Snps molecular marker, primer pair and application related to pork quality trait gene gab1

By discovering SNP molecular markers in the porcine GAB1 gene, designing primer pairs for PCR amplification and sequencing, and screening individuals with the A allele, the problem of insufficient heritability of meat quality traits in existing technologies has been solved, enabling early screening and breeding of pork quality traits, and improving intramuscular fat content and economic benefits.

CN119177299BActive Publication Date: 2026-02-13INST OF ANIMAL SCI & VETERINARY HUBEI ACADEMY OF AGRI SCI
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202411582171.X
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-11-07
Publication Date
2026-02-13
Estimated Expiration
2044-11-07

AI Technical Summary

Technical Problem

The lack of readily available molecular markers for key pork quality traits in current technologies leads to insufficient heritability of these traits, impacting pig farm production and economic benefits.

Method used

The SNP molecular marker g.112G>A in exon 5 of the GAB1 gene on chromosome 8 of pigs was discovered. Primer pairs were designed for PCR amplification and sequencing analysis. Individuals carrying the A allele were screened, while individuals carrying the G allele were eliminated, thus enabling early screening and breeding of pork quality traits.

Benefits of technology

This enabled early screening and breeding of pork quality traits, increased intramuscular fat content, enhanced the heritability of pork quality traits, and increased economic benefits.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119177299B_ABST
    Figure CN119177299B_ABST
Patent Text Reader

Abstract

The application discloses a SNP molecular marker related to a pork quality trait gene GAB1, a primer pair and application thereof, and relates to the technical field of pig molecular markers. The pork quality trait is an intramuscular fat content trait; the molecular marker is located in the 5th exon of the GAB1 gene on the 8th chromosome of a pig, and the nucleotide sequence is shown in the sequence table SEQ ID NO. 1; a g.112G>A base mutation exists at the 112th bp of the sequence. The application further provides a primer pair for amplifying the above-mentioned molecular marker and a method for breeding by using the above-mentioned molecular marker. The application first discovers that a SNP molecular marker in the GAB1 gene of a pig is related to the intramuscular fat content trait of the pig, and therefore can be used for marker-assisted selection breeding of the pig, that is, a new use of a SNP molecular marker in the GAB1 gene of the pig in marker-assisted breeding of pork quality traits is provided, and early screening of pig breeding and breeding traits is realized, and the screening method is simple and rapid.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of pig molecular marker, in particular to a SNP molecular marker related to pig meat quality trait gene GAB1, a primer pair and application thereof. BACKGROUND

[0002] China is a big country of pig production, both the pig breeding scale and the pork consumption are the first in the world. Meat quality trait is an important economic trait of pig breeding industry, and the level of pork quality directly affects the production and economic benefits of pig farm. The heritability of meat quality is between 0.25-0.42, mostly a medium heritability trait. At present, the key genes that can be utilized and elucidate the mechanism of intramuscular fat content on meat quality are still insufficient. Therefore, it is of great significance to find the key molecular genetic markers controlling the meat quality traits of pigs and use them for molecular marker-assisted breeding to improve the meat quality traits of pigs and increase economic benefits.

[0003] GRB2-associated binding protein 1 (GAB1) is the founding member of the GAB / DOS family of proteins containing pleckstrin homology (PH) domains. After receiving various stimuli, GAB1 cell localization changes from cytoplasm to membrane, where it is phosphorylated by a series of kinases, recruiting SH2 domain-containing proteins such as SHP2, p85 subunit of PI3K, CRK, etc., thereby activating different signaling pathways, including MAPK, PI3K / AKT and JNK, thereby regulating various biological processes such as cell proliferation, inhibition of apoptosis, metastasis and angiogenesis.

[0004] Studies have shown that the activation of Gab1 can maintain the downstream activation of PI3K and Akt, and recombinant SNCA as a new glucose regulator can promote glucose uptake in mouse adipocyte precursors and adipose tissue and skeletal muscle in vivo through the LPAR2 / Gab1 / PI3K / Akt pathway. Studies have also shown that GAB1 is essential for fibroblast survival and maintenance of heart function.

[0005] However, whether the GAB1 gene can improve pork quality, this molecular mechanism has not been reported. SUMMARY

[0006] The purpose of the present application is to overcome the deficiencies in the prior art, and to provide a SNP molecular marker related to pig meat quality trait gene GAB1, a primer pair and application thereof. The present application discovers that a SNP in the GAB1 gene on chromosome 8 is associated with pig meat quality traits, which can be used as a molecular marker for pig meat quality trait screening and pig breeding.

[0007] In a first aspect, the present application provides a SNP molecular marker related to a pork quality trait gene GAB1, wherein the pork quality trait is intramuscular fat content; the molecular marker is located in the 5th exon of the GAB1 gene on the 8th chromosome of a pig, and its nucleotide sequence is shown in SEQ ID NO. 1, and a g.112G>A base mutation exists at the 112th bp of the sequence.

[0008] Further, the A or G base polymorphism site at the 112th bp of the sequence SEQ ID NO. 1 shows three genotypes of AA, AG or GG, wherein the A allele is the dominant allele.

[0009] In a second aspect, the present application provides an application of the SNP molecular marker of the first aspect in pork quality trait screening and / or pig breeding.

[0010] In a third aspect, the present application provides a primer pair for amplifying the molecular marker of the first aspect, wherein the nucleotide sequence of the upstream primer is shown in SEQ ID NO. 2, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO. 3.

[0011] In a fourth aspect, the present application provides an application of the primer pair of the third aspect in pork quality trait screening and / or pig breeding.

[0012] In a fifth aspect, the present application provides a kit for rapid selection by using the SNP molecular marker of the first aspect, comprising the primer pair of the third aspect.

[0013] In a sixth aspect, the present application provides a method for pork quality trait screening and / or pig selection, comprising the following steps:

[0014] S1, extracting genomic DNA of a pig;

[0015] S2, using the genomic DNA obtained in step S1 as a template, performing PCR amplification by using the primer pair of claim 4 to obtain the molecular marker of claim 1 and purifying the same;

[0016] S3, performing sequencing analysis on the purified molecular marker of step S2, retaining the individual carrying the A allele at the 112th bp of the sequence and eliminating the individual carrying the G allele.

[0017] Further, in step S1, the genomic DNA is extracted from the ear tissue of the pig to be tested.

[0018] Further, in step S2, the PCR reaction system is 50 μL, and the components in the system are: genomic DNA 100 ng, PCR mix 25 μL, the above-mentioned upstream and downstream primers each 1 μL, and ddH2O is added to a total volume of 50 μL; the running program of PCR is: 98 ℃ pre-denaturation for 45 s; 98 ℃ denaturation for 10 s, 60 ℃ annealing for 30 s, 72 ℃ extension for 30 s, 40 cycles; 72 ℃ extension for 5 min; 4 ℃ preservation.

[0019] Compared with the prior art, the beneficial effects of the present application include:

[0020] The present application first excavates the SNP molecular marker related to the pig GAB1 gene and the meat quality trait of the pig, and specifically the intramuscular fat content trait, so that the molecular marker can be used for screening the meat quality trait of the pig and breeding, that is, a new use of the SNP molecular marker related to the pig GAB1 gene in marker-assisted breeding of the meat quality trait of the pig is provided, and early screening of the meat quality trait of the pig is realized, and the screening method is simple and rapid. BRIEF DESCRIPTION OF DRAWINGS

[0021] Figure 1 It is an agarose gel electrophoresis detection diagram of the PCR product in the embodiment 1 of the present application, wherein the lane M is DL1000Marker, and the lanes 1-3 are amplified fragments in the pig, and the fragment size is 224 bp;

[0022] Figure 2 It is a sequencing map of the g.112G>A site in the embodiment 1 of the present application. DETAILED DESCRIPTION

[0023] In order to make the purpose, technical scheme and advantages of the present application more clear, the present application is further described in detail below in combination with the drawings and embodiments. It should be understood that the specific embodiments described herein are only used to explain the present application, and are not used to limit the present application.

[0024] Example 1: Obtaining of the SNP detection fragment of the pig GAB1 gene and establishment of the polymorphism site detection method

[0025] 1. Extraction of pig genomic DNA

[0026] The extraction of pig genomic DNA adopts the animal tissue genomic DNA extraction kit (PureLink TM Pro 96 Genomic DNA Purification Kit, K182104A) produced by Invitrogen Company, and the extraction of pig genomic DNA is carried out according to the instruction manual of the kit. The extracted DNA is detected for concentration and quality, and is stored at -20 ℃ for standby use.

[0027] 2. Obtaining of the detection fragment of the SNP genetic marker of the pig GAB1 gene

[0028] (1) PCR amplification

[0029] According to the SNP genetic marker detection sequence in the genomic sequence of the pig GAB1 gene, a pair of primers is designed to amplify the fragment of the polymorphic site.

[0030] The nucleotide sequence of the SNP genetic marker detection sequence is as follows:

[0031] TGTTCGCGGAATCTGGTAAGTATTACCCGGCGTGGGAGGAATGTCATAACTCATGGACACATGCCTCATTTGGGTCTCTAAGCTCGCGGTCCCCGATGGCGTGTTGAATACGTAGAGTTCTCCGTCTGCTTCCGTGCTCGAGGGAGACGCCTTGGGCAGAACATCGTGGGAGAAACTCCTGGGCAGGTTGTAAAGGCTGGAGTCTACAGAAACGACGGGGCTCG, as shown in SEQ ID NO. 1.

[0032] The designed primers are as follows:

[0033] The upstream primer is 5'TGTTCGCGGAATCTGGTAAGTATTAC 3', as shown in SEQ ID NO. 2.

[0034] The downstream primer is 5'CGAGCCCCGTCGTTTCTGTA 3', as shown in SEQ ID NO. 3.

[0035] Using the above primers, the pig genomic DNA extracted from the ear edge tissue of the pig to be tested is used as the template to perform PCR amplification, and the PCR reaction system is 25 μL, and the components in the system are as follows: genomic DNA 100 ng, PCR mix 25 μL, the above upstream and downstream primers each 1 μL, and ddH2O is added to a total volume of 50 μL.

[0036] The running program of PCR is as follows: 98℃ pre-denaturation for 45s; 98℃ denaturation for 10s, 60℃ annealing for 30s, 72℃ extension for 30s, 40 cycles; 72℃ extension for 5min; 4℃ preservation. The PCR product is detected by 1.0% agarose gel electrophoresis, and the detection result is shown in FIG. 1 of the accompanying drawings, wherein lane M is DL1000 Marker, and lanes 1-3 are the amplified fragments in pigs, and the size of the amplified fragments is 224bp. Figure 1

[0037] (2) Purification of PCR product ​

[0038] The PCR amplification products were purified by using Gel Extraction Kit of Shanghai Biengen Co., Ltd. The specific steps were shown in the instruction of the kit.

[0039] 3. Detection of molecular markers by direct sequencing of PCR products

[0040] The purified PCR products were directly sent to Beijing Aukey Co. for sequencing. The genotypes of the locus in the detection population were determined according to the sequencing results. The results were analyzed by using DNA Star software, and the results were shown in Table 1. Figure 2 As shown in SEQ ID NO. 1, a G112-A112 allele mutation, i.e. g.112G>A, was found at the 112th bp of the sequence, which caused the polymorphism of GAB1 gene.

[0041] Example 2. Detection of polymorphism distribution of molecular markers in pigs

[0042] In this example, the polymorphism distribution of the g.112G>A locus of the pig GAB1 gene in 276 pigs with intramuscular fat content traits was detected, and the detection results were shown in Table 1.

[0043] Table 1. Polymorphism distribution of the g.112G>A locus of the GAB1 gene

[0044]

[0045] As shown in Table 1, the g.112G>A locus of the GAB1 gene in pigs showed AA, AG, and GG genotypes, among which the AA genotype was more common, and the frequency of A allele was 56.9%.

[0046] Example 3. Association analysis of molecular markers and pork quality traits

[0047] In order to determine whether the g.112G>A locus of the pig GAB1 gene was related to the difference of pork quality traits, the polymorphism detection method established in Example 1 was used, and the correlation between different genotypes of the polymorphic locus and intramuscular fat content traits was analyzed. The GLM program of SAS statistical software (SAS Institute Inc, Version 9.4) was used for variance analysis of different SNP genotype combinations, and significance test was performed. The model used was:

[0048] Yijl = μ + Gi + Wj + eijl;

[0049] Yijl is the trait phenotype value, μ is the average value, Gi is the genotype effect (including gene additive effect and dominant effect); Wj is the age; eijl is the residual effect.

[0050] The correlation analysis between different genotypes and meat quality traits in pigs was carried out, and the statistical analysis results are shown in Table 2:

[0051] Table 2 Correlation analysis of GAB1 gene g.112G>A site and pork quality traits

[0052]

[0053] Note: The trait mean in the table is composed of mean ± standard deviation, and the superscript uppercase letters are different, indicating significant difference (P<0.01), and * indicates significant difference (P<0.05)

[0054] As shown in Table 2, in pigs, the intramuscular fat content of AA genotype individuals of g.112G>A site is significantly higher than that of AG and GG genotype individuals (P<0.05), and therefore the A allele is the dominant allele.

[0055] Example 4 Application of GAB1 gene SNP molecular marker in screening of pork quality traits and / or pig breeding

[0056] The SNP molecular marker g.112G>A site on the intron of GAB1 gene is significantly correlated with pork quality traits. Therefore, in the process of breeding pigs, AA type or AG type individuals with good meat quality can be selected by the SNP molecular marker, and individuals carrying the dominant allele should be retained in breeding, so as to improve the production performance of the population.

[0057] The specific embodiments of the application described above do not constitute a limitation on the protection scope of the application. Any various other corresponding changes and modifications made according to the technical concept of the application should be included in the protection scope of the claims of the application.

Claims

1. Use of SNP molecular markers in the selection of pork quality traits and / or in the breeding of pork quality traits-related pigs, characterized in that, The meat quality trait is intramuscular fat content, the molecular marker is located in the 5th exon of GAB1 gene on pig chromosome 8, the nucleotide sequence is shown in SEQ ID NO. 1, and there is a g.112G>A base mutation at the 112th bp of the sequence; The A or G base polymorphism site at the 112th bp in the sequence SEQ ID NO. 1, which is expressed as AA, AG or GG three genotypes, wherein the A allele is the dominant allele.

2. Use according to claim 1, characterized in that, The primer pair for amplifying the molecular marker comprises: an upstream primer with the nucleotide sequence shown in SEQ ID NO. 2 and a downstream primer with the nucleotide sequence shown in SEQ ID NO.

3.

3. A method for pork quality trait screening and / or pork quality trait associated selection in pigs, characterized in that, The meat quality trait is intramuscular fat content, and the method comprises the following steps: S1, extracting the genomic DNA of the pig; S2, using the genomic DNA obtained in step S1 as a template, performing PCR amplification by using a primer pair to obtain a molecular marker and purifying the same; S3, performing sequencing analysis on the purified molecular marker in step S2, retaining the individual with AA or AG genotype at the 112th bp of the sequence, and eliminating the individual with GG genotype; The primer pair comprises: an upstream primer with the nucleotide sequence shown in SEQ ID NO. 2 and a downstream primer with the nucleotide sequence shown in SEQ ID NO.

3. The molecular marker is located in the 5th exon of GAB1 gene on pig chromosome 8, the nucleotide sequence is shown in SEQ ID NO. 1, and there is a g.112G>A base mutation at the 112th bp of the sequence.

4. The method for screening and / or selecting for pork quality traits according to claim 3, wherein, In step S1, the genomic DNA is extracted from the ear tissue of the pig to be tested.

5. The method for screening pork quality traits and / or pork quality traits related selection of pigs according to claim 3, characterized in that, In step S2, the PCR reaction system is 50 μL, and the components in the system are: genomic DNA 100 ng, PCR mix 25 μL, the above upstream and downstream primers each 1 μL, and ddH2O is added to a total volume of 50 μL; the running program of PCR is: 98℃ pre-denaturation for 45s; 98℃ denaturation for 10s, 60℃ annealing for 30s, 72℃ extension for 30s, 40 cycles; 72℃ extension for 5min; 4℃ storage. In step S2, the PCR reaction system is 50 μL, and the components in the system are: genomic DNA 100 ng, PCR mix 25 μL, the above upstream and downstream primers each 1 μL, and ddH2O is added to a total volume of 50 μL; the running program of PCR is: 98℃ pre-denaturation for 45s; 98℃ denaturation for 10s, 60℃ annealing for 30s, 72℃ extension for 30s, 40 cycles; 72℃ extension for 5min; 4℃ storage.