shrimp to be tested is first extracted, and the obtained genomic DNA is used as a template for PCR amplification and purification of the PCR amplification product, and then the obtained PCR amplification product is sequenced to determine the genotypes of the molecular marker D.11926, molecular marker D.11999, molecular marker D.12025, molecular marker D.12026, molecular marker D.12039, molecular marker D.12044, molecular marker D.12063, molecular marker D.12195, molecular marker D.12212, molecular marker D.12241, and molecular marker D.12349; When the genotype of the molecular marker D.11926 is the dominant genotype of AA genotype, the individual is selected as a reserve parent for breeding of whiteleg shrimp varieties; When the genotype of the molecular marker D.11999 is the dominant genotype of TT, the individual is selected as a reserve parent for breeding of whiteleg shrimp varieties; When the genotype of the molecular marker D.12025 is the dominant genotype of AA genotype, the individual is selected as a reserve parent for breeding of whiteleg shrimp varieties; When the genotype of the molecular marker D.12026 is the dominant genotype of AA genotype, the individual is selected as a reserve parent for breeding of whiteleg shrimp varieties; When the genotype of the molecular marker D.12039 is the dominant genotype of AA genotype, the individual is selected as a reserve parent for breeding of whiteleg shrimp varieties; When the genotype of the molecular marker D.12044 is the dominant genotype CC genotype, the individual is selected as a reserve parent for whiteleg shrimp variety breeding; When the genotype of the molecular marker D.12063 is the dominant genotype of AA genotype, the individual is selected as a reserve parent for breeding of whiteleg shrimp varieties; When the genotype of the molecular marker D.12195 is the dominant genotype of TT, the individual is selected as a reserve parent for breeding of whiteleg shrimp varieties; When the genotype of the molecular marker D.12212 is the dominant genotype of AA genotype or AT genotype, the individual is selected as a reserve parent for breeding of whiteleg shrimp varieties; When the genotype of the molecular marker D.12241 is the dominant genotype of GG, the individual is selected as a reserve parent for breeding of whiteleg shrimp varieties; When the genotype of the molecular marker D.12349 is the dominant genotype of TT, the individual is selected as a reserve parent for breeding of whiteleg shrimp varieties.

3. The use of the SNP molecular marker of the Raptor gene of Penaeus vannamei according to claim 2, characterized in that: During the PCR amplification process, the primers used to detect the SNP molecular marker of the Raptor gene of the white shrimp include primer F1, primer R1, and primer R2; The nucleotide sequence of the primer F1 is: TCTGGAGAGGTGAGGTTATGG; The nucleotide sequence of the primer R1 is: GCATCCCTGGTATATTTGTTCTCA; The nucleotide sequence of the primer R2 is: CATAGACTGTGATGTAACTGTCAG.

4. The use of the SNP molecular marker of the Raptor gene of Penaeus vannamei according to claim 2, characterized in that: The PCR amplification process is a nested PCR amplification, in which two PCR amplifications are performed, and the amplification system of the first PCR includes 5 μL of 2×Es Taq MasteMix, 0.2 μL of a template with a concentration of 100 ng / μL, 0.4 μL of a primer F1 with a concentration of 10 μmol / L, 0.4 μL of a primer R1 with a concentration of 10 μmol / L, and 4 μL of ddH2O; the amplification system of the second PCR includes 25 μL of 2×Es Taq MasteMix, 1 μL of a product of the first PCR amplification diluted 100 times, 2 μL of a primer F1 with a concentration of 10 μmol / L, 2 μL of a primer R2 with a concentration of 10 μmol / L, and 20 μL of ddH2O.

5. The use of the SNP molecular marker of the Raptor gene of Penaeus vannamei according to claim 2, characterized in that: The amplification program of the first PCR amplification is: S101: pre-denaturation at 94°C for 5 min; S102: denaturation at 94°C for 30 s, annealing at 62°C for 30 s, and extension at 72°C for 30 s, for a total of 35 amplification cycles; S103: post-extension at 72°C for 7 min; The amplification procedure of the second PCR is: S201: pre-denaturation at 94°C for 3 min; S202: denaturation at 94°C for 30 s, annealing at 62°C for 30 s, and extension at 72°C for 30 s, for a total of 35 cycles; S203: Post-extension at 72°C for 7 min.

Images