Sunflower disc extract, composite liposome and application thereof in preparation of reducing inflammatory response and uric acid

Abstract

The present application relates to sunflower disc related raw material technical field, concretely relates to a kind of sunflower disc liposome and its application in preparation reduce uric acid and dissolve gout stone product.The sunflower disc liposome is formed by self-assembly with ferrocene sunflower disc peptide, alkaloid and flavone as raw material, can reduce uric acid, dissolve gout stone, balance in vivo acid-base balance, inhibit xanthine oxidase synthesis uric acid, promote in vivo uric acid excretion and intestinal peristalsis, repair damaged liver and kidney cells, swelling anti-inflammatory analgesic, prevent and treat hyperuricemia, relieve gout inflammation, reduce blood pressure, improve immunity.

Description

Technical Field

[0001] The present invention relates to the technical field of sunflower disk-related raw materials, and in particular to a sunflower disk peptide, a composite liposome and applications thereof in preparing a method for reducing inflammatory reactions and uric acid caused by hyperuricemia. Background Art

[0002] Sunflower, an annual plant of the genus Helianthus in the Asteraceae family, is a valuable medicinal plant for development and utilization. It is sweet, warm, and non-toxic. Its main functions include clearing heat, promoting diuresis, promoting urination, and treating gastric cancer. Sunflower contains a diverse range of chemical components, including sesquiterpenoid lactones, diterpenoids, monoterpenoids, flavonoids, coumarins, and sterols, with sesquiterpenoid lactones and diterpenes being the most prevalent. Sesquiterpenoids, flavonoids, and alkanes are primarily concentrated in the leaves, while aromatic compounds are concentrated in the seeds. The diverse structural types and spatial configurations of the compounds in sunflower contribute to its wide range of biological activities. Sunflower seeds exhibit significant therapeutic effects in insect repellent, anti-tumor, and anti-aging. Sunflower discs have anti-tumor, anti-angina, antibacterial, analgesic, and blood pressure-lowering properties. Sunflower leaves have antihypertensive, antibacterial, and blood sugar-lowering properties. Sunflower stems have anti-tumor and laxative effects. Sunflower roots have significant antibacterial properties. However, there is still great potential to fully develop sunflower-related active ingredients to provide further assistance in drug development and application. Summary of the Invention

[0003] In view of this, the present invention provides sunflower disc liposomes and their use in the preparation of products for reducing uric acid and dissolving tophi. The sunflower disc liposomes are self-assembled using ferrocene sunflower disc peptide, alkaloids, and flavonoids as raw materials. They can reduce uric acid, dissolve tophi, balance the acid-base balance in the body, inhibit the synthesis of uric acid by xanthine oxidase, promote uric acid excretion and intestinal peristalsis in the body, repair damaged liver and kidney cells, reduce swelling, anti-inflammatory and analgesic effects, prevent and treat hyperuricemia, relieve gout inflammation, lower blood pressure, and improve immunity. To this end, the present invention discloses the following technical solutions:

[0004] In a first aspect, the present invention provides a method for modifying a sunflower disk peptide, comprising: protecting the amino group of the sunflower disk peptide; reacting aminoferrocene with the amino-protected sunflower disk peptide to form tert-butyloxy-sunflower disk peptide-ferrocene, and then acid hydrolyzing the reacted tert-butyloxy-sunflower disk peptide-ferrocene to obtain a ferrocene-modified sunflower disk peptide; wherein the sunflower disk peptide is PDP-9, whose amino acid sequence is shown in SEQ ID NO.1, or PDP-17, whose amino acid sequence is shown in SEQ ID NO.2.

[0005] Furthermore, the step of "protecting the amino group of sunflower peptide" specifically includes:

[0006] A saturated solution of sodium bicarbonate was prepared and mixed with a dioxane solution containing di-tert-butyl dicarbonate; then the sunflower peptide mixture was added in small amounts and multiple times, and the reaction progress was monitored by TLC;

[0007] After reacting overnight, wash with ethyl acetate 2-3 times;

[0008] The aqueous phase was washed twice with ethyl acetate; the oil phase was washed twice with saturated sodium bicarbonate;

[0009] Then all the aqueous phases were mixed and the pH of the aqueous phase was adjusted to 1 with 10% hydrochloric acid, and then the aqueous phase was washed twice with ethyl acetate; the above oil phases were collected and dried over anhydrous sodium sulfate, filtered, and evaporated to dryness to obtain a crystalline product.

[0010] Furthermore, the step of “reacting aminoferrocene with amino-protected sunflower peptide to form tert-butyloxy-sunflower peptide-ferrocene” comprises:

[0011] The amino-protected sunflower peptide obtained above was dissolved in anhydrous dichloromethane in a dry round-bottom flask, triethylamine was added at 0°C, and then benzotriazole-1-tetramethyl hexafluorophosphate was added and reacted for 1 hour;

[0012] Add amino-ferrocene, react for 2 h, then move to room temperature for overnight reaction, and monitor the reaction progress by TLC.

[0013] After the reaction is completed, the mixture is washed with saturated sodium bicarbonate solution, 0.5 M hydrochloric acid, 0.5 M sodium bicarbonate solution and water, respectively. Finally, the oil phase is dried over anhydrous sodium sulfate, filtered and evaporated to dryness to obtain a solid.

[0014] The solid was dissolved in dichloromethane and ethanol, and passed through a chromatography column using a mixed solution of dichloromethane and ethanol (mixed volume ratio 95:5) as an eluent. The components were collected and dried to obtain a purified tert-butyloxy-sunflower peptide-ferrocene solid.

[0015] Furthermore, the step of “acid hydrolyzing the ferrocene-modified sunflower peptide” specifically includes:

[0016] Dissolve tert-butyloxy-sunflower peptide-ferrocene in ethyl acetate solution, then pass dry HCl gas at 0℃ for 1 hour, then react at room temperature for 0.5 hours, and finally evaporate to dryness;

[0017] The solid was dissolved in methanol and recrystallized repeatedly with ether to obtain a relatively pure product, sunflower peptide.

[0018] In a second aspect, the present invention provides a method for preparing sunflower disc liposomes, comprising:

[0019] Weigh soybean lecithin, cholesterol, and distearoylphosphatidylethanolamine methoxypolyethylene glycol into a 250 mL single-necked round-bottom flask, and add dichloromethane to dissolve all the solids.

[0020] Then, a methanol solution containing ferrocene sunflower disk peptide, total sunflower disk alkaloids and total sunflower disk flavonoids was added, and ultrasonicated for 30 seconds to mix uniformly;

[0021] Subsequently, the flask was connected to a rotary evaporator, and the dichloromethane-methanol solution was completely evaporated in a 42° C. water bath under vacuum to form a uniform yellow phospholipid film with refractive index on the wall of the flask; and

[0022] Remove the flask, add 8 mL of sterile pH 7.4 PBS solution, separate the phospholipid membrane in an ultrasonic cleaner, and then transfer the flask to an ultrasonic cell disruptor and sonicate at 300 W for 10 minutes to allow the phospholipid membrane to self-assemble into sunflower disc liposomes.

[0023] Wherein, the ferrocenyl sunflower peptide is prepared by the method described in claims 1 to 4.

[0024] Furthermore, the method for extracting total alkaloids and total flavonoids from sunflower discs includes:

[0025] Take the sunflower disk powder particles and extract them once with 10 times the mass of 50% ethanol for 15 minutes, filter, and concentrate the filtrate under reduced pressure to 0.5 times the mass of the sunflower disk powder to obtain the alcohol extract;

[0026] 1000 mL of pretreated D001 macroporous resin was loaded into a glass column with an inner diameter of 60 mm and a height of 1200 mm. The alcohol extract obtained from the above extraction was added and slowly adsorbed. After that, water-soluble impurities were washed away with distilled water of about 5 times the column volume at a flow rate of 4 BV / h.

[0027] Then elute with 5BV of 50% ethanol at a flow rate of 1BV / h, and collect eluate I. Then elute with 5BV of 50% ethanol with a 1% ammonia content at a flow rate of 1BV / h, and collect eluate II;

[0028] The total flavonoids of sunflower disc are obtained by concentrating and drying the eluate I, and the total alkaloids of sunflower disc are obtained by concentrating and drying the eluate II.

[0029] In a third aspect, the present invention provides ferrocenyl sunflower peptide prepared by the method described in the first aspect.

[0030] In a fourth aspect, the present invention provides sunflower disc liposomes prepared by the method described in the second aspect.

[0031] In a fifth aspect, the present invention provides the use of sunflower disc liposomes prepared by the method described in the second aspect in the preparation of products for reducing uric acid and dissolving tophi.

[0032] Compared with the prior art, the present invention has at least one of the following beneficial effects:

[0033] The liposomes involved in the present invention can reduce the uric acid content in the supernatant of the hyperuricemia model cells to the lowest level. Not only do ferrocene sunflower disk peptide and alkaloids and flavonoids extracted from sunflower disks are used as raw materials to form liposomes through self-assembly, but Fc-PDP-9 and Fc-PDP-17 are also used as raw materials instead of Fc-SFTI-1. Therefore, a preparation that can significantly interfere with the uric acid metabolism of liver cells and significantly reduce the amount of uric acid metabolism can be obtained.

[0034] Compared with liposomes obtained from PDP-9, PDP-17 and SFTI-1 as raw materials and Fc-PDP-9, Fc-PDP-17 and Fc-SFTI-1 as preparations to intervene in small intestinal mucosal epithelial cells, liposomes obtained from Fc-PDP-9, Fc-PDP-17 and Fc-SFTI-1 as raw materials can not only promote their transport of uric acid, but also reduce the occurrence of their inflammatory response.

[0035] The liposomes and ferrocene sunflower disc peptide involved in the present invention have good therapeutic effects on hyperuricemia, and the therapeutic effect is achieved based on the regulation of the PI3K / AKT signaling pathway. BRIEF DESCRIPTION OF THE DRAWINGS

[0036] Figure 1 The Fc-PDP-9 ( Figure 1 A), Fc-PDP-17 ( Figure 1 B) and Fc-SFTI-1 ( Figure 1 C) infrared spectrum.

[0037] Figure 2 HE staining images of mouse joint synovial tissue sections of the normal group, model group, experimental group (liposome treatment provided in Example 1) and control group in the animal experiment provided in the embodiments of the present invention. DETAILED DESCRIPTION

[0038] In order to make the objectives, technical solutions and advantages of the present invention more clearly understood, the present invention is further described in detail below with reference to the following examples. It should be understood that the specific examples described herein are merely illustrative of the present invention and are not intended to limit the present invention. Reagents not described in detail herein are all conventional reagents and are commercially available; methods not specifically described in detail are all conventional experimental methods and are known in the art.

[0039] It should be noted that the terms "first", "second", etc. in the description and claims of the present invention and the above-mentioned drawings are used to distinguish similar objects, and are not necessarily used to describe a specific order or sequence, nor do they play a substantial limiting role on the subsequent technical features. It should be understood that the numbers used in this way can be interchanged where appropriate, so that the embodiments of the present invention described herein can be implemented in an order other than those illustrated or described herein. In addition, the terms "including" and "having" and any variations thereof are intended to cover non-exclusive inclusions. For example, a process, method, system, product or device that includes a series of steps or units is not necessarily limited to those steps or units clearly listed, but may include other steps or units that are not clearly listed or inherent to these processes, methods, products or devices.

[0040] 1. Materials

[0041] Sunflower disk peptide (synthesized according to the method provided in "Evolutionary Origins of a Bioactive Peptide Buried within Preproal Bumin [J] The Plant Cell, Vol. 26: 981-995, March 2014"). The present invention relates to: PDP-9: GDCYWTSTPPFFTCTPD, shown in SEQ ID NO. 1; PDP-17: GDCHWIPAPPFFMCTPD, shown in SEQ ID NO. 2; SFTI-1: GRCTKSIPPICFPD, shown in SEQ ID NO. 3.

[0042] 2. Modification of sunflower disc peptide

[0043] The present invention provides a method for modifying a sunflower disk peptide, comprising: protecting the amino group of the sunflower disk peptide; reacting aminoferrocene with the amino-protected sunflower disk peptide to form tert-butyloxy-sunflower disk peptide-ferrocene, and then acid hydrolyzing the reaction to obtain ferrocene-modified sunflower disk peptide. Specifically comprising:

[0044] (1) Protection of peptide amino groups

[0045] 780 mg of sodium bicarbonate was dissolved in distilled water at 4°C in a round-bottom flask to prepare a saturated sodium bicarbonate solution. Separately, 460 mg of di-tert-butyl dicarbonate ((Boc)2O, CAS: 24424-99-5, Nanjing Aupchi Pharmaceutical Technology Co., Ltd.) was weighed and dissolved in approximately 50 mL of dioxane (CAS: 123-91-1, Shanghai Aladdin). The two solutions were mixed. 700 mg of sunflower peptide was then added to the mixture in small portions. The reaction progress was monitored by TLC. After reacting overnight, the mixture was washed 2-3 times with ethyl acetate; the aqueous phase was washed twice with ethyl acetate; and the oil phase was washed twice with saturated sodium bicarbonate. All aqueous phases were then combined and adjusted to pH 1 with 10% hydrochloric acid. The aqueous phase was then washed twice with ethyl acetate. The oil phase was pooled, dried over anhydrous sodium sulfate, filtered, and evaporated to dryness to yield the product as white crystals. The solid was dissolved in methanol and recrystallized repeatedly with ether to obtain relatively pure Boc-protected Boc-PDP-9, Boc-PDP-17 and Boc-SFTI-1 (450 mg, 537 mg and 514 mg, respectively).

[0046] (2) Synthesis of tert-butyloxy-sunflower peptide-ferrocene

[0047] The Boc-PDP-9, Boc-PDP-17, and Boc-SFTI-1 obtained above were dissolved in anhydrous dichloromethane in a dry round-bottom flask. 2.0 mL of triethylamine was added at 0°C, followed by 430 mg of 1-tetramethylbenzotriazole hexafluorophosphate (HBTU, CAS: 94790-37-1, Shanghai Covalent Chemical Technology Co., Ltd.). After reacting for 1 hour, 303 mg of aminoferrocene (CAS: 1273-82-1, Beijing Bailingwei) was added. After 2 hours of reaction, the mixture was moved to room temperature and allowed to react overnight. The reaction progress was monitored by TLC (ninhydrin color development). After completion of the reaction, the mixture was washed sequentially with saturated sodium bicarbonate solution, 0.5 M hydrochloric acid, 0.5 M sodium bicarbonate solution, and water. Finally, the oil phase was dried over anhydrous sodium sulfate, filtered, and evaporated to dryness to obtain a solid. The solid was dissolved in dichloromethane and ethanol, and passed through a chromatography column using a mixed solution of dichloromethane and ethanol (mixed volume ratio 95:5) as the eluent. The components were collected and dried to obtain 298 mg, 285 mg and 279 mg of purified tert-butyloxy-sunflower peptide-ferrocene solids, respectively.

[0048] (3) Synthesis of ferrocene sunflower peptide

[0049] The tert-butyloxy-sunflower peptide-ferrocene obtained above was dissolved in ethyl acetate, then passed through dry HCl gas at 0°C for 1 hour. The reaction was then allowed to react at room temperature for 0.5 hours before evaporation to dryness. Because amino compounds are susceptible to oxidation and deterioration, they must be stored dry at low temperatures. The solid was dissolved in methanol and recrystallized repeatedly from ether to obtain relatively pure sunflower peptides. The yields of Fc-PDP-9, Fc-PDP-17, and Fc-SFTI-1 were 179 mg, 164 mg, and 171 mg, respectively.

[0050] (4) Infrared detection

[0051] The ferrocene sunflower peptide (KBr tablet) was determined at 4000~400 cm -1 IR spectrum in the range. Figure 1 Fc-PDP-9 ( Figure 1 A), Fc-PDP-17 ( Figure 1 B) and Fc-SFTI-1 ( Figure 1 C) infrared spectrum. Among them, 3247cm -1 A broad single peak appears near 1537 cm, which is attributed to the stretching vibration absorption of NH; -1 Nearby, NH in-plane bending vibration absorption is shown, which is a common characteristic absorption peak of general amine ferrocene derivatives. -1 The stretching vibration absorption peak of C=O in the ester group appears near 1136cm -1 The stretching vibration absorption peak of COC appears near 1403cm -1 Appear-COO - Antisymmetric stretching vibration peak. 2927cm -1 The CH stretching vibration absorption of methylene appears nearby. 1302cm -1 A weak CN stretching vibration absorption peak appears near 3082cm -1 The absorption of cyclopentadienyl CH stretching vibration appears at 1009 cm -1 and 824cm -1 The characteristic absorption peak of monocyclic substituted ferrocene appeared nearby, indicating that the above-mentioned Fc-PDP-9, Fc-PDP-17 and Fc-SFTI-1 were successfully prepared.

[0052] 3. Sunflower disk extract

[0053] The alkaloids and flavonoids of sunflower disk were extracted according to the process of “Pharmacological effects of sunflower disk powder, a Chinese herbal medicine for anti-gout [J] Inner Mongolia Chinese Medicine 2016(08):130-1”, as follows:

[0054] Extraction of total flavonoids and alkaloids: Take 100g of sunflower seed powder granules and extract them once with 10 times the mass of 50% ethanol under reflux for 15 minutes. Filter and concentrate the filtrate under reduced pressure to 0.5 times the mass of the sunflower seed powder to obtain the alcohol extract. Load 1000mL of pretreated D001 macroporous resin into a glass column with an inner diameter of 60mm and a height of 1200mm. Add the alcohol extract obtained above and allow it to adsorb slowly and thoroughly. Wash away water-soluble impurities with approximately 5 column volumes of distilled water at a flow rate of 4 BV / h. Elute with 5 BV of 50% ethanol at a flow rate of 1 BV / h, collecting eluate I. Elute with 5 BV of 50% ethanol containing 1% ammonia at a flow rate of 1 BV / h, collecting eluate II. After eluent I was concentrated and dried, the total flavonoids from the sunflower discs were obtained. The content of rutin was 61.4% (refer to "Simultaneous Determination of Alkaloids and Triticin in Malt Total Alkaloid Extract by HPLC [J] New Chinese Medicine and Clinical Pharmacology, January 2020"). This is the total flavonoid component of the sunflower discs. After eluent II was concentrated and dried, the total alkaloids from the sunflower discs were obtained. The content of methyl sunflower alkaloids was 75.8% (refer to "Simultaneous Determination of Alkaloids and Triticin in Malt Total Alkaloid Extract by HPLC [J] New Chinese Medicine and Clinical Pharmacology, January 2020"). This is the total flavonoid component of the sunflower discs.

[0055] 4. Preparation of liposomes

[0056] (1) Liposome preparation process

[0057] 200 mg of soy lecithin, 50 mg of cholesterol, and 25 mg of distearoylphosphatidylethanolamine methoxypolyethylene glycol (DSPE-PEG2000, Guangzhou Weihua Biotechnology Co., Ltd.) were weighed into a 250 mL single-necked round-bottom flask. 50 mL of dichloromethane was added to dissolve the solids completely. Then, 50 mL of a methanol solution containing 1.0 mg / mL ferrocenyl sunflower peptide, 4 mg / mL total sunflower alkaloids (prepared in the above example), and 2.5 mg / mL total sunflower flavonoids (prepared in the above example) was added. The mixture was ultrasonically mixed for 30 seconds. Subsequently, the flask was connected to a rotary evaporator and the dichloromethane-methanol solution was completely evaporated in a 42°C water bath under vacuum to form a uniform yellow phospholipid film with refractive index on the flask wall. The flask was removed, 8 mL of sterile pH 7.4 PBS solution was added, and the phospholipid film was separated in an ultrasonic cleaner. The flask was then transferred to an ultrasonic cell disruptor and ultrasonicated at 300 W for 10 min to allow the phospholipid film to self-assemble into sunflower disc liposomes.

[0058] The liposome solution was then transferred to a 10 mL centrifuge tube and centrifuged at 3000 rpm for 5 minutes to remove unencapsulated ferrocene sunflower peptide. The precipitate after centrifugation was retained to determine the encapsulation efficiency. Finally, the resulting liposome solution was stored in a refrigerator at 4°C.

[0059] As a control, the same liposome preparation process was performed without adding ferrocenesin peptide in the above steps to obtain blank liposomes.

[0060] In this step, Fc-PDP-9, Fc-PDP-17 and Fc-SFTI-1 were used as ferrocene sunflower disc peptides, and were combined with sunflower disc total alkaloids and 2.5 mg / mL sunflower disc total flavonoids to prepare corresponding liposomes, which were respectively used as Examples 1, 2 and Comparative Example 1; blank liposomes were used as Comparative Example 2.

[0061] Liposome preparation provided in Comparative Example 3:

[0062] 200 mg of soy lecithin, 50 mg of cholesterol, and 25 mg of distearoylphosphatidylethanolamine methoxypolyethylene glycol (DSPE-PEG2000, Guangzhou Weihua Biotechnology Co., Ltd.) were placed in a 250 mL single-necked round-bottom flask. 50 mL of dichloromethane was added to dissolve the solids completely. Then, 50 mL of a methanol solution containing 1.0 mg / mL sunflower peptide (PDP-9), 4 mg / mL sunflower total alkaloids (prepared in the above example), and 2.5 mg / mL sunflower total flavonoids (prepared in the above example) were added. The mixture was ultrasonically mixed for 30 seconds. The flask was then connected to a rotary evaporator and the dichloromethane-methanol solution was completely evaporated in a 42°C water bath under vacuum to form a uniform, refractive yellow phospholipid film on the flask wall. The flask was removed and 8 mL of sterile pH 7.4 PBS solution was added. The phospholipid membrane was separated in an ultrasonic cleaner. The flask was then transferred to an ultrasonic cell disruptor and sonicated at 300W for 10 minutes to allow the phospholipid membrane to self-assemble into sunflower disc liposomes. The sunflower disc peptide was PDP-9.

[0063] Liposome preparation provided in Comparative Example 4:

[0064] 200 mg of soybean lecithin, 50 mg of cholesterol, and 25 mg of distearoylphosphatidylethanolamine methoxypolyethylene glycol (DSPE-PEG2000, Guangzhou Weihua Biotechnology Co., Ltd.) were placed in a 250 mL single-necked round-bottom flask. 50 mL of dichloromethane was added to dissolve the solids completely. Then, 50 mL of a methanol solution containing 1.0 mg / mL sunflower peptide (PDP-17), 4 mg / mL sunflower total alkaloids (prepared in the above example), and 2.5 mg / mL sunflower total flavonoids (prepared in the above example) were added. The mixture was ultrasonically mixed for 30 seconds. The flask was then connected to a rotary evaporator and the dichloromethane-methanol solution was completely evaporated in a 42°C water bath under vacuum to form a uniform, refractive yellow phospholipid film on the flask wall. The flask was removed and 8 mL of sterile pH 7.4 PBS solution was added. The phospholipid membrane was separated in an ultrasonic cleaner. The flask was then transferred to an ultrasonic cell disruptor and sonicated at 300W for 10 minutes to allow the phospholipid membrane to self-assemble into sunflower disc liposomes. The sunflower disc peptide was PDP-17.

[0065] Liposome preparation provided in Comparative Example 5

[0066] 200 mg of soy lecithin, 50 mg of cholesterol, and 25 mg of distearoylphosphatidylethanolamine methoxypolyethylene glycol (DSPE-PEG2000, Guangzhou Weihua Biotechnology Co., Ltd.) were placed in a 250 mL single-necked round-bottom flask. 50 mL of dichloromethane was added to dissolve the solids completely. Then, 50 mL of a methanol solution containing 1.0 mg / mL sunflower peptide (SFTI-1), 4 mg / mL sunflower total alkaloids (prepared in the above example), and 2.5 mg / mL sunflower total flavonoids (prepared in the above example) were added. The mixture was ultrasonically mixed for 30 seconds. The flask was then connected to a rotary evaporator and the dichloromethane-methanol solution was completely evaporated in a 42°C water bath under vacuum, forming a uniform, refractive yellow phospholipid film on the flask wall. The flask was removed and 8 mL of sterile pH 7.4 PBS solution was added. The phospholipid membrane was separated in an ultrasonic cleaner. The flask was then transferred to an ultrasonic cell disruptor and sonicated at 300W for 10 minutes to allow the phospholipid membrane to self-assemble into sunflower disc liposomes. The sunflower disc peptide was -SFTI-1.

[0067] (2) Characterization of liposome particle size

[0068] The particle size and zeta potential of the prepared liposomes were measured using a Malvern ZetaSizer Nano ZSC (Model: ZEN3600). The liposomes used for zeta potential measurement were ultrasonically hydrated with deionized water without PBS during preparation. To investigate the short-term physiological stability of the liposomes, three liposome solutions diluted with PBS (pH 7.4) were incubated on a shaker at 37°C for 7 days, and their particle size distribution was measured. The results are shown in Table 2.

[0069] (3) Liposome loading performance

[0070] Ultrasonic cleaning fluid from commercial liposomes was collected, and 2 mL was taken in a quartz cuvette to measure its absorbance at 441 nm. The content of ferrocenyl sunflower disc peptide was calculated, and the liposome encapsulation efficiency was calculated based on the difference between the volume of the ultrasonic cleaning fluid and the amount of ferrocenyl sunflower disc peptide added. In addition, the total alkaloid and total flavonoid contents in the ultrasonic cleaning fluid were measured according to the method disclosed in "Simultaneous Determination of Alkaloids and Tadalafil in Malt Total Alkaloid Extract by HPLC [J] New Chinese Medicine and Clinical Pharmacology, January 2020", and the liposome encapsulation efficiency of the total alkaloids and total flavonoids in the sunflower disc was calculated.

[0071] Table 2

[0072]

[0073] As shown in Table 2, the hydration dynamic diameters of the liposomes prepared in Examples 1-2 and Comparative Examples 1-5 are not significantly different. The encapsulation efficiency of the liposomes provided in Example 1 and Comparative Example 3 for ferrocenyl sunflower peptide, total alkaloids, and total flavonoids is not significantly different. The encapsulation efficiency of the liposomes provided in Example 2 and Comparative Example 4 for ferrocenyl sunflower peptide, total alkaloids, and total flavonoids is not significantly different. The encapsulation efficiency of the liposomes provided in Comparative Example 1 and Comparative Example 5 for ferrocenyl sunflower peptide, total alkaloids, and total flavonoids is not significantly different.

[0074] 5. Hepatocyte test

[0075] (1) Materials

[0076] Test samples: liposomes provided in Examples 1 to 3 and Comparative Examples 1 to 5, and ferrocene sunflower peptide provided in Examples 1 to 3, respectively.

[0077] Human primary hepatocytes (L-O2 cells, Shanghai Huiying Biotechnology Co., Ltd.) were selected to measure whether the liposomes provided in Examples 1 to 3 and Comparative Examples 1 to 5, respectively, and the ferrocene sunflower disc peptide provided in Examples 1 to 3, respectively, have cytotoxicity thereto and their intervention effects on hyperuricemia model cells.

[0078] (2) Cytotoxicity test

[0079] L-O2 cells growing in the logarithmic phase were selected and digested with 0.25% EDTA-containing trypsin and gently blown into a cell suspension and counted. The suspension was diluted to 1×10 5 5000 cells / mL were seeded into each well of a 96-well cell culture plate. 200 μL of serum-containing medium was then added. The cells were cultured in a cell culture incubator overnight to allow complete cell attachment. After complete cell attachment, the medium was removed from the wells, and the wells were rinsed once with sterile PBS. 200 μL of 200 μM test samples (dissolved in tert-butanol) were added to the serum-free medium.

[0080] The cells were then incubated in a 37°C incubator for 24, 48, and 96 hours. After incubation, the culture medium was aspirated from the plate, rinsed twice with sterile PBS, and 100 μL of serum-free culture medium containing 1 mg / mL MTT was added in a dark-protected environment. The cells were then incubated in a 37°C incubator for 4 hours. The culture medium was aspirated from the plate, and 100 μL of DMSO was added. The cells were incubated in a 37°C incubator for 20 minutes. The absorbance of each well in the plate was measured at 570 nm using a microplate reader. Serum-free culture medium served as the control group. Six replicates were performed for each group, and cell viability was calculated using the following formula: absorbance of experimental group / absorbance of control group × 100%.

[0081] Table 3

[0082]

[0083]

[0084] Table 3 shows the cell viability of human primary hepatocytes in each treatment group at 24 hours, 48 ​​hours, and 96 hours. As shown in Table 3, the cell viability of each group at 24 hours and 48 hours was higher than 100%, and decreased at 96 hours, indicating that the test samples in each group had almost no toxic effect on human primary hepatocytes.

[0085] (3) In vitro hyperuricemia model cell intervention test

[0086] Human primary hepatocytes in the logarithmic growth phase were divided into control group, model group and observation group, with 9 wells in each group.

[0087] 1) Establishment of hyperuricemia model cells:

[0088] LO2 cells in the logarithmic growth phase were taken at 10 5Cells were seeded at a density of 100 μg / mL in a 24-well plate and cultured in a 37°C, 5% CO2 incubator for 48 hours. The culture medium was then removed and different concentrations of adenosine solution (CAS: 58-61-7, Nanjing Spark Biotechnology Co., Ltd.) were added, with three replicate wells set up for each concentration. After a further 36 hours of culture, the cell supernatant was removed and xanthine oxidase was added to a concentration of 0.005 U / mg. The cells were incubated for another 12 hours, and the uric acid concentration in the cell supernatant was analyzed by high-performance liquid chromatography (HPLC). The detection method was described in "Construction of a Hyperuricemia Cell Model and Its Application in Screening Uric Acid-Lowering Peptides [J] Modern Food Science and Technology, Vol. 33, No. 8, 2017." Compared to the control group without the adenosine induction process, the model group showed a significant increase in uric acid production, while the blank control group produced almost no uric acid, indicating that the hyperuricemia model was successfully established.

[0089] 2) Group test

[0090] The above-induced hyperuricemia model cells were plated as the model group and set as the model group, positive drug group, and test group. After 24 hours of adherent growth, the model group was added with complete medium, the positive drug group was added with 0.5 mg / mL febuxostat solution (CAS: 144060-53-7, Beijing Century Maijin Biotechnology Co., Ltd.), and the test group was added with 200 μM of the above test samples containing different test samples (dissolved in tert-butanol) and incubated for 24 hours. The supernatant was removed and the cells were washed three times with PBS. The blank control group was added with complete medium, and the model group, positive drug group, and whey protein peptide group were added with adenosine solution and incubated for another 36 hours. The uric acid content in the cell supernatant was determined by high-performance liquid chromatography.

[0091] After 4 hours of continuous cell culture in each group, the culture medium was collected and centrifuged at 1000 rpm for 5 minutes. The supernatant was then collected and assayed for XO enzyme activity according to the instructions of the XO enzyme assay kit (K710-100, Biovision). Using the enzyme activity in the model group as a reference, the percentage of the difference between the enzyme activity in the supernatant of each cell group and that in the model group was calculated as the percentage of the enzyme activity in the model group.

[0092] Table 4

[0093]

[0094] Table 4 shows the uric acid content in the supernatant of the treated cells in each group, and the data is subjected to multiple comparison and significant difference marking, and "-" represents undetectable. As shown in Table 4, the uric acid content and XO enzyme activity of the model group are the highest, and the uric acid content in the positive drug group is reduced to about half of the content, and the XO enzyme activity is also greatly reduced, indicating that the positive drug has the ability to reduce uric acid content and inhibit XO enzyme activity. In the experimental group, the liposomes and ferrocene sunflower disc peptides both intervene in the XO enzyme activity and uric acid synthesis of L-O2 model cells, resulting in different degrees of reduction in XO enzyme activity and uric acid content.

[0095] Among them, the liposomes provided in Examples 1-2 can reduce the uric acid content in the supernatant of the hyperuricemia model cells to the lowest. Relative to Example 1, the ferrocene sunflower disc peptide provided in Comparative Example 1 does not show the effects of inhibiting XO enzyme activity and reducing uric acid. Relative to Examples 1-2, the liposomes in Comparative Examples 3-4 select sunflower disc peptides, alkaloids and flavones as raw materials, and the effects of inhibiting XO enzyme activity and reducing uric acid are significantly reduced, which may be related to the alkaloids and flavones in the raw materials, and has little to do with the effect of the sunflower disc peptides. Thus, it is found from the above description of the preparation process of the liposomes provided in Examples 1-2 and Comparative Examples 1-5 that not only the ferrocene sunflower disc peptides and the alkaloids and flavones extracted from sunflower are selected as raw materials in Examples 1-2, but also Fc-PDP-9 and Fc-PDP-17 instead of Fc-SFTI-1 are selected as raw materials, so that a preparation capable of significantly interfering with uric acid metabolism of liver cells and significantly reducing the amount of uric acid metabolism can be obtained.

[0096] 6. Small intestinal mucosal epithelial cell test

[0097] (1) Materials

[0098] The small intestinal mucosal epithelial cells of rats were purchased from the ATCC cell bank.

[0099] Test samples: liposomes provided in Examples 1-3 and Comparative Examples 1-5, and ferrocene sunflower disc peptides provided in Examples 1-3, respectively.

[0100] (2) Culture and subculture of small intestinal mucosal epithelial cells of rats

[0101] The small intestinal mucosal epithelial cells of rats were cultured in DMEM medium added with 100 mL / L fetal bovine serum, 10 g / L penicillin and streptomycin in a 37°C, 5% CO2 incubator, and the medium was changed every 2 days. When the number of cells grew to about 80%-90%, the cells were trypsinized and subcultured at a ratio of 1:3, and the cells used for the test were the 3rd generation cells. The cells were seeded at a density of 5x10 4 / cm 2The ratio of the cells was inoculated into the well plate for subsequent experiments. (3) Establishment of the small intestinal mucosal epithelial cell inflammation model

[0102] Uric Acid Treatment: Cells were seeded in 96-well plates at a ratio of approximately 1000 cells per well, with a volume of 100 μL per well. Cells were treated with 50 mg / L uric acid (to ensure model establishment and cell viability), with four replicates per concentration. The cells were incubated in a cell incubator for 48 hours. Cell viability was minimally attenuated using the MTS assay.

[0103] (4) Group test

[0104] Small intestinal mucosal epithelial cells in the logarithmic growth phase were used as the normal group, and the above-mentioned small intestinal mucosal epithelial cell inflammation model cells were used as the model group.

[0105] Approximately 1000 small intestinal mucosal epithelial cells in the logarithmic growth phase were taken and inoculated into a 96-well plate with a volume of 100 μL per well. They were treated with 50 mg / L uric acid (to ensure model establishment and cell activity). Four replicate wells were set for each concentration. After being placed in a cell culture incubator for 48 hours, 100 μL of 2 mg / mL of the above test sample was added and incubated for 24 hours before use.

[0106] (5) Real-time fluorescence quantitative PCR

[0107] To measure mRNA expression of TSPO (transporter protein), ABCG2 (ATP-binding membrane transporter), and IL-1β in small intestinal epithelial cells, RNA was extracted using Trizol (TAKARA). 1 μg of RNA was then reverse-transcribed into cDNA using a reverse transcription kit (TAKARA) according to the manufacturer's instructions. Gene expression levels were determined using the SYBR ExTaq kit (TAKARA), using GAPDH as an internal control. Primer sequences are shown in Table 4.

[0108] Table 5

[0109]

[0110]

[0111] (7) Results

[0112] Table 6 Relative mRNA expression

[0113]

[0114] Table 6 shows the relative expression levels of TSPO, ABCG2, and IL-1β in each group of cells detected by RT-PCR. Multiple comparisons and significant difference marks were performed on each column of data. As shown in Table 5, compared with the normal group, the expression levels of TSPO, ABCG2, and IL-1β in the model group cells after uric acid treatment for 24 hours were significantly increased. This shows that uric acid stimulates the expression of TSPO, ABCG2, and IL-1β in small intestinal mucosal epithelial cells, not only accelerating the uric acid transport of cells, but also causing the cells to produce an inflammatory response.

[0115] In Table 6, after the cells were treated with the ferrocene sunflower disc peptide provided in Examples 1 to 2, the TSPO expression level of the cells was increased relative to the normal group and was equivalent to that of the model group, the ABCG2 expression level was significantly increased relative to the model group, and the IL-1β expression level was significantly decreased relative to the model group. Similarly, after the cells were treated with the liposomes provided in Examples 1 to 2, the TSPO expression level of the cells was significantly increased relative to the model group, the ABCG2 expression level was significantly increased relative to the model group, and the IL-1β expression level was significantly decreased relative to the model group. The liposomes provided in Comparative Examples 3 to 5 used PDP-9, PDP-17, and SFTI-1 as raw materials, respectively, instead of Fc-PDP-9, Fc-PDP-17, and Fc-SFTI-1 as raw materials. After the cells were treated with the liposomes, the TSPO expression level of the cells was significantly decreased relative to the model group, while the ABCG2 and IL-1β expression levels did not change significantly relative to the model group.

[0116] The results showed that compared with liposomes obtained from PDP-9, PDP-17 and SFTI-1 as raw materials and Fc-PDP-9, Fc-PDP-17 and Fc-SFTI-1 as preparations to intervene in small intestinal mucosal epithelial cells, liposomes obtained from Fc-PDP-9, Fc-PDP-17 and Fc-SFTI-1 as raw materials can not only promote their transport of uric acid, but also reduce the occurrence of their inflammatory response.

[0117] 7. Animal experiments

[0118] (1) Experimental animals

[0119] Sixty healthy male Sprague-Dawley rats weighing (250 ± 25) g were selected and provided by the Shanghai Slake Laboratory Animal Center (license number: SCXK(Shanghai)2017-0005). Animals were housed in a clean laboratory with a temperature of 20–25°C, humidity of 40%–70%, noise level <60 dB, ventilation rate of 10–20 times / h, and operating illumination of 12 h / 12 ​​h. All animals were housed individually for one week after purchase. Those with no adverse reactions and normal diet and water intake were included in the experiment.

[0120] (2) Test sample

[0121] The liposomes provided in Examples 1 to 3 and Comparative Examples 1 to 5, and the ferrocene sunflower disk peptide provided in Examples 1 to 3 were used as test samples.

[0122] (3) Establishment of a rat hyperuricemia model

[0123] The rats in the model group were given potassium oxonate (Sigma) 100 mg / kg intraperitoneally and hypoxanthine 500 mg / kg orally to induce hyperuricemia. The modeling drugs were administered once a day for 24 days until the end of the experiment.

[0124] (4) Experimental groups

[0125] After routine adaptive feeding, 10 rats in each of the normal group, model group, experimental group and control group (febuxostat 4 mg / kg dose) were prepared to establish a rat hyperuricemia model.

[0126] (5) Experimental animals

[0127] After successful model establishment, the experimental group received the test article twice daily by gavage at a dose of 7.5 mg / kg / day. The febuxostat group received 4 mg / kg / day once daily. The remaining control and model groups received an equal volume of normal saline by gavage. Starting on day 4 of the experiment, 0.5 hours after modeling agent administration, the test article (dissolved in tert-butyl alcohol) was administered orally, calculated based on the adult dose using the body surface area conversion method. The positive drug group (febuxostat 4 mg / kg dose) and the model and blank groups received only normal saline by gavage. Treatment was administered once daily for a total of 21 days. The entire experiment lasted 24 days. The normal control group received no treatment.

[0128] (6) Detection

[0129] HE staining: The synovial tissue was fixed in 4% paraformaldehyde solution, dehydrated with gradient alcohol, embedded in conventional paraffin, and sliced ​​into 5 μm sections. After HE staining, the sections were read under a light microscope.

[0130] On the 21st day, 3 hours after the drug treatment, 3 ml of blood was collected from the heart (using a vacuum blood collection tube commonly used in clinical practice), and the serum was separated by centrifugation at 3000 r / min and 4°C for 15 minutes and stored at -80°C.

[0131] The serum UA concentration, creatinine and urea nitrogen content were determined using Hitachi-7150 automatic biochemical analyzer.

[0132] ELISA kits (eBioscience) were used to detect the levels of TNF-α and IL-1β in rat serum.

[0133] RT-PCR (relevant kits from TAKARA) was used to extract total cellular RNA according to the Trizol reagent product instructions. 1 μg of RNA was then reverse-transcribed into cDNA using a reverse transcription kit (TAKARA) according to the reagent instructions. Gene expression levels were determined using the SYBR ExTaq kit (TAKARA), using GAPDH as an internal control. The relevant genes and primers for detection are shown in Table 7.

[0134] Table 7

[0135] sequence name Nucleotide sequence (5'→3') TLR4-F ctccattcaagcccaagcct, shown in SEQ ID NO.12 TLR4-R gtccttccatgacagaacggt, shown in SEQ ID NO.13 AKT-F caggaccacgagaagctgtt, shown in SEQ ID NO.14 AKT-R gatctccttggcatcctcgg, shown in SEQ ID NO. 15 PI3K-F ggagaaccagccctaagctc, shown in SEQ ID NO. 16 PI3K-R cagtgatggggttttgcagc, shown in SEQ ID NO. 17 NF-kBp65-F atgcccaacttctccgacag, SEQ ID NO. 18 NF-kBp65-R aggacttccggtactccctc, shown in SEQ ID NO.19

[0136] (7) Results

[0137] like Figure 2 As shown, the synovial tissue of the hind paw joints of rats in the normal group was smooth and intact, while the subsynovial soft tissue consisted of fat, blood vessels, and collagen fibers, with occasional hyperemia. There was no inflammatory cell infiltration, vascular proliferation, or fibrin exudate. In the model group and the positive group, the synovium was hyperemic, with exudative neutrophils and fibrinoid necrosis, focal hyperplasia of synovial surface cells, and diffuse or perivascular inflammatory cell infiltration of the synovium, including neutrophils, lymphocytes, and a few plasma cells. Inflammation was reduced in the experimental group and the positive group.

[0138] Table 8

[0139]

[0140]

[0141] Table 8 shows the results of uric acid, uric acid protein, and blood creatinine levels in the serum of each group of mice. Multiple comparisons were performed on each column of data, and significant differences were marked. The results show that in the blood UA test results of rats, the blood UA level in the model group far exceeded that of the normal control group, and the difference was statistically significant (P < 0.01), indicating that the modeling method is effective. After intraperitoneal injection of potassium oxonate and oral gavage of hypoxanthine, the experimental rats showed a state of hyperuricemia. In the experimental groups, the serum uric acid, uric acid nitrogen, and blood creatinine levels of mice treated with the liposomes and ferrocene sunflower peptide provided in Examples 1 and 2 were significantly lower than those of the model group, and the control effect on uric acid, uric acid nitrogen, and blood creatinine in mice was not inferior to that of the control group.

[0142] Table 9

[0143]

[0144] Table 9 shows the results of TNF-α and IL-1β levels in the serum of mice in each group, with multiple comparisons and significant differences marked for each column of data. In the experimental groups, the TNF-α and IL-1β levels in the serum of mice treated with the liposomes and ferrocene sunflower disc peptide provided in Examples 1 and 2, respectively, were significantly lower than those in the model group, and the control effects on TNF-α and IL-1β in mice were not inferior to those in the control group, indicating that the liposomes and ferrocene sunflower disc peptide provided in Examples 1 and 2, respectively, can effectively control the occurrence of inflammation.

[0145] Table 10 mRNA relative expression

[0146]

[0147]

[0148] Table 10 shows the results of TLR4, AKT, PI3K, and NF-κB-P65 gene expression in the serum of mice in each group, and multiple comparisons and significant difference marks were performed on each column of data. In the experimental group, the TLR4, AKT, PI3K, and NF-κB-P65 gene expression levels in the serum of mice treated with the liposomes and ferrocene sunflower disc peptide provided in Examples 1 to 2 were significantly higher than those in the model group, and the control effect on the expression of TLR4, AKT, PI3K, and NF-κB-P65 genes in mice was not inferior to that of the control group, indicating that the liposomes and ferrocene sunflower disc peptide provided in Examples 1 to 2 have good therapeutic effects on hyperuricemia, and the therapeutic effect is achieved based on the regulation of the PI3K / AKT signaling pathway.

[0149] The above description is only a preferred specific embodiment of the present invention, but the scope of protection of the present invention is not limited thereto. Any changes or substitutions that can be easily thought of by any technician familiar with this technical field within the technical scope disclosed by the present invention should be covered by the scope of protection of the present invention.

Claims

1. Use of sunflower disc liposomes in the preparation of products for reducing inflammatory responses caused by hyperuricemia; The preparation method of the sunflower disc liposome comprises: Weigh soybean lecithin, cholesterol, and distearoylphosphatidylethanolamine methoxypolyethylene glycol into a 250 mL single-necked round-bottom flask and add dichloromethane to dissolve all the solids. Then, a methanol solution containing ferrocenyl sunflower disc peptide, total sunflower disc alkaloids and total sunflower disc flavonoids was added and ultrasonicated for 30 seconds to mix them evenly. Subsequently, the flask was connected to a rotary evaporator, and the dichloromethane-methanol solution was completely evaporated in a 42°C water bath under vacuum to form a uniform yellow phospholipid film with refractive index on the wall of the flask; as well as Remove the flask, add 8 mL of sterile pH 7.4 PBS solution, separate the phospholipid membrane in an ultrasonic cleaner, and then transfer the flask to an ultrasonic cell disruptor and sonicate at 300 W for 10 min to allow the phospholipid membrane to self-assemble into sunflower disc liposomes. The preparation method of the ferrocene sunflower disk peptide comprises: protecting the amino group of the sunflower disk peptide; reacting aminoferrocene with the amino-protected sunflower disk peptide to form tert-butyloxy-sunflower disk peptide-ferrocene; and then acid hydrolyzing the reacted ferrocene to obtain the ferrocene-modified sunflower disk peptide; wherein the sunflower disk peptide is PDP-9 with an amino acid sequence as shown in SEQ ID NO.1, or PDP-17 with an amino acid sequence as shown in SEQ ID NO.2; The step of "protecting the amino group of the sunflower peptide" specifically includes: A saturated solution of sodium bicarbonate was prepared and mixed with a dioxane solution containing di-tert-butyl dicarbonate; then the sunflower peptide mixture was added in small amounts and multiple times, and the reaction progress was monitored by TLC; After reacting overnight, wash with ethyl acetate 2-3 times; The aqueous phase was washed twice with ethyl acetate; the oil phase was washed twice with saturated sodium bicarbonate; Then, all the aqueous phases were mixed and the pH of the aqueous phase was adjusted to 1 with 10% hydrochloric acid, and the aqueous phase was washed twice with ethyl acetate; the above oil phases were collected and dried over anhydrous sodium sulfate, filtered, and evaporated to dryness to obtain a crystalline product; The step of "reacting aminoferrocene with amino-protected sunflower peptide to form tert-butyloxy-sunflower peptide-ferrocene" comprises: The amino-protected sunflower peptide obtained above was dissolved in anhydrous dichloromethane in a dry round-bottom flask, triethylamine was added at 0°C, and then benzotriazole-1-tetramethyl hexafluorophosphate was added and reacted for 1 hour; Add amino-ferrocene, react for 2 h, then move to room temperature for overnight reaction, and monitor the reaction progress by TLC. After the reaction is completed, the mixture is washed with saturated sodium bicarbonate solution, 0.5 M hydrochloric acid, 0.5 M sodium bicarbonate solution and water, respectively. Finally, the oil phase is dried over anhydrous sodium sulfate, filtered and evaporated to dryness to obtain a solid. The solid was dissolved in dichloromethane and ethanol, and passed through a chromatography column using a mixed solution of dichloromethane and ethanol in a volume ratio of 95:5 as an eluent. The fractions were collected and dried to obtain a purified tert-butyloxy-sunflower peptide-ferrocene solid; The step of "acid hydrolysis" specifically includes: Dissolve tert-butyloxy-sunflower peptide-ferrocene in ethyl acetate solution, then pass dry HCl gas at 0℃ for 1 hour, then react at room temperature for 0.5 hours, and finally evaporate to dryness; The solid was dissolved in methanol and recrystallized repeatedly with ether to obtain relatively pure ferrocenium sunflower peptide.

2. The use according to claim 1, characterized in that The method for extracting total alkaloids and total flavonoids from sunflower discs comprises: Take the sunflower disk powder particles and extract them once with 10 times the mass of 50% ethanol under reflux for 15 minutes, filter, and concentrate the filtrate under reduced pressure to 0.5 times the mass of the sunflower disk powder to obtain the alcohol extract; 1000 mL of pretreated D001 macroporous resin was loaded into a glass column with an inner diameter of 60 mm and a height of 1200 mm. The alcohol extract obtained from the above extraction was added and slowly adsorbed. After that, water-soluble impurities were washed away with 5 times the column volume of distilled water at a flow rate of 4 BV / h. Then, elute with 5BV of 50% ethanol at a flow rate of 1BV / h, and collect eluate I. Then, elute with 5BV of 50% ethanol containing 1% ammonia water at a flow rate of 1BV / h, and collect eluate II. The total flavonoids of sunflower disc are obtained by concentrating and drying the eluate I, and the total alkaloids of sunflower disc are obtained by concentrating and drying the eluate II.

Images