Primer and method for identifying variety of geosmin olfactory algae in environmental water body

Abstract

The invention discloses a primer and an identification method for identifying the variety of geosmin olfactory algae in an environmental water body, the method comprises the following steps: reacting cells in the water body with acrylamide to prepare single-cell gel beads, dissolving the single-cell gel beads, and identifying the algae species by adopting a three-step PCR (Polymerase Chain Reaction), namely an intracellular fusion gene technology (epicPCR), the sequence of the fusion PCR primer is SEQ ID NO.1-3; the sequence of the nested PCR reaction primer is SEQ ID NO. 6-7; performing gene sequencing on a nested PCR reaction product, and comparing with an NCBI (National Center of Biotechnology Information) database to obtain the type of the algae carrying the geoA gene for producing the geosmin in the water body. According to the method, the single cell fusion PCR method for the geosmin olfactory algae is established through selection of primers of the geoA gene and the 16S rRNA gene and optimization of amplification conditions, the connection of the geoA functional gene and the phylogenetic gene can be realized in uncultured single cells, the flux is high, the cost is low, the geosmin olfactory algae in an environmental sample can be accurately identified, and the method has the advantages that the method is simple and convenient to operate, and the application prospect is wide. The sniffing algae in an environmental sample can be specifically recognized.

Description

Technical Field

[0001] The invention relates to an algae identification method, in particular to an olfactory algae identification method, and belongs to the field of biotechnology. Background Art

[0002] The odor problem of drinking water is widely detected in my country, among which the earthy smell caused by geosmin is the main type of odor. However, it is difficult to remove geosmin with conventional drinking water treatment processes, and adding deep treatment processes will increase the treatment cost. In addition, it is difficult to effectively remove geosmin when the concentration is high. Although from a medical point of view, most odor substances are not clearly toxic, trace amounts of odor substances remaining in drinking water will cause consumers to worry about the safety of drinking water. The water flow rate in lake-type water sources is slow and the self-purification capacity of the water body is weak. Therefore, in-situ regulation of odor substances can greatly reduce the treatment needs of water plants and is a more ideal treatment method.

[0003] In lake and reservoir water sources, geosmin is mainly a volatile terpene compound produced by the metabolism of filamentous cyanobacteria, and its odor threshold is only 5-10ng / L. In existing water source lakes and reservoirs, the problem of geosmin exceeding the standard has been increasing and decreasing, and it has appeared more frequently in stages. The current chemical and biological control methods for algae have great limitations. If the water plant sets up deep treatment specifically to reduce the concentration of geosmin, it requires a higher treatment cost, and it is not necessary to use it every day, so in situ control of the growth and odor production of geosmin-producing algae in the water source is a better choice. Accurate identification of geosmin-producing algae is the key to in situ treatment of geosmin problems.

[0004] The identified genera of geosmin-producing algae include Longisporium, Anabaena, Sheathing filamentous algae, Floating filamentous algae, Nostoc, and Oscillatoria, most of which are filamentous cyanobacteria. These cyanobacteria are similar in morphology and difficult to distinguish by conventional microscopic examination. The method of isolating and culturing pure algae alone is highly random and has a low success rate. It is basically impossible to identify the geosmin production of all cyanobacteria in environmental samples.

[0005] Molecular biological methods have the advantages of being rapid, sensitive, high-throughput and capable of early diagnosis, and can study the epigenetic phenomena and functional responses of microorganisms from the essence of life. Existing studies have shown that whether the genome carries the geosmin synthase functional gene (geoA gene) is the key basis for identifying olfactory algae. Quantitative detection of functional genes can detect all geosmin-producing algae in water bodies, but cannot identify different species of geosmin-producing algae.

[0006] Phylogenetic gene (such as 16S rRNA gene) amplicon sequencing based on molecular biology can only be used to identify algal community structure, but cannot specifically identify geosmin-producing algae. Although the results of metagenomic sequencing can be basically spliced ​​into relatively complete genome information, the research objects of metagenomic sequencing are only dominant species, while geosmin-producing algae are usually not dominant species, and low-density geosmin-producing algae can already cause geosmin exceeding the standard. Therefore, the existing molecular biological technology cannot complete the high-throughput accurate identification of geosmin-producing algae in environmental samples.

[0007] Single-cell fusion PCR (epicPCR) is a new molecular biology technology that can connect phylogenetic genes and functional genes in single cells. This technology disperses algae and other microorganisms in water into a single cell or single algae filament system by adding emulsified oil and polyacrylamide. In this system, the phylogenetic gene and geoA gene of the cell or algae filament are connected through fusion PCR and nesting, which can avoid the geoA gene of a certain algae cell or algae filament being connected to the phylogenetic gene of other algae cells or algae filaments. Finally, the amplified products are sequenced and analyzed to obtain the host information corresponding to the functional gene, and the geosmin-producing algae species in the water body are accurately and high-throughput identified.

[0008] Due to the difference in functional genes, the current single-cell fusion PCR method cannot be directly used for the identification and recognition of geosmin-producing algae. Therefore, the present invention establishes a single-cell fusion PCR method for geosmin-producing algae by selecting primers for geoA gene and 16S rRNA gene and optimizing amplification conditions. The present invention designs primers and amplification conditions for fusion PCR and nested PCR for the functional genes of geosmin-producing algae, and accurately identifies geosmin-producing algae (more than 90%). By verifying in environmental samples, the method can be used for the specific identification of geosmin-producing algae in environmental samples. Summary of the invention

[0009] The invention aims to solve the technical problems in the existing identification and recognition of geosmin-producing odor algae, such as the inability to accurately distinguish odor algae species by conventional microscopic examination, the uncultivable algae species by separation and culture methods, the inability to accurately identify odor algae species in water bodies, inaccurate identification, identification deviation, a large amount of non-specific amplification during gel electrophoresis detection for PCR amplification, poor accuracy of identification methods, inability to comprehensively identify and identify geosmin-producing odor algae, and the like. A method for identifying geosmin-producing cyanobacteria species in environmental water bodies is provided. The method of the invention is based on single-cell fusion PCR technology, and accurately identifies and recognizes geosmin-producing odor algae in environmental water bodies. The identification method of the invention connects the geoA functional gene with the phylogenetic gene, and the identification method has high throughput and low cost. The vast majority of geosmin-producing odor algae in environmental samples are accurately identified, and the identification result has high accuracy, and the geosmin-producing odor algae cover a wide range, have complete species, and have low error or missed detection rate. In addition, the method of the invention does not need to use the traditional pure algae separation and culture means, and directly connects genes in environmental sample cells (uncultured cells).

[0010] To achieve the purpose of the present invention, the technical solution of the present invention is as follows:

[0011] In one aspect, the present invention provides a primer for identifying geosmin-producing olfactory algae species in environmental water, comprising:

[0012] a) Fusion PCR reaction primers:

[0013] Fusion PCR forward primer F1: 5′-TCCTAYCARAGAGAAGT-3′, SEQ ID NO. 1;

[0014] Fusion PCR reverse primer R1: 5′-GGTTACCTTGTTACGACTT-3′, SEQ ID NO. 2;

[0015] Fusion PCR bridge primer: 5'-TTACCGCGGCKGCTGGCACCTGCCAATCCTGAAGTCCTTT-3', SEQ ID NO.3;

[0016] b) Nested PCR reaction primers:

[0017] Nested PCR forward primer F2: 5′-TGTGAGTACCCAAGAGG-3′, SEQ ID NO. 6;

[0018] Nested PCR reverse primer R2: 5'-GGACTACHVGGGTWTCTAAT-3', SEQ ID NO.7.

[0019] In particular, it also includes c) Blocking PCR reaction primers:

[0020] Blocking PCR forward primer (Blocking F): 5'-TTTTTTTTTTGTGYCAGCMGCCGCGGTAA-3', SEQ ID NO. 4;

[0021] Blocking PCR reverse primer (BlockingR): 5'-TTTTTTTTTTTTACCGCGGCKGCTGRCAC-3', SEQ ID NO.5.

[0022] In particular, the primers are screened as follows:

[0023] 1) Targeting the geoA end of the olfactory gene of geosmin-producing algae, consult the literature and search for primers targeting the geoA gene;

[0024] 2) Primers were designed using Primer Premier 5 for the geoA gene sequences of three typical geosmin-producing olfactory algae included in NCBI, wherein the primer length was controlled to be between 16 and 24 bp, and the GC content was between 40% and 60%. The geoA gene sequences of the three typical algae in NCBI are as follows:

[0025] HQ404997.1Anabaena ucrainica CHAB2155 geosmin synthesis operon, complete sequence;

[0026] LC739811.1Dolichospermum planctonicum B-18geoA gene for geosminsynthase, partial cds;

[0027] MK124614.1Nostoc sp.TURKEYGEO1 geosmin synthase gene,partial cds;

[0028] 3) Primers covering at least two genotypes were screened out; and primer pairs 173AF and 173AR with high coverage of geosmin-producing cyanobacteria were obtained by BLAST comparison of the screened primer pairs in NCBI, wherein the base sequence of the standard genotype corresponding to primer 173A is SEQ ID NO.9; the base sequences of primers 173AF and 173AR are: SEQ ID NO.6, SEQ ID NO.10.

[0029] In particular, it also includes using the screened primers to perform PCR amplification on eight olfactory genotypes that have two or more base differences from the screened primers, and performing gel electrophoresis on the PCR amplification products to verify that the primer pairs 173AF and 173AR obtained by the screening are feasible and have the greatest coverage of geosmin-producing cyanobacteria.

[0030] In particular, the sequence numbers of the eight olfactory genotypes in NCBI and their positions in the sequence are as follows:

[0031]

[0032] In another aspect, a method for identifying geosmin-producing olfactory algae species in an environmental water body is provided, comprising the following steps performed in order:

[0033] A. Preparation of Cellular Gel Beads for Environmental Water Samples

[0034] A-1) Mixing the collected environmental water sample, acrylamide solution and ammonium persulfate solution, and then adding STT emulsified oil; then adding tetramethylethylenediamine, mixing, and allowing to stand for polymerization of acrylamide to prepare a polyacrylamide-cell beads mixture that encapsulates algae cells in the water body;

[0035] A-2) washing the polyacrylamide-cell beads mixture with water-saturated ether and ultrapure water in sequence, adding 1×TK buffer to the polyacrylamide-cell beads to form a polyacrylamide-cell beads TK suspension, and then filtering with a cell filter to obtain a purified polyacrylamide-cell beads TK suspension;

[0036] B. Cell lysis

[0037] Add lysozyme to the purified polyacrylamide-cell gel beads TK suspension to dissolve the cell wall of the algae cells, then add proteinase K and TritonX-100 to remove the histones bound to the nucleic acid by enzymatic hydrolysis, free the algae cell DNA, and destroy the algae cell membrane, so that the algae cell genome is exposed in the polyacrylamide gel beads shell, and obtain cell-dissolving polyacrylamide-cell gel beads;

[0038] C. epicPCR treatment (i.e. three-step PCR reaction)

[0039] Using cell lysis polyacrylamide-cell beads as templates, fusion PCR reaction, blocking PCR reaction and nested PCR reaction were carried out in sequence; and the obtained nested PCR reaction products were sequenced, and the amplified fragment between the bridging primer of the fusion PCR and the nested reverse primer in the product was the target 16S rRNA gene, that is, the cyanobacterial species information carrying the geoA gene. The amplified 16S rRNA gene was compared with the genome sequence of the NCBI database to obtain the algae carrying the geoA gene for producing geosmin, that is, the cyanobacterial species producing geosmin in the environmental water body were identified.

[0040] In particular, the STT emulsified oil in step A-1) is prepared according to the following method: Span-80, Tween-80 and TritonX-100 are dissolved in mineral oil, wherein the volume fraction of Span-80 is 4.5%, the volume fraction of Tween-80 is 0.4%, and the volume fraction of TritonX-100 is 0.05%.

[0041] In particular, the cell concentration in the environmental water sample in step A-1) is: the number of cells contained in 30 μl of the water sample is ≤ 14 million, preferably the number of cells contained in 30 μl of the water sample is 10-14 million.

[0042] In particular, the environmental water sample is prepared according to the following method:

[0043] A-1-1) filtering the collected environmental water with a 1.2 μm filter membrane, collecting the cells on the filter membrane with ultrapure water, and preparing a water sample cell suspension;

[0044] A-1-2) Preheat the water sample cell suspension and the ATP extractant at (38±1)°C for at least 1 min respectively; then mix the preheated water sample cell suspension and the ATP extractant, and heat them at (38±1)°C for another 20-30s, and then measure the bioluminescence A of the mixture;

[0045] A-1-3) Substituting the measured bioluminescence into the ATP-bioluminescence intensity standard curve to calculate the ATP concentration of the water sample cell suspension;

[0046] A-1-4) According to the average ATP mass per cell is 10 -16 g standard, calculate the number of cells in the water sample cell suspension; where:

[0047] If the cell concentration in the water sample cell suspension is measured to be ≤14 million cells in 30 μl of water sample, the water sample cell suspension is directly used as the environmental water sample;

[0048] If the measured cell concentration in the water sample cell suspension is that the number of cells contained in 30 microliters of water sample is >14 million, the water sample cell suspension is diluted, the bioluminescence of the diluted water sample cell suspension and the ATP extractant mixture is measured, and the number of cells in the diluted water sample cell suspension is recalculated according to the ATP-bioluminescence intensity standard curve until the number of cells contained in 30 microliters of water sample is ≤14 million, and then the diluted water sample cell suspension is used as the environmental water sample.

[0049] In particular, the environmental water body in step A-1) is water from a reservoir, lake, river or ocean. The cyanobacteria cells in the environmental water body sample are filtered and enriched on the filter membrane.

[0050] In particular, in step A-1-2), a GloMax 20 / 20 luminometer is used to measure the bioluminescence of the mixed solution; the volume ratio of the aqueous cell suspension to the ATP extractant is 10:1, usually 500 μL of the aqueous cell suspension and 50 μL of the ATP extractant.

[0051] In particular, the ATP-bioluminescence intensity standard curve in step A-1-3) is drawn as follows:

[0052] A-1-3-1) diluting the pure ATP standard solution with sterile water without ATP (adenosine triphosphate) to different concentration gradients (usually 0.00005-1 nM, preferably 0.00005, 0.00001, 0.0001, 0.001, 0.01, 0.1, 1 nM) to obtain ATP dilution solution;

[0053] A-1-3-2) Preheat ATP diluents of different concentrations and ATP extractants at (38±1)°C for at least 1 minute; then mix the preheated ATP diluents of different concentrations with the ATP extractants, and heat them at (38±1)°C for 20-30 seconds; then measure the bioluminescence (A) of the ATP diluents of different concentrations;

[0054] A-1-3-3) Using the logarithm of the ATP concentration (B) of the ATP dilution as the abscissa and the logarithm of the bioluminescence intensity (A) as the ordinate, a standard curve (1) of ATP concentration and bioluminescence intensity is drawn, i.e., the ATP-bioluminescence intensity standard curve.

[0055] log A= k × log B + b (1)

[0056] In formula (1), A is the bioluminescence intensity; B is the ATP concentration, mol / L; k is the slope of the standard curve, k = 0.7501; b is the intercept of the standard curve, b = 12.943; R 2 =0.971,p<0.01.

[0057] In particular, the ATP standard solution has a concentration of 10 mM; Promega Corporation.

[0058] In particular, in step A-1-3-2), the volume ratio of ATP diluent to ATP extractant is 10:1, usually 500 μL of ATP diluent and 50 μL of ATP extractant; the bioluminescence is measured using a luminometer (GloMax 20 / 20, Turner Bio-systems, Sunnyvale, CA, USA).

[0059] Among them, the volume ratio of the environmental water sample, acrylamide solution and ammonium persulfate solution in step A-1) is 30:200:25, usually the volume of the environmental water sample is 30 μL; the volume of the acrylamide solution is 200 μL; the volume of the ammonium persulfate solution is 25 μL; after adding STT emulsified oil, vortex treatment is carried out until the liquid is milky white, so that the cells in the water sample are fully dispersed, and the added emulsified oil and polyacrylamide fully wrap the single cells.

[0060] In particular, the acrylamide aqueous solution is prepared according to the following method: acrylamide and BAC (N,N'-methylenebisacrylamide) are dissolved in sterile water, wherein the mass-volume percentage concentrations of acrylamide and BAC are 12% and 0.32%, respectively, for example, 12 g acrylamide and 0.32 g BAC are dissolved in 100 ml of sterile water.

[0061] The mass percentage concentration of acrylamide in the acrylamide solution is 10-15%; the mass percentage concentration of BAC is 0.3-0.4%, which are both applicable to the present invention; the mass percentage concentration of ammonium persulfate solution is 5-15%, which are both applicable to the present invention.

[0062] In particular, the mass percentage concentration of the ammonium persulfate aqueous solution is 10%, and it is prepared according to the following method: dissolving ammonium persulfate in sterile water, wherein the mass fraction of ammonium persulfate is 10%.

[0063] The volume ratio of the environmental water sample to the STT emulsified oil is 30:600, and usually the volume of the environmental water sample is 30 μL; the volume of the STT emulsified oil is 600 μL.

[0064] In particular, the STT emulsified oil is prepared according to the following method: Span-80, Tween-80 and TritonX-100 are dissolved in mineral oil and stirred to mix, wherein the volume fraction of Span-80 is 4.5%, the volume fraction of Tween-80 is 0.4%, and the volume fraction of TritonX-100 is 0.05%.

[0065] The volume ratio of the environmental water sample to tetramethylethylenediamine is 30:25. Usually, the volume of the environmental water sample is 30 μL; the volume of tetramethylethylenediamine is 25 μL.

[0066] In particular, after standing at room temperature for at least 90 minutes, tetramethylethylenediamine catalyzes the polymerization of acrylamide into polyacrylamide, and polyacrylamide and ammonium persulfate become a shell that wraps the single cell, forming polyacrylamide beads that wrap the single cell.

[0067] In particular, the 1×TK buffer in step A-2) is prepared by mixing 40 mmol / L Tris-HCl (pH 7.5) and 120 mmol / L potassium chloride solution in a volume ratio of 1:1.

[0068] In particular, the water-saturated ether washing and ultrapure water washing in step A-2) are carried out as follows: water-saturated ether is added to the polyacrylamide-cell gel beads mixture, mixed, and the upper layer compound is removed; then ultrapure water is added to the lower precipitate to perform ultrapure water washing, that is, ultrapure water is added to the lower mixed layer containing polyacrylamide-cell gel beads, mixed, centrifuged, and the upper layer mixed solution is removed; then ultrapure water is added to the lower precipitate layer, mixed, centrifuged, and the upper layer mixed solution is removed; the ultrapure water is then added to the lower precipitate layer, mixed, centrifuged, and the upper layer mixed solution is removed; the addition of ultrapure water is repeated for ultrapure water washing 2-4 times to obtain an ultrapure water-washed polyacrylamide-cell gel beads mixture.

[0069] Particularly, the polyacrylamide-cell beads TK suspension is filtered through a 35 μm cell filter using a syringe, and the polyacrylamide-cell beads are filtered into a new centrifuge tube to obtain the purified polyacrylamide-cell beads TK suspension.

[0070] In particular, the 1×TK buffer solution is prepared by mixing 40 mmol / L Tris-HCl (pH 7.5) and 120 mmol / L potassium chloride solution in a volume ratio of 1:1. The mixed solution is filtered through a 0.2 micron filter membrane before use.

[0071] In particular, in step A-2), during the washing process of adding ultrapure water, the mixture is mixed and centrifuged, and the upper layer is a water-oil mixture, and the lower layer is a layer containing polyacrylamide-cell beads.

[0072] In particular, after adding lysozyme in step B), the mixture is incubated at 37±1°C for 8-12 hours and then centrifuged to remove the supernatant; 1×TK buffer is then added to resuspend the beads and then the proteinase K and TritonX-100 are added.

[0073] In step B), after adding proteinase K and TritonX-100, the mixture is incubated at (37±1)°C for 30-45 minutes; then, the mixture is incubated at (95±1)°C for 10-20 minutes, centrifuged, and the supernatant is removed; then, 1×TK buffer is added to resuspend the beads to obtain cell-lysing polyacrylamide-cell beads.

[0074] In particular, the enzyme activity of the lysozyme is 4000U / μL; the concentration of the proteinase K is 1mg / mL.

[0075] In particular, proteinase K and TritonX-100 are added repeatedly 2-3 times to enzymatically remove histones bound to nucleic acids, free algae cell DNA, and destroy algae cell membranes.

[0076] In particular, after adding lysozyme, the mixture is cultured overnight at 37°C and centrifuged, and then the supernatant after centrifugation is removed; 1×TK buffer is added to the lower layer of the centrifugation, and the polyacrylamide beads are resuspended to obtain a lysozyme-dissolved polyacrylamide bead suspension;

[0077] In particular, proteinase K and TritonX-100 are added to the lysozyme-dissolved polyacrylamide bead suspension, and the suspension is incubated at 37°C for 30-40 minutes, and then at 95°C for 10-20 minutes; the suspension is then centrifuged and the supernatant is removed; and then 1×TK buffer is added to the lower layer of the centrifuge to resuspend the polyacrylamide beads to obtain a cell-dissolving polyacrylamide bead resuspension.

[0078] In particular, the epic-PCR treatment described in step C) is performed in the following order of steps:

[0079] C-1) Fusion PCR reaction

[0080] A fusion PCR reaction was performed using cell lysis polyacrylamide-cell beads as a template to obtain a fusion PCR reaction product, i.e., fusion PCR purified DNA, wherein the primers for the fusion PCR reaction are:

[0081] Fusion PCR forward primer F1 (geo_cya728F): 5′-TCCTAYCARAGAGAAGT-3′;

[0082] Fusion PCR reverse primer R1 (1492R): 5′-GGTTACCTTGTTACGACTT-3′;

[0083] Fusion PCR bridge primer (515R-173AR): 5′-TTACCGCGGCKGCTGGCACCTGCCAATCCTGAAGTCCTTT-3′;

[0084] C-2) Blocking PCR reaction

[0085] Performing a Blocking PCR reaction using the fusion PCR product as a template to obtain a Blocking PCR reaction product, namely, Blocking PCR purified DNA;

[0086] C-3) Nested PCR reaction

[0087] The blocking PCR reaction product was used as a template to perform a nested PCR reaction to obtain a nested PCR amplification product; wherein the primers for the nested PCR reaction are:

[0088] Nested PCR forward primer F2 (173AF): 5′-TGTGAGTACCCAAGAGG-3′;

[0089] Nested PCR reverse primer R2 (806R): 5'-GGACTACHVGGGTWTCTAAT-3'.

[0090] In particular, the fusion PCR reaction in step C) further includes adding ABIL oil to the fusion PCR reaction system, mixing evenly, and then performing a fusion PCR amplification reaction, wherein the ABIL oil is prepared according to the following method: EM90 and TritonX-100 are dissolved in mineral oil, wherein the volume percentage concentration of EM90 is 4%; the volume percentage concentration of TritonX-100 is 0.05%.

[0091] In particular, the volume ratio of the fusion PCR reaction system to the ABIL oil is 1:9, and usually the volume of the fusion PCR reaction system is 100 μL; the volume of the ABIL oil is 900 μL.

[0092] In particular, the fusion PCR reaction system is: 2×HI-FIPCR Mix 50 μL, forward primer (concentration of 50 μM, 2 μL), reverse primer (concentration of 50 μM, 2 μL), bridging primer (concentration of 1 μM, 1 μL), template (cell lysis polyacrylamide-cell beads prepared in step C, 45 μL).

[0093] In particular, the fusion PCR amplification program was: pre-denaturation stage at 95°C for 5 min; high temperature denaturation at 95°C for 25 s; low temperature annealing at 56°C for 25 s; extension stage at 68°C for 2 min, a total of 35 cycles, and a final extension stage at 68°C for 5 min.

[0094] In particular, the method further includes step C-1), wherein the fusion PCR reaction product is cleaned, that is, after the fusion PCR amplification reaction is completed, EDTA with a final concentration of 1 mM is added to the fusion PCR reaction product system to obtain a fusion PCR product emulsified system; the fusion PCR product emulsified system is then centrifuged to remove the upper oil phase; the lower aqueous phase is then cleaned with water-saturated ether and water-saturated ethyl acetate respectively; and the polyacrylamide beads obtained after the solvent cleaning are used to release the cell DNA and then cleaned with magnetic beads to obtain the fusion PCR purified DNA.

[0095] In particular, the solvent cleaning treatment is to add water-saturated ether and water-saturated ethyl acetate in sequence, and then centrifuge and discard the upper liquid.

[0096] In particular, the magnetic bead cleaning (DNA purification by AMPure XP beads) is performed according to the following steps: AMPure XP magnetic beads are fully shaken and balanced to room temperature (i.e., placed at room temperature for 10-30 minutes); AMPure XP magnetic beads balanced to room temperature are added to a centrifuge tube containing polyacrylamide beads to release cell DNA, wherein 85.5 μL of magnetic beads are added to each 100 μL of polyacrylamide beads to release cell DNA sample, gently mixed, and placed at room temperature for at least 10 minutes; the centrifuge tube is placed on a magnetic bead magnetic cleaning rack for 2-5 minutes, the centrifuge tube is kept on the magnetic rack, and the suspension in the centrifuge tube is sucked out with a pipette and discarded; the magnetic beads are then washed with 70% ethanol for 2-5 times, and then the centrifuge tube cover is opened and air-dried for 15-30 minutes until the surface of the magnetic beads is dry; then the centrifuge tube is removed, and sterile water is added to the centrifuge tube, gently mixed, and placed at room temperature for 7-15 minutes; finally, the centrifuge tube is placed on a magnetic bead magnetic cleaning rack for 2-5 minutes to collect the suspension; and fusion PCR purified DNA is obtained.

[0097] In particular, the primers for the Blocking PCR reaction in step C-2) are:

[0098] Blocking PCR forward primer (BlockingF): 5′-TTTTTTTTTTGTGYCAGCMGCCGCGGTAA-3′;

[0099] Blocking PCR reverse primer (BlockingR): 5'-TTTTTTTTTTTTACCGCGGCKGCTGRCAC-3'.

[0100] In particular, the Blocking PCR reaction system was: 2×PCR Taq MasterMix with dye (50 μL), forward primer (concentration of 100 μM, 3.2 μL), reverse primer (concentration of 100 μM, 3.2 μL), template (fusion PCR purified DNA, 40 μL), and ddH2O (3.6 μL).

[0101] In particular, the Blocking PCR amplification program is: pre-denaturation stage at 95°C for 5 minutes; high temperature denaturation at 95°C for 45 seconds; low temperature annealing at 55°C for 45 seconds; extension stage at 72°C for 1 minute, a total of 35 cycles. The final extension stage is 72°C for 10 minutes.

[0102] In particular, the method further comprises step C-2-1): performing magnetic bead washing treatment on the Blocking PCR amplification reaction product system: placing the centrifuge tube containing the Blocking PCR reaction product system on a magnetic bead magnetic washing rack, keeping the centrifuge tube on the magnetic rack, and using a pipette to suck out the suspension in the centrifuge tube and discarding it; then washing the magnetic beads with 70% ethanol for 2-5 times, and then opening the centrifuge tube cover and air-drying for 15-30 minutes until the surface of the magnetic beads is dry; then removing the centrifuge tube, adding sterile water to the centrifuge tube, gently mixing, and placing at room temperature for 7-15 minutes; finally placing the centrifuge tube on the magnetic bead magnetic washing rack for 2-5 minutes, collecting the suspension, and obtaining Blocking PCR purified DNA.

[0103] Blocking PCR removes unfused DNA fragments to prevent them from continuing to amplify in nested PCR, that is, DNA fragments that have not achieved the connection between geoA gene and 16s gene are removed by subsequent magnetic bead washing after binding with blocking primers. The purpose of magnetic bead washing is to remove non-DNA components or short DNA fragments to prevent them from affecting subsequent PCR.

[0104] In particular, the nested PCR reaction system in step C-3) is: 2×PCR Taq MasterMix with dye (50 μL), forward primer (concentration of 20 μM, 3 μL), reverse primer (concentration of 20 μM, 3 μL), template (Blocking PCR purified DNA, 40 μL), ddH2O (4 μL).

[0105] In particular, the nested PCR amplification program was as follows: pre-denaturation stage at 95°C for 5 min, high temperature denaturation at 95°C for 45 s, low temperature annealing at 56°C for 45 s, extension stage at 72°C for 1 min, 40 cycles in total, and final extension stage at 72°C for 10 min.

[0106] Fusion PCR obtains a long fragment connecting the 16S rRNA gene and the geoA gene, and nested PCR selects two primers for the geoA gene and the 16S rRNA gene respectively to amplify the middle DNA. On the one hand, it increases the yield of the amplified product, and on the other hand, it shortens the length of the amplified fragment compared to fusion PCR for subsequent high-throughput sequencing.

[0107] The purpose of nested PCR is to shorten the length of the fusion PCR product. A primer is selected in the middle of the geoA gene and the middle of the 16S rRNA gene to amplify the middle part. After shortening the length, the next step of high-throughput sequencing is continued, otherwise the fragment is too long. The product is a fragment from 173AF to 806R.

[0108] Compared with the prior art, the present invention has the following advantages and benefits:

[0109] 1. The primers for fusion PCR and nested PCR reactions screened by the present invention have high specificity and can be used for accurate identification and characterization of geosmin-producing olfactory algae through sequencing verification.

[0110] 2. The method of the present invention was applied to environmental samples of Yuqiao Reservoir in my country. The sequencing results showed that the method can realize the connection between the functional gene (geoA gene) and the 16S gene, thereby achieving the purpose of identifying geosmin-producing olfactory algae.

[0111] 3. Compared with pure algae isolation and identification and metagenomic methods, this method has low cost and high throughput, and can achieve accurate identification of geosmin-producing algae in environmental samples.

[0112] The traditional method of identifying geosmin-producing cyanobacteria in water bodies is to isolate and culture pure algae and detect geosmin. Due to the large number of cyanobacteria in water bodies and the existence of uncultivable algae, this method is relatively random, with a low success rate and poor accuracy of identification results. It is basically impossible to isolate all cyanobacteria in environmental samples and identify the production of geosmin. Metagenomic sequencing is only a research object for dominant species, and is not suitable for olfactory algae that are not usually dominant species.

[0113] Since the method of the present invention connects the geoA gene and the phylogenetic gene in uncultured cells, it is not limited by whether the cells are culturable and can be used to identify most geosmin-producing olfactory algae. BRIEF DESCRIPTION OF THE DRAWINGS

[0114] Figure 1 The microscopic observation images of polyacrylamide-cell beads prepared in Example 3; A is a picture of cyanobacteria cells wrapped by oil droplets under sunlight; B is a red light observation picture, in which cyanobacteria have chlorophyll and fluorescence can be seen;

[0115] Figure 2 The gel electrophoresis diagram of the PCR amplification products of the eight olfactory genotype plasmids in Example 5;

[0116] Figure 3 The gel electrophoresis diagram of the product amplified using the primers of the present invention from the Yuqiao Reservoir sample in Example 6;

[0117] Figure 4 This is the gel electrophoresis diagram of the products amplified using the same forward primer 173AF in fusion PCR and nested PCR in Example 6A;

[0118] Figure 5 This is the gel electrophoresis of the product amplified using the same forward primer geo_cya728F in fusion PCR and nested PCR in Example 6B;

[0119] Figure 6 This is the gel electrophoresis of the product processed by epic-PCR in Example 6C, wherein the forward primer of fusion PCR is geo_cya728F; the same forward primer used in nested PCR is 173AF. DETAILED DESCRIPTION

[0120] The present invention will be further described below in conjunction with specific embodiments, and the advantages and features of the present invention will become clearer as the description proceeds. However, these embodiments are exemplary only and do not constitute any limitation to the scope of the present invention. It should be understood by those skilled in the art that the details and forms of the technical solution of the present invention may be modified or replaced without departing from the spirit and scope of the present invention, but these modifications and replacements all fall within the scope of protection of the present invention.

[0121] Reagents: acrylamide, BAC (N,N'-bis(acryloyl)cystamine), ammonium persulfate, Tris-HCl (PH 7.5), potassium chloride, EM90, Span-80, Tween-80, TritonX-100, mineral oil, tetramethylethylenediamine (TEMED), ether, lysozyme, proteinase K, EDTA (ethylenediaminetetraacetic acid) ethyl acetate, and anhydrous ethanol were purchased from Sigma, St. Louis, MO, USA; AMPure XP magnetic beads (Beckman Coulter, Danvers, MA, USA)

[0122] Instruments and equipment: GloMax 20 / 20 luminometer (Turner Bio-systems, Sunnyvale, CA, USA); BacTiter-GloTM kit (G8231, Promega Corporation, Dübendorf, CH); magnetic bead cleaning magnetic stand (DynaMag TM -2,invitrogen)

[0123] Example 1 Drawing a standard curve of ATP concentration and bioluminescence intensity

[0124] 1. Dilute the ATP standard solution (10 mM, Promega Corporation) with sterile water without ATP to form 7 different concentrations (i.e., 0.00005-1 nM, usually 0.00005, 0.00001, 0.0001, 0.001, 0.01, 0.1, 1 nM) of ATP dilution solution.

[0125] 2. Preheat ATP diluents of different concentrations and the ATP extractant in the BacTiter-GloTM kit at 38°C for 1 min. Then, take 500 μL of the preheated ATP diluents of different concentrations, add 50 μL of the ATP extractant, mix, heat at 38°C for 20 s, and then take out immediately. Then, use GloMax 20 / 20 (Turner Bio-systems, Sunnyvale, CA, USA) luminometer to measure the bioluminescence (A) of each ATP dilution.

[0126] 3. Use the logarithm of the ATP concentration (B) of the ATP dilution solution as the horizontal axis and the logarithm of the bioluminescence intensity (A) as the vertical axis to draw a standard curve (1) of ATP concentration and bioluminescence intensity, i.e., the ATP-bioluminescence intensity standard curve.

[0127] log A= k × log B + b (1)

[0128] In formula (1), A is the bioluminescence intensity; B is the ATP concentration, mol / L; k is the slope of the standard curve, k = 0.7501; b is the intercept of the standard curve, b = 12.943; R 2 =0.971,p<0.01.

[0129] Example 2 Preparation of water-like cell suspension

[0130] In November and December 2023, samples were collected from 8 points in Yuqiao Reservoir, Tianjin, including the east, southeast, south, center, north, west, release hole and Fengshan. A total of 16 samples were collected. 300 ml of the collected water samples were taken and 1.2

[0131] μm filter membrane (RTTP04700, 1.2 μm polycarbonate membrane, IsoporeTM, USA), the cyanobacterial cells in the water sample were retained and enriched on the filter membrane, and then used The SPIN Kit for Soil was used to extract the DNA on the filter membrane of each water sample; and each collected water sample (10 ml) was taken for GC-MS detection.

[0132] After GC-MS testing, the concentration of geosmin in the water samples from each collection point reached 10 ng / L, and after quantitative PCR testing, the concentration of geoA gene reached 10 5 copies / L. GC-MS and quantitative PCR tests showed that the collected environmental samples were positive samples.

[0133] The results of GC-MS and quantitative PCR showed that the concentrations of geosmin and geoA genes in the reservoir core sample (sample A) collected in November and the reservoir south sample (sample B) collected in December were higher than those in water samples from other sites of Yuqiao Reservoir.

[0134] The water samples (300 mL for each water sample) collected from Yuqiao Reservoir were filtered using a 1.2 μm filter membrane (RTTP04700, 1.2 μm polycarbonate membrane, IsoporeTM, USA). The cyanobacterial cells in the water samples were filtered and enriched on the filter membrane. The cells on the filter membrane were then washed with ultrapure water and collected in a centrifuge tube to obtain a water sample cell suspension (10 ml).

[0135] In addition to using RTTP04700, 1.2 μm polycarbonate membrane to filter and enrich the cyanobacteria cells in the aqueous solution of the present invention as an example, other 1.2 μm filter membranes are also suitable for the present invention, such as PVDF (polyvinylidene fluoride) filter membranes.

[0136] 2. Preheat the water sample cell suspension and the ATP extractant in the BacTiter-GloTM kit at 38°C for at least 1 minute. Then take 500 μL of the preheated water sample cell suspension, add 50 μL of ATP extractant to each, mix, heat at 38°C for 20 seconds, and then take out immediately. Then place it in a GloMax 20 / 20) luminometer to measure the bioluminescence (A) of the water sample cell suspension.

[0137] 3. The bioluminescence (A) of the water sample cell suspension was inserted into the ATP-bioluminescence intensity standard curve (1) drawn in Example 1 to calculate the ATP concentration of the water sample cell suspension; and then the average ATP mass per cell was 10 -16 g standard, and calculate the number of cells in the water sample cell suspension.

[0138] If the number of cyanobacterial cells in each 30 μl of the water sample cell suspension measured is ≤ 14 million, in obtaining the water sample cell suspension for preparing acrylamide-cell beads;

[0139] If the number of cyanobacteria cells in each 30 μl of the water sample cell suspension is ≤ 14 million, add ultrapure water to dilute the water sample cell suspension, and then measure the number of cells in the water sample cell suspension after dilution according to steps 2 and 3), until the number of cells in the 30 μl diluted water sample cell suspension is ≤ 14 million, and obtain the water sample cell suspension for preparing acrylamide-cell beads. Set aside.

[0140] The concentration of cyanobacteria cells in the water sample in this embodiment is as follows: 30 μl of the water sample from Yuqiao Reservoir contains 10 million cyanobacteria cells.

[0141] In order to prevent multiple cells from being encapsulated in subsequent polyacrylamide beads and ensure that each polyacrylamide bead encapsulates a single cyanobacterial cell and fully guarantee the dispersion of single cells, the number of cells needs to be controlled. The number of cells contained in 30 microliters of liquid in the water sample prepared in the present invention is less than 14 million.

[0142] When preparing polyacrylamide beads, about 500 million droplets will be generated (calculated based on an average droplet diameter of 10 μm). If the number of cells is too large, it is easy for multiple geosmin cells to be encapsulated in one polyacrylamide bead, resulting in inaccurate identification results.

[0143] Example 3 Preparation of polyacrylamide-cell beads

[0144] 1. Add the water sample cell suspension (30 μL) prepared in step 3) of Example 2, acrylamide aqueous solution (200 μL), and ammonium persulfate solution (25 μL) into a centrifuge tube, and vortex gently and thoroughly to mix; wherein:

[0145] The acrylamide aqueous solution is prepared as follows: acrylamide and BAC are dissolved in sterile water, wherein the mass-volume percentage concentrations of acrylamide and BAC are 12% and 0.32%, respectively, for example, 12 g acrylamide and 0.32 g BAC are dissolved in 100 ml sterile water;

[0146] The mass percentage concentration of the ammonium persulfate aqueous solution is 10%, and it is prepared according to the following method: dissolving ammonium persulfate in sterile water, wherein the mass percentage of ammonium persulfate is 10%;

[0147] The mass percentage concentration of acrylamide in the acrylamide aqueous solution is 10-15%; the mass percentage concentration of BAC is 0.3-0.4%, which are both suitable for the present invention; the mass percentage concentration of ammonium persulfate aqueous solution is 5-15%, which are both suitable for the present invention.

[0148] 2. Add 600 μL of STT emulsified oil to the centrifuge tube and vortex at 3000 rpm for 30 seconds to prepare a milky white water sample-STT emulsion to be tested, wherein the STT emulsified oil is prepared as follows: Span-80, Tween-80, and TritonX-100 are dissolved in mineral oil, wherein the volume fraction of Span-80 is 4.5%, the volume fraction of Tween-80 is 0.4%, and the volume fraction of TritonX-100 is 0.05%;

[0149] The vortex treatment allows the cells in the sample to be fully dispersed and the added emulsified oil etc. to fully encapsulate the single cells.

[0150] 3. Add 25 μL of tetramethylethylenediamine (TEMED) to the centrifuge tube, vortex at 6,000 rpm for 60 seconds, mix well, and let stand at room temperature for 90 minutes. The tetramethylethylenediamine in the emulsion catalyzes the polymerization of acrylamide into polyacrylamide. Polyacrylamide and ammonium persulfate become the shell that wraps a single cyanobacterial cell, forming polyacrylamide beads that wrap a single cell. The polyacrylamide beads are dispersed in the emulsified oil system to obtain a polyacrylamide-cell beads mixed solution (880 μL);

[0151] Take an appropriate amount of polyacrylamide-cell bead mixture and observe it under a microscope. Figure 1 As shown, A is a picture of cyanobacteria cells wrapped in oil droplets observed under a microscope under conventional daylight; B is a picture observed under a microscope under red light, because there is chlorophyll in the cyanobacteria, fluorescence can be seen.

[0152] 4. Add 800 μL of water-saturated ether (water and ether mixed in a ratio of 1:1) to the centrifuge tube and mix immediately to produce a precipitate; use a pipette to remove the upper layer of the mixture (i.e., a mixture of the emulsified oil mixture and ether), wherein the water-saturated ether is prepared as follows: water and ether are mixed in a volume ratio of 1:1 (they can be mixed in a separatory funnel, but care must be taken to exhaust the air at the right time), and when the obtained mixture is allowed to stand and separate into layers, take the upper layer of liquid (i.e., water-saturated ether).

[0153] The emulsified oil in the polyacrylamide-cell gel beads mixture was washed and removed by water-saturated ether to obtain the polyacrylamide-cell gel beads, in which the polyacrylamide encapsulated the single cyanobacteria cell.

[0154] 5. Add ultrapure water (1 mL) to the centrifuge tube, mix well and transfer all to a new centrifuge tube, centrifuge at 12,000 g for 30 s, aspirate the upper water-oil mixed layer, and keep the lower polyacrylamide-cell beads layer in the centrifuge tube;

[0155] 6. Repeat step 5) washing with ultrapure water for 5 times, until no water-oil mixed layer is formed by adding ultrapure water to wash, to obtain an ultrapure water-washed polyacrylamide-cell gel beads mixed solution, the number of ultrapure water washings is 5 times, usually 4-6 times;

[0156] 7. Aspirate all the residual water in the centrifuge tube without touching the precipitated beads at the bottom of the centrifuge tube; then add 1×TK buffer (1 ml) to suspend the polyacrylamide-cell beads to form a polyacrylamide-cell beads TK suspension, wherein the 1×TK buffer is composed of 40 mmol / L Tris-HCl (pH 7.5) and 120 mmol / L potassium chloride solution, mixed in a volume ratio of 1:1, and the mixture is filtered through a 0.2 micron filter membrane before use.

[0157] 8. Use a syringe to filter the polyacrylamide-cell beads TK suspension through a 35 μm cell filter, and filter the polyacrylamide-cell beads into a new centrifuge tube to obtain the purified polyacrylamide-cell beads TK suspension, which is stored at 4°C for future use.

[0158] Example 4 Cell lysis treatment

[0159] 1. Add lysozyme (70 μL, 4000 U / μL) to the purified polyacrylamide-cell bead TK suspension and culture at 37°C overnight; then centrifuge at 12,000 g × 30 s and remove the supernatant; then add 1×TK buffer (800 μL) and resuspend the beads to obtain a lysozyme-dissolved polyacrylamide bead suspension;

[0160] Lysozyme dissolves the cell wall of the olfactory algae to prevent it from affecting the subsequent PCR amplification.

[0161] 2. Add proteinase K (1 mg / mL, 200 μL) and TritonX-100 (8 μL) to the suspension of lysozyme-dissolved polyacrylamide beads, and incubate at 37°C for 30 min; then incubate at 95°C for 10 min, centrifuge at 12,000 g × 30 s, and remove the supernatant; then add 1×TK buffer (800 μL) to resuspend the beads;

[0162] Proteinase K enzymatically cleaves histones bound to nucleic acids, freeing DNA; TritonX-100 destroys cell membranes.

[0163] 3. Repeat step 2) 2-3 times to obtain cell-lysing polyacrylamide-cell beads.

[0164] The single cell wrapped in the polyacrylamide bead shell undergoes cell lysis in the polyacrylamide shell. Inside the polyacrylamide shell, the cell wall, cell membrane, protein, etc. of the cyanobacterial cell are dissolved, exposing the genome of the cyanobacterial cell in the polyacrylamide shell.

[0165] Cell lysis refers to the dissolution of the cell wall, cell membrane and protein of the olfactory algae to prevent them from affecting the subsequent PCR amplification and obtaining the genome of the cell.

[0166] Example 5 PCR amplification reaction primer screening

[0167] 1. Targeting the geoA end of the olfactory gene of geosmin-producing algae, we consulted the literature and found dozens of primers targeting the geoA gene;

[0168] Primer Premier 5 was used to design primers for the three typical algae geoA gene sequences included in NCBI. The primer length was controlled between 16 and 24 bp and the GC content was between 40% and 60%. The three typical algae geoA gene sequences are as follows:

[0169] HQ404997.1Anabaena ucrainica CHAB2155 geosmin synthesis operon, complete sequence;

[0170] LC739811.1Dolichospermum planctonicum B-18geoA gene for geosminsynthase, partial cds;

[0171] MK124614.1Nostoc sp.TURKEYGEO1 geosmin synthase gene,partial cds.

[0172] Primers that can cover at least two genotypes were screened out, and the screened primers are shown in Table 1.

[0173] Table 1 PCR amplification primers

[0174]

[0175]

[0176] 2. The primer pairs in Table 1 were compared by BLAST (National Center for Biotechnology Information) in NCBI. The coverage of 173AF and 173AR primers for geosmin-producing cyanobacteria was high, among which: the standard genotype corresponding to the 173A primer was: TGTGAGTAC CCAAGAGGCCGCTAACCTCACTAACGAACACTCAACTCCC GTTTATACCAATTTGACAACACTGCTGTCACGGAATTACCCTCTCTTTTTGAGGAGTACG GAGTAGATCCAGTAGAGCGTGTGAATGTTCTCCTTTACATTAAAGGACTTCAGGATTGGC AA, SEQ ID NO.10), and among the more than 90 geoA genotypes included in NCBI, only eight olfactory genotypes corresponding to the 173A primer had two or more base differences with the primers. These eight genotypes are shown in Table 1A.

[0177] Table 1A The sequence numbers of the eight genotypes in NCBI and their positions in the sequence are as follows:

[0178] serial number NCBI sequence number Position in the sequence 1 MK861973.1 756bp-951bp 2 KJ658376.1 673bp-868bp 3 KP268488.1 771bp-961bp 4 LC739810.1 650bp-840bp 5 MF084933.1 771bp-966bp 6 MK213953.1 771bp-956bp 7 MK213956.1 774bp-969bp 8 LC331272.1 1157bp-1352bp

[0179] For these eight genotypes, PUC57 was used as a vector to construct eight plasmids, which were synthesized by Shanghai Sangon Biotechnology Co., Ltd. Eight genotype plasmids corresponding to the eight olfactory base-producing genotypes were obtained, and then the eight genotype plasmids were amplified by ordinary PCR, and the feasibility of the primers (173AF, 173AR primer pair) was verified by gel electrophoresis, and the plasmid sequences corresponded to the eight genotypes.

[0180] Primers for conventional PCR:

[0181] 173AF: 5'-TGTGAGTACCCAAGAGG-3' (SEQ ID NO.6)

[0182] 173AR:5'-CTGCCAATCCTGAAGTCCTTT-3'(SEQ ID NO.11)

[0183] The PCR amplification program is as follows: pre-denaturation stage at 95°C for 5 min; high temperature denaturation at 95°C for 45 s; low temperature annealing at 56°C for 45 s; extension stage at 72°C for 1 min, with a total of 35 cycles. The final extension stage is at 72°C for 5 min.

[0184] The amplified product was verified by gel electrophoresis. Figure 2 , where A is DL500 DNA Marker, and BI are plasmids of 8 genotypes, where BI corresponds to the plasmids corresponding to the eight genotypes numbered 1-8 in Table 1A. Figure 2 It can be seen that except for the olfactory gene in column B, the other 7 genotypes with different bases from the primers all have obvious bands, so the 173A primer can cover most of the common geoA genes. The coverage of other primers is smaller than that of the 173A primer.

[0185] 3. Based on the plasmid verification results corresponding to the eight genotypes, the bridge primers for fusion PCR and the forward primers for nested PCR were screened and determined as follows:

[0186] Bridging primer for fusion PCR: 515R-173AR: 5'-TTACCGCGGCKGCTGGCACCTGCCAATCCTGAAGTCCT TT-3' (SEQ ID NO. 3)

[0187] The forward primer for nested PCR is:

[0188] F2(173AF): 5'-TGTGAGTACCCAAGAGG-3'(SEQ ID NO.6)

[0189] 4. The primers for the three-step PCR reaction for the identification of geosmin-producing olfactory algae species are as follows:

[0190] 4-1) Fusion PCR primers

[0191] Fusion PCR forward primer F1 (geo_cya728F): 5′-TCCTAYCARAGAGAAGT-3′, SEQ ID NO. 1;

[0192] Fusion PCR reverse primer R1 (1492R): 5'-GGTTACCTTGTTACGACTT-3', SEQ ID NO. 2;

[0193] Fusion PCR bridge primer (515R-173AR): 5'-TTACCGCGGCKGCTGGCACCTGCCAATCCTGAAGTCCTTT-3', SEQ ID NO. 3;

[0194] 4-2) Blocking PCR primers:

[0195] Blocking PCR forward primer (BlockF): 5′-TTTTTTTTTTGTGYCAGCMGCCGCGGTAA-3′, SEQ ID NO. 4;

[0196] Blocking PCR reverse primer (BlockR): 5'-TTTTTTTTTTTTACCGCGGCKGCTGRCAC-3', SEQ ID NO. 5;

[0197] 4-3) Nested PCR primers

[0198] Nested PCR forward primer F2 (173AF): 5'-TGTGAGTACCCAAGAGG-3', SEQ ID NO. 6;

[0199] Nested PCR reverse primer R2 (806R): 5'-GGACTACHVGGGTWTCTAAT-3', SEQ ID NO.7.

[0200] Example 6 PCR amplification reaction

[0201] The positive samples from environments labeled A and B were identified as producing olfactory algae species according to the following method, where: A and B were respectively the water samples collected from the center of Yuqiao Reservoir in November 2023 and the water samples collected from the south of Yuqiao Reservoir in December 2023, in which GC-MS and quantitative PCR tests in Example 2 showed that the geosmin concentration and geoA gene concentration in the water samples were higher than those at other sampling points of Yuqiao Reservoir.

[0202] 1. Fusion PCR reaction

[0203] 1A. Using the cell-dissolved polyacrylamide-cell beads of the sample collected from the center of Yuqiao Reservoir in November 2023 (sample A) obtained in Example 4 and the water sample collected from the south of Yuqiao Reservoir in December 2023 (sample B) as templates, the fusion PCR reaction was performed with the primers screened in Example 5, wherein: the fusion PCR primers are as follows:

[0204] Forward primer F1 (geo_cya728F): 5'-TCCTAYCARAGAGAAGT-3' (SEQ ID NO.1)

[0205] Reverse primer R1 (1492R): 5'-GGTTACCTTGTTACGACTT-3' (SEQ ID NO. 2)

[0206] Bridging primer (515R-173AR): 5'-TTACCGCGGCKGCTGGCACCTGCCAATCCTGAAGTCCTTT-3'

[0207] The fusion PCR reaction system was: 2×HI-FIPCR Mix 50 μL, forward primer (concentration of 50 μM, 2 μL), reverse primer (concentration of 50 μM, 2 μL), bridging primer (concentration of 1 μM, 1 μL), template (cell lysis polyacrylamide-cell beads, 45 μL);

[0208] 1B. Add ABIL oil (900 μL) to the fusion PCR reaction system, vortex at 3000 rpm for 1 min, mix well, and prepare a fusion PCR reaction system; then perform a fusion PCR amplification reaction according to the fusion PCR amplification procedure to obtain a fusion PCR reaction product system, wherein:

[0209] ABIL oil was prepared as follows: EM90 (emulsifier, cetyl polyethylene glycol) and TritonX-100 were dissolved in mineral oil, wherein the volume percentage concentration of EM90 was 4%; the volume percentage concentration of TritonX-100 was 0.05%;

[0210] The fusion PCR amplification program is as follows: pre-denaturation stage at 95°C for 5 min; high temperature denaturation at 95°C for 25 s; low temperature annealing at 56°C for 25 s; extension stage at 68°C for 2 min, for a total of 35 cycles. Final extension stage at 68°C for 5 min;

[0211] 1C. After the fusion PCR amplification reaction is completed, EDTA with a final concentration of 1 mM is added to the fusion PCR reaction product system to prepare a fusion PCR product emulsification system.

[0212] 2. Cleaning of Fusion PCR Products

[0213] 2A. Solvent Cleaning

[0214] The fusion PCR product emulsified system was centrifuged at room temperature for 13,000 g × 5 min, and the upper oil phase was discarded; then, water-saturated ether (water and ether mixed in a ratio of 1:1) was added to the lower liquid phase (DNA mixed solution), and the mixture was centrifuged at 13,000 g × 1 min to perform ether washing; after the upper layer was discarded, water-saturated ethyl acetate (water and ethyl acetate mixed in a ratio of 1:1) was added to the lower liquid phase, and the mixture was centrifuged at 13,000 g × 1 min to perform ethyl acetate washing, and the upper layer was discarded, that is, two solvent (water-saturated ether, water-saturated ethyl acetate) washing treatments were performed to remove the emulsified oil and the polyacrylamide shell, and the upper liquid phase was discarded; the lower liquid phase (DNA mixed solution) was evaporated in a fume hood to allow the residual ether and ethyl acetate to evaporate, and polyacrylamide beads were obtained to release the cell DNA;

[0215] That is: the fusion PCR product emulsified system is centrifuged at room temperature at 13,000g×5min, and the upper oil phase is discarded; then 1mL of water-saturated ether (water and ether are mixed in a ratio of 1:1) is added to the fusion PCR product in the lower layer of the centrifuge, and the mixture is immediately mixed, centrifuged at 13,000g×1min, and the upper liquid phase is discarded, and this step is repeated once; then 1mL of water-saturated ethyl acetate (water and ethyl acetate are mixed in a ratio of 1:1) is added, and the centrifuge tube is immediately inverted to mix, centrifuged at 13,000g×1min, and the upper liquid phase is discarded, and this step is repeated once; the lower liquid phase (DNA mixed solution) is placed in a fume hood for 10min to allow the residual ether and ethyl acetate to evaporate, and the product is collected to obtain polyacrylamide beads to release cellular DNA.

[0216] In the present invention, both water-saturated ether and water-saturated ethyl acetate are used to further clean the emulsified oil and the polyacrylamide shell. Water and ether are mixed in a volume ratio of 1:1 (they can be mixed in a separatory funnel, but it is important to exhaust the air in time). When the obtained mixture is allowed to stand and separate, the organic phase is a water-saturated solution of ether, and the aqueous phase is a water-saturated solution of ether.

[0217] 2B. Magnetic bead cleaning (DNA purification by AMPure XP beads)

[0218] First: shake AMPure XP magnetic beads (Beckman Coulter, Danvers, MA, USA) thoroughly and equilibrate to room temperature (i.e., place at room temperature for 10-30 min);

[0219] Next: add AMPureXP magnetic beads equilibrated to room temperature to the centrifuge tube containing polyacrylamide beads to release cell DNA, wherein 85.5 μL of magnetic beads are added to every 100 μL of polyacrylamide beads to release cell DNA sample, mix gently, and place at room temperature for 13 minutes to perform DNA purification by AMPure XP beads; use AMPure XP magnetic beads to wash away non-DNA components and short DNA fragments.

[0220] Then: place the centrifuge tube on the magnetic bead magnetic cleaning rack for 2 minutes, keep the centrifuge tube on the magnetic rack, and use a pipette to suck out the suspension in the centrifuge tube and discard it; then wash the magnetic beads twice with 70% ethanol, 0.5 mL of 70% ethanol each time, then open the centrifuge tube lid and air-dry for 15-30 minutes until the surface of the magnetic beads is dry; then remove the centrifuge tube, add sterile water (40 μL) to the centrifuge tube, mix gently, and place at room temperature for 7 minutes; finally, place the centrifuge tube on the magnetic bead magnetic cleaning rack for 2 minutes to collect the suspension; obtain fusion PCR purified DNA.

[0221] 3. Blocking PCR reaction

[0222] 3A. Using the fusion PCR purified DNA as a template, a Blocking PCR reaction was performed to obtain a Blocking PCR reaction product system, wherein the Blocking PCR primers are as follows:

[0223] Forward primer (Blocking F): 5'-TTTTTTTTTTGTGYCAGCMGCCGCGGTAA-3' (SEQ ID NO. 4)

[0224] Reverse primer (BlockingR): 5'-TTTTTTTTTTTTACCGCGGCKGCTGRCAC-3' (SEQ ID NO.5)

[0225] The blocking PCR reaction system was: 2×PCR Taq MasterMix with dye 50 μL, forward primer (concentration of 100 μM, 3.2 μL), reverse primer (concentration of 100 μM, 3.2 μL), template (purified fusion PCR reaction DNA, 40 μL), ddH2O (3.6 μL);

[0226] Blocking PCR amplification program is: pre-denaturation stage 95℃, lasting 5min; high temperature denaturation 95℃, lasting 45s; low temperature annealing 55℃, lasting 45s; extension stage 72℃, lasting 1min, a total of 35 cycles. Final extension stage 72℃, lasting 10min;

[0227] 3B. Purification of Blocking PCR Reaction Products

[0228] The Blocking PCR reaction product system is placed in a centrifuge tube, and the centrifuge tube is placed on a magnetic bead magnetic cleaning rack for magnetic bead cleaning (i.e., the Blocking PCR reaction product is subjected to DNA magnetic bead cleaning (DNA purification by AMPure XP beads), wherein the magnetic bead cleaning process is the same as the "2B) magnetic bead cleaning" in step 2) of Example 6 except that the Blocking PCR reaction product system is mixed with AMPure XP magnetic beads, to obtain Blocking PCR purified DNA.

[0229] 4. Nested PCR reaction

[0230] Using Blocking PCR purified DNA as a template, a nested PCR reaction was performed to obtain a nested PCR amplification product, wherein the nested PCR primers are as follows:

[0231] Forward primer F2 (173AF): 5'-TGTGAGTACCCAAGAGG-3' (SEQ ID NO. 6)

[0232] Reverse primer R2 (806R): 5'-GGACTACHVGGGTWTCTAAT-3' (SEQ ID NO. 7)

[0233] The nested PCR reaction system (100 μL) was: 2×PCR Taq MasterMix with dye 50 μL, forward primer (concentration of 20 μM, 3 μL), reverse primer (concentration of 20 μM, 3 μL), template (Blocking PCR purified DNA, 40 μL), and ddH2O (4 μL).

[0234] The nested PCR amplification program was as follows: pre-denaturation stage at 95°C for 5 min; high temperature denaturation at 95°C for 45 s; low temperature annealing at 56°C for 45 s; extension stage at 72°C for 1 min, for a total of 40 cycles. The final extension stage was at 72°C for 10 min.

[0235] After the nested PCR reaction is completed, the amplified products are collected to obtain the nested PCR amplification products, namely the nested PCR reaction DNA.

[0236] 5. Gel electrophoresis detection

[0237] The nested PCR amplification products were subjected to 1% agarose gel electrophoresis. Figure 3 As shown, the target band length is 465 bp. Gel electrophoresis shows an obvious band at the target band (400 bp).

[0238] Figure 3 On the left is the DNA marker, and the sequence lengths from top to bottom are 2000bp, 1000bp, 750bp, 500bp, 250bp, and 100bp; the labels (A and B) are the results of DNA gel electrophoresis after nested PCR of water samples from Yuqiao Reservoir. The gel electrophoresis detection results show that the length of the amplified product is about 400bp (sequence 1).

[0239] The nested PCR amplification product (sequence 1) was sent to Meiji Bio Group for sequencing, and the sequencing result was: SEQ ID NO.8.

[0240] The fragment amplified between primer 515F (GTGCCAGCMGCCGCGGTAA) and primer 806R (GGACTACHVGGGTWT CTAAT) is the target 16S rRNA gene, that is, the cyanobacterial species information carrying the geoA gene.

[0241] The 16S rRNA gene was compared with the (nr / nt) database of the NCBI database, and the 16S rRNA gene end of sequence 1 (sequence SEQ ID NO.9) was aligned to Hydraulum spp. The results showed that the cyanobacteria carrying the geoA gene in the Yuqiao Reservoir were Hydraulum spp.

[0242] Example 6A Using the same forward primer (primer 173AF) in fusion PCR and nested PCR

[0243] 1. DNA extraction from environmental water samples

[0244] Water samples collected from Erhai Lake and Yuqiao Reservoir were filtered using a 1.2 μm filter membrane (RTTP04700, 1.2 μm polycarbonate membrane, IsoporeTM, USA). Each water sample was 300 mL. The cyanobacterial cells in the water samples were retained and enriched on the filter membrane, and then used The SPIN Kit for Soil was used to extract the DNA on the filter membrane of each water sample; and each collected water sample (10 ml) was taken for GC-MS detection.

[0245] 2. GC-MS detection

[0246] The concentration of geosmin in the water sample detected by GC-MS exceeded 10 ng / L, and the concentration of geoA gene in the extracted DNA reached 10 5 copies / L, as positive samples.

[0247] Among them: A is a blank control, i.e. sterile ultrapure water; samples BD are water samples collected from Haihu, Beihuxin and Wase in Erhai Lake in December 2023, and the geosmin concentration in the water samples exceeds 10 ng / L, and the geoA gene concentration contained reaches 10 5 The samples labeled EH were collected from the center, east, southeast, and south of Yuqiao Reservoir in December 2023, and the geosmin concentration in the water samples exceeded 10 ng / L, and the geoA gene contained reached 10 5 copies / L of positive samples.

[0248] 3. Identify the olfactory algae species of the positive samples labeled BH according to the following method

[0249] 1: Fusion PCR reaction:

[0250] The fusion PCR reaction was the same as in Example 6 except that the fusion PCR primers were as follows.

[0251] Forward primer F1 (173AF): 5'-TGTGAGTACCCAAGAGG-3', SEQ ID NO. 6;

[0252] Reverse primer R1 (1492R): 5'-GGTTACCTTGTTACGACTT-3', SEQ ID NO. 2;

[0253] Bridging primer (515R-173AR): 5′-TTACCGCGGCKGCTGGCACCTGCCAATCCTGAAGTCCTTT-3′;

[0254] 2. Cleaning of Fusion PCR Products

[0255] The same as the "fusion PCR product cleaning" in Example 6.

[0256] 3: Blocking PCR reaction

[0257] Same as "Blocking PCR reaction" in Example 6

[0258] 4: Nested PCR reaction

[0259] The nested PCR reaction was the same as in Example 6 except that the nested primers were as follows.

[0260] The nested PCR primers are as follows:

[0261] Forward primer F2 (173AF): 5'-TGTGAGTACCCAAGAGG-3', SEQ ID NO. 6;

[0262] Reverse primer R2 (806R): 5'-GGACTACHVGGGTWTCTAAT-3', SEQ ID NO. 7;

[0263] 5: Gel electrophoresis detection

[0264] The nested PCR amplification products were subjected to 1% agarose gel electrophoresis. Figure 4 As shown, A is a blank sample (sterile ultrapure water); BD are positive samples of environmental DNA from Erhai Lake; EH are positive samples of environmental DNA from Yuqiao Reservoir. The leftmost column is DL2000 DNA Marker. The results showed that the same forward primer 173AF was used for amplification in fusion PCR and nested PCR, but no target band (465bp) was obtained, and there was no obvious band at the target band position, so sequencing could not be performed.

[0265] Example 6B used the same forward primer in both fusion PCR and nested PCR: geo_cya728F.

[0266] Water samples collected from Erhai Lake and Yuqiao Reservoir were filtered using a 1.2 μm filter membrane (RTTP04700, 1.2 μm polycarbonate membrane, IsoporeTM, USA). Each water sample was 300 mL. The cyanobacterial cells in the water samples were retained and enriched on the filter membrane, and then used The DNA on each water sample filter membrane was extracted using the SPIN Kit for Soil; and each collected water sample (10 ml) was taken for GC-MS detection.

[0267] The concentration of geosmin in the water sample detected by GC-MS exceeded 10 ng / L, and the concentration of geoA gene in the extracted DNA reached 10 5 copies / L, as positive samples.

[0268] Samples B and C were collected from the eastern part of Yuqiao Reservoir and the water discharge hole in December 2023. The concentration of geosmin in the water samples exceeded 10 ng / L, and the concentration of geoA gene in the extracted DNA reached 10 5 copies / L; D is the DNA of Longispora algae cultured in the laboratory. Longispora algae comes from the freshwater algae species bank of the Chinese Academy of Sciences, with the species number FACHB-1250, and is a geosmin-producing olfactory algae; E is the DNA of Microcystis cultured in the laboratory. Microcystis comes from the freshwater algae species bank of the Chinese Academy of Sciences, with the species number FACHB-562, and is used as a negative control; F is the blank control, i.e., sterile ultrapure water.

[0269] The DNA sample labeled BF was used to identify the olfactory algae species as follows:

[0270] 1: Fusion PCR reaction

[0271] Except that the fusion PCR primers are as follows, the rest is the same as the "fusion PCR reaction" of Example 6.

[0272] Fusion PCR primers are as follows:

[0273] Forward primer F1 (geo_cya728F): 5'-TCCTAYCARAGAGAAGT-3', SEQ ID NO. 1;

[0274] Reverse primer R1 (1492R): 5'-GGTTACCTTGTTACGACTT-3', SEQ ID NO. 2;

[0275] Bridging primer (515R-173AR): 5′-TTACCGCGGCKGCTGGCACCTGCCAATCCTGAAGTCCTTT-3′;

[0276] 2. Cleaning of Fusion PCR Products

[0277] The same as the "fusion PCR product cleaning" in Example 6.

[0278] 3: Blocking PCR reaction

[0279] Same as "Blocking PCR reaction" in Example 6

[0280] 4: Nested PCR reaction

[0281] The nested PCR reaction was the same as in Example 6 except that the primers for the nested PCR were as follows.

[0282] Forward primer F2 (geo_cya728F): 5'-TCCTAYCARAGAGAAGT-3', SEQ ID NO. 1;

[0283] Reverse primer R2 (806R): 5'-GGACTACHVGGGTWTCTAAT-3', SEQ ID NO. 7;

[0284] 5: Gel electrophoresis detection

[0285] The nested PCR amplification products were subjected to 1% agarose gel electrophoresis. The gel electrophoresis results were as follows: Figure 5 , where A is DL2000 DNA Marker, B and C are positive samples of environmental DNA from Yuqiao Reservoir, D is DNA of Longispora algae with algae species number FACHB-1250; E is negative control, and F is blank sample (sterile ultrapure water). Figure 5 From the test results, although the positive samples obtained the target band between 250-500bp, there were a lot of non-specific amplifications. This may be because the same upstream primers were used in fusion PCR and nested PCR, and the band fragmentation occurred during the amplification process, resulting in some non-specific amplification. The results showed that the same forward primer geo_cya728F was used in fusion PCR and nested PCR, and sequencing could not be performed.

[0286] In Example 6C, the forward primer screened in Example 5 was used in fusion PCR and nested PCR.

[0287] DNA of environmental water samples was extracted in the same manner as in Example 6A; wherein: the DNA of Microcystis cultured in the laboratory was obtained from the freshwater algae bank of the Chinese Academy of Sciences, and the algae species number was FACHB-562, which was used as a negative control; the environmental water samples numbered C, D, and E were collected from the eastern part of Yuqiao Reservoir, the water discharge hole, and the northern part of the reservoir, respectively;

[0288] The DNA sample labeled BE was used to identify the olfactory algae species according to the following method. The identification method and primers were the same as those in Example 6.

[0289] The nested PCR amplification products were subjected to 1% agarose gel electrophoresis. The gel electrophoresis results were as follows: Figure 6 , where A is DL 2000DNA Marker, B is the negative control, and CE is the positive environmental DNA sample from Yuqiao Reservoir. Figure 6 The test results show that the concentration of the target product is high and there is no non-specific amplification, so the method is feasible.

[0290] According to the test results of Examples 6, 6A, 6B, and 6C, the PCR primers for identifying the species of geosmin-producing olfactory algae determined by the present invention are as follows:

[0291] 1) Fusion PCR primers

[0292] Fusion PCR forward primer F1 (geo_cya728F): 5'-TCCTAYCARAGAGAAGT-3' (SEQ ID NO. 1);

[0293] Fusion PCR reverse primer R1 (1492R): 5'-GGTTACCTTGTTACGACTT-3' (SEQ ID NO. 2);

[0294] Fusion PCR bridge primer (515R-173AR): 5'-TTACCGCGGCKGCTGGCACCTGCCAATCCTGAAGTCCTTT-3' (SEQ ID NO. 3);

[0295] 2) Blocking PCR primers:

[0296] Blocking PCR forward primer (BlockF): 5′-TTTTTTTTTTGTGYCAGCMGCCGCGG TAA-3′;

[0297] Blocking PCR reverse primer (BlockR): 5′-TTTTTTTTTTTTACCGCGGCKGCTGR CAC-3′;

[0298] 3) Nested PCR primers

[0299] Nested PCR forward primer F2 (173AF): 5'-TGTGAGTACCCAAGAGG-3' (SEQ ID NO. 6);

[0300] Nested PCR reverse primer R2 (806R): 5'-GGACTACHVGGGTWTCTAAT-3' (SEQ ID NO. 7).

[0301] The present invention performs three types of PCR effects:

[0302] 1. Fusion PCR

[0303] There are many species in the raw water. PCR for olfactory genes alone can only quantify the olfactory potential, but cannot accurately identify the olfactory algae species. Through fusion PCR, the 16SrRNA gene and the olfactory functional gene of the olfactory algae can be connected. Combined with the aforementioned polyacrylamide beads, it can ensure that this connection only occurs in a single cell or a single filamentous algae, avoiding the possibility that the phylogenetic gene and the geoA gene come from different cyanobacterial individuals. Fusion PCR used fusion PCR forward primer F1 (geo_cya728F), fusion PCR reverse primer R1 (1492R) and fusion PCR bridging primer 173AR-515F (geoA reverse primer and 16s rRNA forward primer) to connect the DNA fragments of geoA gene (224bp) and 16S rRNA gene (977bp) by fusion PCR to produce a fused fragment (1201bp), which contains both taxonomic and functional information of cyanobacteria. However, the product of the fusion PCR step may contain some short fragments that were not amplified, and the fused fragment is long, which is not conducive to sequencing, so subsequent steps are required.

[0304] 2. Blocking PCR

[0305] After fusion PCR, there will be some impurities such as unamplified short fragments in the product. Blocking PCR uses Blocking PCR forward primer (BlockF) and Blocking PCR reverse primer (BlockR) to reduce the impurity content and block the further amplification of the unamplified fragments.

[0306] 3. Nested PCR

[0307] For the blocking PCR product, the nested PCR forward primer F2 (173AF) and the nested PCR reverse primer R2 (806R) were continued to be amplified to shorten the length of the final product. The resulting nested PCR product was 465bp in length. This fragment contained both the V3-V4 region of the cyanobacterial taxonomic information and the geoA gene of the cyanobacteria, and was suitable for high-throughput sequencing. Sequencing could be used to identify which algae the olfactory function originated from.

Claims

1. A primer for identifying geosmin-producing olfactory algae species in environmental water bodies, characterized in that: include: Fusion PCR reaction primers: Fusion PCR forward primer F1: 5′-TCCTAYCARAGAGAAGT-3′; Fusion PCR reverse primer R1: 5′-GGTTACCTTGTTACGACTT-3′; Fusion PCR bridge primer: 5′-TTACCGCGGCKGCTGGCACCTGCCAATCCTGAAGTCCTTT-3′; Nested PCR reaction primers: Nested PCR forward primer F2: 5′-TGTGAGTACCCAAGAGG-3′; Nested PCR reverse primer R2: 5′-GGACTACHVGGGTWTCTAAT-3′.

2. The primer according to claim 1, characterized in that The primers were screened as follows: 1) Targeting the geoA end of the olfactory gene of geosmin-producing algae, consult the literature and search for primers targeting the geoA gene; 2) Primers were designed using Primer Premier 5 for the geoA gene sequences of three typical geosmin-producing olfactory algae included in NCBI, wherein the primer length was controlled to be between 16 and 24 bp, the GC content was between 40% and 60%, and the typical algae geoA gene sequences in NCBI were as follows: HQ404997.1Anabaena ucrainica CHAB2155 geosmin synthesis operon,complete sequence; LC739811.1Dolichospermum planctonicum B-18geoA gene for geosmin synthase,partial cds; MK124614.1Nostoc sp.TURKEYGEO1 geosmin synthase gene,partial cds; 3) Primers covering at least two genotypes were selected; and primer pairs 173AF and 173AR with high coverage of geosmin-producing cyanobacteria were obtained by BLAST comparison of the selected primer pairs in NCBI.

3. A method for identifying geosmin-producing olfactory algae species in environmental water bodies, characterized in that: The steps include the following steps: A. preparing cell beads of environmental water samples A-1) Mixing the collected environmental water sample, acrylamide solution and ammonium persulfate solution, and then adding STT emulsified oil; then adding tetramethylethylenediamine, mixing, and allowing to stand for polymerization of acrylamide to prepare a polyacrylamide-cell beads mixture that encapsulates algae cells in the water body; A-2) washing the polyacrylamide-cell beads mixture with water-saturated ether and ultrapure water in sequence, adding 1×TK buffer to the polyacrylamide-cell beads to form a polyacrylamide-cell beads TK suspension, and then filtering with a cell filter to obtain a purified polyacrylamide-cell beads TK suspension; B. Cell lysis Add lysozyme to the purified polyacrylamide-cell gel beads TK suspension to dissolve the cell wall of the algae cells, then add proteinase K and TritonX-100 to remove the histones bound to the nucleic acid by enzymatic hydrolysis, free the algae cell DNA, and destroy the algae cell membrane, so that the algae cell genome is exposed in the polyacrylamide gel beads shell, and obtain cell-dissolving polyacrylamide-cell gel beads; C. epic PCR treatment Using cell lysis polyacrylamide-cell beads as templates, fusion PCR reaction, blocking PCR reaction and nested PCR reaction were carried out in sequence; the amplified products of the nested PCR reaction were sequenced, and the amplified fragment between the bridging primer of the fusion PCR and the nested reverse primer in the product was the target 16S rRNA gene, that is, the cyanobacterial species information carrying the geoA gene. The amplified 16S rRNA gene was compared with the genome sequence of the NCBI database to obtain the algae carrying the geoA gene for producing geosmin, that is, the cyanobacterial species producing geosmin in the environmental water body were identified.

4. The identification method according to claim 3, characterized in that: The STT emulsified oil in step A-1) is prepared as follows: Span-80, Tween-80 and TritonX-100 are dissolved in mineral oil, wherein the volume fraction of Span-80 is 4.5%, the volume fraction of Tween-80 is 0.4% and the volume fraction of TritonX-100 is 0.05%.

5. The identification method according to claim 3 or 4, characterized in that: The 1×TK buffer in step A-2) is prepared by mixing 40 mmol / L Tris-HCl (pH 7.5) and 120 mmol / L potassium chloride solution in a volume ratio of 1:

1.

6. The identification method according to claim 3 or 4, characterized in that: After adding lysozyme in step B), the mixture is incubated at 37±1°C for 8-12 hours, centrifuged, and the supernatant is removed; 1×TK buffer is then added, the beads are resuspended, and the proteinase K and TritonX-100 are then added.

7. The identification method according to claim 3 or 4, characterized in that: The epic PCR process described in step C) is performed in the following order of steps: C-1) Fusion PCR reaction A fusion PCR reaction was performed using cell lysis polyacrylamide-cell beads as a template to obtain a fusion PCR reaction product, i.e., fusion PCR purified DNA, wherein the primers for the fusion PCR reaction are: Fusion PCR forward primer F1 (geo_cya728F): 5′-TCCTAYCARAGAGAAGT-3′; Fusion PCR reverse primer R1 (1492R): 5′-GGTTACCTTGTTACGACTT-3′; Fusion PCR bridge primer (515R-173AR): 5′-TTACCGCGGCKGCTGGCACCTGCCAATCCTGAAGTCCTTT-3′; C-2) Blocking PCR reaction Performing a Blocking PCR reaction using the fusion PCR product as a template to obtain a Blocking PCR reaction product, namely, Blocking PCR purified DNA; C-3) Nested PCR reaction A nested PCR reaction was performed using the Blocking PCR reaction product as a template to obtain a nested PCR amplification product; wherein the primers for the nested PCR reaction are: Nested PCR forward primer F2 (173AF): 5′-TGTGAGTACCCAAGAGG-3′; Nested PCR reverse primer R2 (806R): 5'-GGACTACHVGGGTWTCTAAT-3'.

8. The identification method according to claim 3 or 4, characterized in that: The fusion PCR reaction in step C) further includes adding ABIL oil to the fusion PCR reaction system, mixing evenly, and then performing a fusion PCR amplification reaction, wherein the ABIL oil is prepared according to the following method: EM90 and TritonX-100 are dissolved in mineral oil, wherein the volume percentage concentration of EM90 is 4%; the volume percentage concentration of TritonX-100 is 0.05%.

9. The identification method according to claim 3 or 4, characterized in that: The primers for the Blocking PCR reaction in step C) are: Blocking PCR forward primer (BlockingF): 5′-TTTTTTTTTTGTGYCAGCMGCCGCGGTAA-3′; Blocking PCR reverse primer (BlockingR): 5'-TTTTTTTTTTTTACCGCGGCKGCTGRCAC-3'.

Images