SNP (Single Nucleotide Polymorphism) marker related to main root length in seedling stage of wheat 4B chromosome and application thereof

Abstract

The invention discloses an SNP (Single Nucleotide Polymorphism) marker related to a main root length in a wheat 4B chromosome seedling stage and application thereof. The invention provides an application of a substance for detecting the Ta-4B-SNP unit type of an SNP site in a wheat genome in any one of the following applications: A1) identifying or assisting in identifying the root length of wheat; a2) screening or auxiliary screening of wheat with long roots; a3) breeding wheat with a long root system; a4) wheat genetic breeding; the SNP site Ta-4B-SNP is the 94th site of the SEQ ID NO: 1 (Sequence Identity Number 1). An SNP site Ta-4B-SNP is found on a 4B chromosome of wheat, a molecular marker is developed according to the SNP site, the marker is a KASP marker, repeatability is good, cost is low, wheat strains or varieties with long root systems can be screened out easily, and the molecular marker has important significance on cultivation of new wheat varieties with long root systems.

Description

Technical Field

[0001] The invention belongs to the field of molecular detection technology and crop genetic breeding, and relates to a SNP marker related to the taproot length of wheat 4B chromosome in the seedling stage and an application thereof. Background Art

[0002] Excellent root morphology is the basis for efficient use of water and nutrients in wheat (Atkinson et al. 2015). Root architecture is composed of traits with different functions, such as root length affecting water absorption, root number, root diameter and root surface area affecting nutrient absorption (Meister et al. 2014; Courtois et al. 2009), and root biomass affecting the balance of plant aboveground and root biomass, thereby affecting yield (Bettembourg et al. 2017; Cormier et al. 2016). The root system adapts to different growth environments by changing its morphology and spatial distribution characteristics, which is the fundamental reason for wheat's high water and fertilizer efficiency, resistance to lodging and heat resistance (Li et al. 2022; Uga et al. 2013).

[0003] At present, the root trait investigation methods mainly include indoor identification in the seedling stage and field identification in the adult stage. The root identification methods in the adult stage include the digging method, the small basket method, and the micro-root tube method, which cause great damage to the root system, have low throughput, and a large workload, and are not suitable for population genetic analysis (Li et al. 2022). However, seedling root identification is fast, simple, and has a strong correlation with the adult stage, and can well reflect the root morphology and root group distribution in the adult stage. Therefore, using molecular breeding technology to study the genetic mechanism of seedling root traits is helpful for wheat root improvement.

[0004] Discovering molecular markers that control seedling root traits is a prerequisite for assisted breeding of wheat varieties with superior root systems. Using molecular markers closely linked to genes or QTLs related to wheat seedling roots for assisted selection can greatly improve the efficiency of breeding selection, which is of great significance for accelerating the improvement and cultivation of wheat varieties with superior root systems. At present, the positioning and cloning of genes or QTLs have made certain progress. For example, Ayalew et al (2017) used RIL populations to identify seedling root length and root dry weight, and identified 13 QTLs on chromosomes 1B, 2D and 5A; Ma et al (2022) used a natural population consisting of 388 varieties to identify 9 seedling root traits, and obtained a total of 36 related QTLs.

[0005] Although some studies have located some QTLs related to wheat seedling root system, there are few reports on the application of tightly linked markers in molecular breeding. Therefore, it is necessary to further explore functional markers that can be used for wheat seedling root system identification and use them to screen wheat varieties with excellent root traits, so as to provide molecular assisted selection methods for breeding high-yield, stable-yield and excellent-quality wheat varieties. Summary of the invention

[0006] The technical problem solved by the invention is to identify and assist in screening wheat varieties with long root systems in the seedling stage by using KASP markers at Ta-4B-SNP sites.

[0007] In order to solve the above technical problems, in the first aspect, the present invention provides an application of a substance for detecting the Ta-4B-SNP unit type of a SNP site in a wheat genome in any of the following:

[0008] A1) Identify or assist in identifying wheat root length;

[0009] A2) Screening or assisting in the selection of wheat with long root systems;

[0010] A3) Breeding wheat with long root systems;

[0011] A4) Wheat genetics and breeding;

[0012] The SNP site Ta-4B-SNP is the 94th position of SEQ ID NO: 1.

[0013] In the application described above, the root length is specifically the main root length.

[0014] In the application described above, the root length is further specifically the main root length in the seedling stage.

[0015] In the application described above, the unit type of the SNP site Ta-4B-SNP is GG, CC or GC.

[0016] In the above application, the substance for detecting the unit type of the SNP site Ta-4B-SNP in the wheat genome is B1) or B2):

[0017] B1) Primer set;

[0018] B2) a PCR reagent or a kit containing the set of primers;

[0019] The set of primers includes primer 1, primer 2 and primer 3;

[0020] The nucleotide sequence of the primer 1 includes the sequence shown at positions 22-42 of SEQ ID NO: 2;

[0021] The nucleotide sequence of the primer 2 includes the sequence shown at positions 22-42 of SEQ ID NO: 3;

[0022] The nucleotide sequence of the primer 3 is SEQ ID NO:4.

[0023] In the application described above, the nucleotide sequence of the primer 1 is SEQ ID NO: 2;

[0024] The nucleotide sequence of the primer 2 is SEQ ID NO: 3.

[0025] In a second aspect, the present invention provides any of the following substances:

[0026] The set of primers described in the first aspect;

[0027] Or, a PCR reagent or kit containing the set of primers described in the first aspect.

[0028] In the above, the PCR reagents include primer 1, primer 2, primer 3, and KASP Master mix (LGC Biosearch, KBS-1050-122);

[0029] The molar ratio of primer 1, primer 2 and primer 3 is 1:1:2.5.

[0030] In an embodiment of the present invention, the concentration of primer 1 in the PCR reagent is 168 nM, the concentration of primer 2 in the PCR reagent is 168 nM, and the concentration of primer 3 in the PCR reagent is 420 nM.

[0031] In a third aspect, the present invention provides the use of the set of primers, PCR reagents or kits described in the second aspect in any of the following:

[0032] A1) Identify or assist in identifying wheat root length;

[0033] A2) Screening or assisting in the selection of wheat with long root systems;

[0034] A3) Breeding wheat with long root systems;

[0035] A4) Wheat genetics and breeding.

[0036] In a fourth aspect, the present invention provides a method for identifying or assisting in identifying wheat root length, comprising the following steps: detecting whether the SNP site Ta-4B-SNP unit type in the wheat genome is GG or CC, and the root length of the wheat to be tested whose Ta-4B-SNP site unit type is GG is greater than or is candidate to be greater than the wheat to be tested whose Ta-4B-SNP site unit type is CC.

[0037] In the method described above, the method for detecting whether the unit type of the SNP site Ta-4B-SNP in the wheat genome is GG or CC comprises the following steps: using the wheat genome to be tested as a template, performing a KASP reaction with the PCR reagent described in the second aspect to obtain the unit type.

[0038] In a fifth aspect, the present invention provides a method for breeding long-root wheat, comprising the following steps: breeding wheat of the Ta-4B-SNP locus unit type GG described in the fourth aspect.

[0039] In the above method, the detection of whether the unit type of the SNP site Ta-4B-SNP in the wheat genome is GG or CC also includes the following steps: using the wheat genome to be tested as a template, using PCR reagents to perform KASP reaction to obtain the unit type.

[0040] In the above, the KASP reaction procedure is as follows:

[0041] Pre-denaturation at 94°C for 15 min; denaturation at 94°C for 20 s; annealing and extension at 61°C for 60 s, 10 cycles, decreasing by 0.6°C in each cycle; denaturation at 94°C for 20 s, annealing and extension at 55°C for 60 s, 32 cycles; 37°C for 1 min, 37°C for 1 s (scanning fluorescence values ​​for genotype reading).

[0042] In the above, the unit type is obtained by using PCR reagents for KASP reaction, and the amplification product is detected by Bio-RAD CFX96 fluorescence quantitative PCR instrument. The unit type is obtained by KASP reaction, and genotyping is performed based on the fluorescence data.

[0043] The present invention found a SNP site Ta-4B-SNP on chromosome 4B of wheat, and found that the SNP site was significantly correlated with the length of wheat taproot (P<0.01) by using marker / trait association analysis in 194 wheat germplasms, and further verified its application in the breeding process. A molecular marker was developed based on the SNP site, which is a KASP marker with good repeatability and low cost, and is conducive to screening out wheat strains or varieties with longer root systems, which is of great significance for cultivating new wheat varieties with longer root systems. BRIEF DESCRIPTION OF THE DRAWINGS

[0044] Figure 1 Comparison of the root systems of wheat materials with unit types Ta-4B-SNP-GG and Ta-4B-SNP-CC at the seedling stage.

[0045] Figure 2 Comparison of the taproot length of two Ta-4B-SNP unit types in wheat natural population (A) and genetic population (B). DETAILED DESCRIPTION

[0046] The present invention is further described in detail below in conjunction with specific embodiments, and the examples provided are only for illustrating the present invention, rather than for limiting the scope of the present invention. The examples provided below can be used as a guide for further improvements by those of ordinary skill in the art, and do not constitute a limitation of the present invention in any way.

[0047] The experimental methods in the following examples, unless otherwise specified, are all conventional methods, and are performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials, reagents, etc. used in the following examples, unless otherwise specified, can all be obtained from commercial channels.

[0048] Unless otherwise specified, the quantitative tests in the following examples were performed three times and the results were averaged.

[0049] The taproot length in the following embodiments refers to the length from the rhizome separation point to the farthest point of the taproot.

[0050] Example 1: Mining of Ta-4B-SNP sites and obtaining primers specific for KASP markers

[0051] 1. Mining of Ta-4B-SNP loci

[0052] 1. Investigation of root characteristics

[0053] 194 wheat varieties were used as materials. 20 seeds with full grains and uniform size were selected for each variety. After repeated disinfection with 3% H2O2, they were placed in a culture dish for germination for 7 days. After removing the endosperm, 5 plants were placed in one hole, fixed with sponge strips, and each hole was 3 cm apart. They were transferred to a perforated foam board and placed in Hoagland nutrient solution (pH = 6.0). The oxygen pump was continuously ventilated and cultured in an artificial climate chamber with a photoperiod of 16h light / 8h dark and a light intensity of 500μmol·m-2·s-1 for 21 days (seedling stage). 20L of nutrient solution was replaced every 3 days. Three uniform plants were selected for each line. The phenotypic data of taproot length, total root length, root surface area, root volume, root diameter and root tip number were measured using Microtek Scanmakeri 800plus root scanner and Win-RHIZO system. The fresh weight of roots, fresh weight of stems and leaves, fresh weight of plants, dry weight of roots, dry weight of stems and leaves, and dry weight of plants were weighed.

[0054] 2. Association analysis and discovery of linkage marker Ta-4B-SNP

[0055] The wheat 16K SNP chip was used to perform SNP typing on 194 wheat varieties, of which 9793 SNP markers were different among the 194 wheat varieties. TASSEL 5.0 was used to perform genome-wide association analysis using MLM with each SNP as a fixed factor, PCA and Kinship matrix as random factors. When the threshold value was P<0.001 or log10(P)>3, it was found that the SNP site Ta-4B-SNP was significantly associated with taproot length.

[0056] The unit type of Ta-4B-SNP site is GG, CC or GC.

[0057] The taproot length of wheat varieties with the unit type of Ta-4B-SNP locus GG ( Figure 1 A) The taproot length of wheat varieties with CC haplotype greater than Ta-4B-SNP locus ( Figure 1 B)(such as Figure 1 shown).

[0058] The Ta-4B-SNP site is located on chromosome 4B of the wheat genome, and is the 94th nucleotide of SEQ ID NO: 1, which is G or C.

[0059] 2. Development of KASP-marked primers for detecting Ta-4B-SNP loci

[0060] According to the design rules of KASP primers, KASP primers for amplifying Ta-4B-SNP sites were designed. As primers for detecting Ta-4B-SNP, they include 3 primer sequences (sequences such as SEQ ID NO: 2-4), as follows: Primer 1 KASP-4B-SNP-FAM: GAAGGTGACCAAGTTCATGCTacacatggccgtgaaattctG (SEQ ID NO: 2)

[0061] Primer 2KASP-4B-SNP-HEX: GAAGGTCGGAGTCAACGGATTacacatggccgtgaaattctC (SEQID NO: 3)

[0062] Primer 3KASP-4B-SNP-R: tccaaaacctagcgcttcca (SEQ ID NO: 4)

[0063] Among them, GAAGGTGACCAAGTTCATGCT is the FAM fluorescent label sequence carried by the 5' end of primer 1 KASP-4B-SNP-FAM, and GAAGGTCGGAGTCAACGGATT is the HEX fluorescent label sequence carried by the 5' end of primer 2 KASP-4B-SNP-HEX.

[0064] The scatter plot based on KASP markers shows the clustering of different germplasms on the X-(FAM) axis and the Y-(HEX) axis. The genotype is determined by detecting the fluorescence signal of the amplified product. The amplified products of primers 1 and 3 only show the color of the connected FAM fluorescent label, and the strong FAM signal is concentrated in the lower right corner of the scatter plot. The unit type of the Ta-4B-SNP site of the wheat to be tested is GG homozygous; the amplified products of primers 2 and 3 only show the color of the connected HEX fluorescent label, and the strong HEX signal is concentrated in the upper left corner of the scatter plot. The unit type of the Ta-4B-SNP site of the wheat to be tested is CC homozygous.

[0065] 3. Establishment of the Ta-4B-SNP locus haplotype detection method

[0066] 1. Extraction of wheat genomic DNA to be determined

[0067] 2. Using the extracted DNA as a template, PCR amplification was performed using the KASP primers shown in SEQ ID NO: 2-4;

[0068] The amplification process is as follows:

[0069] (1) Preparation of KASP primer working solution

[0070] The primers were diluted into 100 μM stock solution respectively, and then 12 μL of primer 1 KASP-4B-SNP-FAM, 12 μL of primer 2 KASP-4B-SNP-HEX, 30 μL of primer 3 KASP-4B-SNP-R and 46 μL of ddH2O were mixed to form KASP-4B-SNP Assay Mix working solution.

[0071] (2) KASP reaction system and procedure

[0072] The 10 μL reaction system of a 96-well plate includes: 5 μL of KASP Master mix (LGC Biosearch, KBS-1050-122), 1.5 μL of DNA template (about 60 ng), 0.14 μL of KASP-4B-SNP Assay Mix working solution, and 3.5 μL of ddH2O.

[0073] Among them, the concentration of primer 1 KASP-4B-SNP-FAM in the reaction system is 168 nM, the concentration of primer 2 KASP-4B-SNP-HEX in the reaction system is 168 nM, and the concentration of primer 3 KASP-4B-SNP-R in the reaction system is 420 nM.

[0074] The KASP reaction procedure is as follows:

[0075] Pre-denaturation at 94°C for 15 min; denaturation at 94°C for 20 s; annealing and extension at 61°C for 60 s, 10 cycles, decreasing by 0.6°C in each cycle; denaturation at 94°C for 20 s, annealing and extension at 55°C for 60 s, 32 cycles; 37°C for 1 min, 37°C for 1 s (scanning fluorescence values ​​for genotype reading).

[0076] 3. Use Bio-RAD CFX96 fluorescence quantitative PCR instrument to detect the amplified products and perform genotyping based on the fluorescence data.

[0077] If the fluorescence signal of the amplified product is connected to the FAM fluorescent label sequence on the X-axis, the base of the wheat Ta-4B-SNP site to be tested is G, and the unit type is GG; if the fluorescence signal of the amplified product is connected to the HEX fluorescent label sequence on the Y-axis, the base of the wheat Ta-4B-SNP site to be tested is C, and the unit type is CC.

[0078] The taproot length of wheat with Ta-4B-SNP locus haplotype GG is longer than that of wheat with Ta-4B-SNP locus haplotype CC. Since wheat is a self-fertile crop with a low proportion of genomic heterozygous loci, this experiment did not study the heterozygous type of Ta-4B-SNP locus haplotype.

[0079] Therefore, the forward primer 1 KASP-4B-SNP-FAM with FAM sequence tag (SEQ ID NO: 2), the forward primer 2 KASP-4B-SNP-HEX with HEX sequence tag (SEQ ID NO: 3) and the reverse primer 3 KASP-4B-SNP-R (SEQ ID NO: 4) can be used to perform allele-specific marker KASP genotyping on the wheat to be tested. The taproot length of the wheat to be tested is detected according to whether the Ta-4B-SNP locus unit type is GG or CC. The taproot length of wheat with GG unit type is longer than that of wheat with CC unit type. The GG unit type is a long root and long line, indicating that the marker can achieve auxiliary selection for the taproot length of wheat in the seedling stage, providing a molecular assisted selection method for breeding long root varieties.

[0080] Example 2: Application of Ta-4B-SNP in detecting taproot length of natural wheat populations

[0081] Taking 194 portions of wheat as an example, the taproot length was detected according to the method of Example 1. The results are shown in Table 1.

[0082] The Ta-4B-SNP locus haplotypes of the 194 wheat samples were detected according to the method shown in Example 1, and the KASP reaction and data analysis were performed using a Bio-RAD CFX96 fluorescence quantitative PCR instrument. The results are shown in Table 1.

[0083] Table 1 shows the unit type statistics of wheat germplasm

[0084]

[0085]

[0086]

[0087]

[0088] It can be seen that among the 194 wheat materials, 153 had a GG unit type at the Ta-4B-SNP site, and 41 had a CC unit type at the Ta-4B-SNP site.

[0089] The taproot of wheat with GG unit type is larger than that of wheat with CC unit type.

[0090] The unit types of taproot length and Ta-4B-SNP locus of 194 wheat samples were statistically analyzed.

[0091] The results are as follows Figure 2 As shown in A, it can be seen that the average taproot length of wheat materials with Ta-4B-SNP locus haplotype GG is 16.80cm; the average taproot length of wheat with Ta-4B-SNP locus haplotype CC is 15.49cm. The average taproot length of wheat materials with Ta-4B-SNP locus haplotype GG is significantly higher than that of wheat materials with Ta-4B-SNP locus haplotype CC ( Figure 2 A).

[0092] Therefore, it can be judged or assisted in judging that the wheat material with the unit type of Ta-4B-SNP site as GG is wheat with a long root system.

[0093] Example 3: Application of Ta-4B-SNP in genetic populations

[0094] There are differences between Jinmai 47 and Jinmai 84 varieties. These two parents were used to construct a DH population (201 strains) and detect the application of the Ta-4B-SNP locus in the DH population.

[0095] The DH population was genotyped using the KASP-Ta-4B-SNP marker using the method of Example 1, and the PCR reaction and data analysis were performed using a Bio-RAD CFX96 fluorescence quantitative PCR instrument.

[0096] The root traits of the DH population were investigated: 20 seeds with full grains and uniform size were taken each time, and 3% H2O2 was repeatedly disinfected and placed in a culture dish for germination for 7 days. After removing the endosperm, 5 plants were placed in one hole, fixed with sponge strips, and each hole was 3 cm apart. They were transferred to a perforated foam board and placed in Hoagland nutrient solution (pH = 6.0). The oxygen pump was continuously ventilated and cultured in an artificial climate room with a photoperiod of 16h light / 8h dark and a light intensity of 500μmol·m-2·s-1 for 14 days (seedling stage). 20L of nutrient solution was replaced every 3 days. Three uniform plants were selected for each line and the taproot length was measured using Microtek Scanmakeri 800plus root scanner and Win-RHIZO system.

[0097] The results showed that among the above 201 strains, 107 had a GG unit type at the Ta-4B-SNP site, and 94 had a CC unit type at the Ta-4B-SNP site.

[0098] The above two unit types and their corresponding average lengths of taproots were analyzed. The results are as follows: Figure 2 As shown in B, the average taproot length of the families with the unit type of Ta-4B-SNP locus GG is 8.55 cm, while the average taproot length of the families with the unit type of Ta-4B-SNP locus CC is 6.83 cm. The taproot length of the wheat to be tested with the unit type of Ta-4B-SNP locus GG is significantly higher than that of the wheat to be tested with the unit type of Ta-4B-SNP locus CC.

[0099] Example 4: Application of Ta-4B-SNP in detecting wheat breeding offspring

[0100] The F1 generation after hybridization of Jinmai 919 and DH118 was self-pollinated to obtain the F3 generation, and the application of Ta-4B-SNP loci in the subsequent generations was detected.

[0101] The F3 population was genotyped using the KASP-Ta-4B-SNP marker using the method in Example 4, and the PCR reaction was performed using a Bio-RAD CFX96 fluorescence quantitative PCR instrument.

[0102] The taproot length of the F3 generation was measured using the method in Example 1.

[0103] The results showed that the average taproot length of the tested wheat with Ta-4B-SNP unit type GG was 15.84 cm; the average taproot length of the tested wheat with Ta-4B-SNP unit type CC was 12.10 cm. The taproot length of the tested wheat with Ta-4B-SNP unit type GG was significantly (P<0.01) higher than that of the tested wheat with Ta-4B-SNP unit type CC.

[0104] Therefore, the SNP site Ta-4B-SNP and the KASP marker designed based on this site can be used to quickly identify whether the wheat to be tested has a longer root system.

[0105] The present invention has been described in detail above. It will be apparent to those skilled in the art that the present invention may be implemented in a wide range under equivalent parameters, concentrations and conditions without departing from the spirit and scope of the present invention and without the need for unnecessary experimentation. Although the present invention provides specific embodiments, it should be understood that further improvements may be made to the present invention. In short, according to the principles of the present invention, this application intends to include any changes, uses or improvements to the present invention, including changes made by conventional techniques known in the art that depart from the scope disclosed in this application. Applications of some of the basic features may be made within the scope of the following appended claims.

Claims

1. Application of the material for detecting the Ta-4B-SNP unit type of the SNP site in the wheat genome in any of the following: A1) Identify or assist in identifying wheat root length; A2) Screening or assisting in the selection of wheat with long root systems; A3) Breeding wheat with long root systems; A4) Wheat genetics and breeding; The SNP site Ta-4B-SNP is the 94th position of SEQ ID NO:

1.

2. The use according to claim 1, characterized in that: The unit type of the SNP site Ta-4B-SNP is GG, CC or GC.

3. The use according to claim 1 or 2, characterized in that: The substance for detecting the unit type of the SNP site Ta-4B-SNP in the wheat genome is B1) or B2): B1) Primer set; B2) a PCR reagent or a kit containing the set of primers; The set of primers includes primer 1, primer 2 and primer 3; The nucleotide sequence of the primer 1 includes the sequence shown at positions 22-42 of SEQ ID NO: 2; The nucleotide sequence of the primer 2 includes the sequence shown at positions 22-42 of SEQ ID NO: 3; The nucleotide sequence of the primer 3 is SEQ ID NO:

4.

4. The use according to claim 3, characterized in that: The nucleotide sequence of the primer 1 is SEQ ID NO: 2; The nucleotide sequence of the primer 2 is SEQ ID NO:

3.

5. Any of the following substances: The set of primers as claimed in claim 3 or 4; Or, a PCR reagent or kit containing the set of primers described in claim 3 or 4.

6. Use of the primer set, PCR reagent or kit according to claim 5 in any of the following: A1) Identify or assist in identifying wheat root length; A2) Screening or assisting in the selection of wheat with long root systems; A3) Breeding wheat with long root systems; A4) Wheat genetics and breeding.

7. A method for identifying or assisting in identifying wheat root length, comprising the following steps: detecting whether the SNP site Ta-4B-SNP unit type in the wheat genome is GG or CC, and the root length of the wheat to be tested whose Ta-4B-SNP site unit type is GG is greater than or has the potential to be greater than the wheat to be tested whose Ta-4B-SNP site unit type is CC.

8. The method according to claim 7, characterized in that: The method for detecting whether the unit type of the SNP site Ta-4B-SNP in the wheat genome is GG or CC comprises the following steps: using the wheat genome to be tested as a template, performing a KASP reaction with the PCR reagent described in claim 5 to obtain the unit type.

9. A method for breeding long-root wheat, comprising the following steps: breeding wheat of the Ta-4B-SNP locus unit type GG as described in claim 7 or 8.

Images