Application of FGF8 protein in preparation of antibacterial agent

Abstract

The invention belongs to the technical field of genetic engineering, and discloses application of FGF8 protein in preparation of an antibacterial agent. Escherichia coli BL21 (DE3) is adopted to express grass carp FGF8a and mouse FGF8b, the grass carp FGF8a and mouse FGF8b recombinant protein is obtained after purification of a Ni < 2 + >-TED agarose gel column, and it is found that the two proteins have the remarkable sterilization effect on gram-negative bacteria and gram-positive bacteria, can be used for preparing broad-spectrum antibacterial agents or antibacterial drugs and have high application value.

Description

Technical Field

[0001] The present invention belongs to the field of genetic engineering technology, and specifically relates to the application of FGF8 protein in the preparation of antibacterial agents. The present invention discloses and verifies for the first time that FGF8 protein (including grass carp FGF8a protein and / or mouse FGF8b protein) has a broad-spectrum antibacterial effect. Background Art

[0002] With the development of aquaculture, problems such as antibiotic resistance and drug residues caused by excessive use of antibiotics have seriously restricted the development of aquaculture in my country. Therefore, it is urgent to develop new antimicrobial drugs to replace traditional antibiotics in aquaculture. Antimicrobial peptides or antimicrobial proteins are a class of polypeptides or proteins with broad-spectrum antibacterial, antifungal, viral, protozoan and tumor cell inhibition activities. And with its unique mechanism of action and low resistance to drug resistance, it is considered to be one of the effective alternatives to antibiotics and has broad application prospects in disease prevention and control.

[0003] Fibroblast growth factor 8 (FGF8) is a member of the fibroblast growth factor (FGF) family. It is expressed in a variety of tissues during the embryonic period and is crucial to the formation of various organs and the nervous system. In addition, FGF8 is also present in peripheral blood leukocytes and participates in the formation of normal red blood cells. Since FGF8 is involved in the proliferation and differentiation of tissue cells, FGF8 also has the potential for application in tissue trauma repair in clinical practice.

[0004] The present invention discovers for the first time that FGF8 protein (including FGF8a protein of grass carp and / or FGF8b protein of mouse) has a broad-spectrum antibacterial activity and can be used to prepare a broad-spectrum antibacterial agent. Summary of the invention

[0005] The purpose of the present invention is to provide the use of fibroblast growth factor 8 in the preparation of antibacterial agents.

[0006] Another object of the present invention is to provide the use of fibroblast growth factor 8 in the preparation of a drug for treating or preventing bacterial infection. In order to achieve the above object, the present invention adopts the following technical measures:

[0007] Application of fibroblast growth factor 8 protein or its encoding gene in the preparation of antibacterial agents.

[0008] Application of fibroblast growth factor 8 protein or its encoding gene in preparing medicine for treating or preventing bacterial infection.

[0009] In the above application, preferably, the fibroblast growth factor 8 is a fibroblast growth factor 8 of a mammal or / and an oviparous animal;

[0010] In the above application, preferably, the mammal is a mouse; and the oviparous animal is a fish.

[0011] In the above application, preferably, the fibroblast growth factor 8 is grass carp FGF8a protein and / or mouse FGF8b protein, the grass carp FGF8a protein includes the sequence shown in SEQ ID NO.1, and the mouse FGF8b protein includes the sequence shown in SEQ ID NO.2.

[0012] In the above application, preferably, the fibroblast growth factor 8 contains a protein purification tag.

[0013] In the above application, preferably, the coding gene of the grass carp FGF8a protein is shown in SEQ ID NO.3, and the coding gene of the mouse FGF8b protein is shown in SEQ ID NO.4.

[0014] In the above application, preferably, the bacteria are Gram-negative bacteria and / or Gram-positive bacteria;

[0015] In the above application, preferably, the Gram-negative bacteria include:

[0016] Escherichia coli, Aeromonas hydrophila, Yersinia ruckeri, Pseudomonas fluorescens, Edwardsiella ictaluri, Vibrio fluvialis and / or Aeromonas sobria;

[0017] The Gram-positive bacteria include: Staphylococcus aureus S. aureus (Staphylococcus aureus), Streptococcus agalactiae S. agalactiae (Streptococcus agalactiae), Micrococcus luteus M. luteus (Micrococcus luteus) and / or Streptococcus dysgalactiae S. dysgalactiae (Streptococcus dysgalactiae).

[0018] Compared with the prior art, the present invention has the following beneficial effects:

[0019] The present invention discovers for the first time that fibroblast growth factor 8 (FGF8) from different animals has a broad-spectrum antibacterial effect and has a good effect on both Gram-negative and Gram-positive bacteria.

[0020] In the present invention, the applicant adopted the prokaryotic expression method to express and purify grass carp FGF8a and mouse FGF8b, and found that the FGF8 proteins of the two animals had significant bactericidal effects on both Gram-negative and Gram-positive bacteria, that is, they had broad-spectrum antibacterial activity and could be used to prepare broad-spectrum antibacterial agents or antibacterial drugs. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 This is a graph showing the results of the purification of the grass carp FGF8a recombinant protein in Example 1 of the present invention;

[0022] Lane M: Protein Marker; Lane 1: His-grass carp FGF8a fusion protein.

[0023] Figure 2 This is a graph showing the antibacterial activity test results of the grass carp FGF8a recombinant protein in Example 2 of the present invention.

[0024] Figure 3 This is a diagram showing the results of purification of mouse FGF8b recombinant protein in Example 1 of the present invention;

[0025] Lane M: Protein Marker; Lane 1: His-mouse FGF8b fusion protein.

[0026] Figure 4 This is a graph showing the antibacterial activity test results of the mouse FGF8b recombinant protein in Example 2 of the present invention. DETAILED DESCRIPTION

[0027] The technical scheme of the present invention will be described clearly and completely below in conjunction with the embodiments of the present invention. Obviously, the described embodiments are only a part of the embodiments of the present invention, rather than all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0028] The present invention adopts the prokaryotic expression method to obtain grass carp FGF8a and mouse FGF8b recombinant proteins with purification tags, and verifies their antibacterial effects. Proteins obtained by other methods, such as artificially synthesized grass carp FGF8a and mouse FGF8b without purification tags, can also achieve their antibacterial effects, which will not be repeated in this application due to space limitations.

[0029] Embodiment 1:

[0030] Preparation of grass carp FGF8a and mouse FGF8b recombinant proteins:

[0031] (1) Amplification of the grass carp FGF8a gene and synthesis of the mouse FGF8b gene

[0032] According to the gene sequence of grass carp FGF8a on NCBI and the multiple cloning site on the pET-15b vector, specific primers with NcoI and BamHI restriction sites were designed using PrimerPremier 5.0 software:

[0033] Up:catg a ccatgg b ac c TCCCCGCCTAATTTTACACAG,

[0034] Down:cgc d ggatcc e TCAACGCTCTCCTGAGTAGCG.

[0035] in a and d Represents the protective base of the restriction site, b and e Represent NcoI and BamH I restriction sites, respectively. c stands for mismatch-protected bases.

[0036] The target gene FGF8a shown in SEQ ID NO.3 (the gene does not contain a signal peptide sequence) was cloned using grass carp cDNA as a template, and the PCR product was recovered using a PCR product recovery kit.

[0037] The mouse FGF8b gene sequence (shown in SEQ ID NO. 4) with NcoI and BamH I restriction sites added at the 5' and 3' ends, respectively, was synthesized by Wuhan Qingke Biotechnology Co., Ltd.

[0038] (2) Obtaining BL21-pET-15b-FGF8a and BL21-pET-15b-FGF8b engineered bacteria

[0039] The grass carp FGF8a gene PCR recovery product in step (1) was double-digested with NcoI and BamH I, and then connected with T4 DNA ligase, and then transformed into DH5α competent cells. In addition, the synthesized mouse FGF8b gene sequence with NcoI and BamH I restriction sites was connected to the double-digested pET-15b plasmid, and then transformed into DH5α competent cells. The positive clones were screened and sequenced respectively, and the grass carp pET-15b-FGF8a and mouse pET-15b-FGF8b recombinant plasmids were extracted from the strains with correct sequencing and transformed into BL21 (DE3) expression strains respectively. The positive clones were engineering bacteria (BL21-pET-15b-FGF8a and BL21-pET-15b-FGF8b) containing the pET-15b-grass carp FGF-8a and pET-15b-mouse FGF-8b recombinant plasmids, respectively.

[0040] (3) Prokaryotic expression and purification of His-grass carp FGF8a and His-mouse FGF8b fusion proteins

[0041] 1) Prepare buffer A, pH 8.0: 20 mM Tris, 300 mM NaCl; binding buffer B, pH 8.0: 20 mM Tris, 300 mM NaCl, 8 M urea; wash buffer C, pH 8.0: 20 mM Tris, 300 mM NaCl, 8 M urea, 10 mM imidazole; elution buffer D, pH 8.0: 20 mM Tris, 300 mM NaCl, 8 M urea, 300 mM imidazole; dialysate E, pH 7.4: 20 mM Tris.

[0042] 2) The engineered bacteria BL21-pET-15b-FGF8a and BL21-pET-15b-FGF8b were inoculated into LB medium containing ampicillin (100 μg / mL) and cultured at 37°C with shaking until OD 600 =0.6, IPTG was added to a final concentration of 0.75 mM and induced at 37°C for 5 h.

[0043] 3) Collect the cells by centrifugation (5000 g, 10 min) and resuspend in 50 mL of pre-cooled solution A. After high-pressure disruption for 10 min, centrifuge at 12000 g for 60 min to collect the inclusion body precipitate.

[0044] 4) Dissolve the inclusion bodies with 50 mL of solution B, centrifuge at 12,000 g for 60 min, and collect the supernatant.

[0045] 5) 100mL of solution B to balance Ni 2+-TED agarose column, incubate the supernatant with the purified filler at 4°C overnight, wash with 200mL of solution B, wash with 200mL of solution C, and elute the target protein with 20mL of solution D. The eluted target protein was dialyzed into buffer E with a gradient of urea, imidazole, and sodium chloride to obtain His-grass carp FGF8a fusion protein fused with His tag ( Figure 1 , comprising the amino acid sequence shown in SEQ ID NO.1) and His-mouse FGF8b fusion protein ( Figure 3 , comprising the amino acid sequence shown in SEQ ID NO.2).

[0046] Embodiment 2:

[0047] Detection of antibacterial activity of grass carp FGF8a and mouse FGF8b proteins in vitro

[0048] This example uses 7 common Gram-negative bacteria and 4 Gram-positive bacteria in the art as examples to verify the in vitro broad-spectrum antibacterial activity of grass carp FGF8a and mouse FGF8b proteins, including:

[0049] Gram-negative bacteria:

[0050] Grass carp FGF8a protein test group: Escherichia coli, Aeromonas hydrophila, Yersinia ruckeri, Pseudomonas fluorescens, Edwardsiella ictaluri, Vibrio fluvialis and Aeromonas sobria;

[0051] Mouse FGF8b protein test group: Escherichia coli, Aeromonas hydrophila, Yersinia ruckeri and Pseudomonas fluorescens;

[0052] Gram-positive bacteria:

[0053] Grass carp FGF8a protein test group: Staphylococcus aureus S.aureus, Streptococcus agalactiae S.agalactiae, Micrococcus luteus M.luteus and Streptococcus dysgalactiae S.dysgalactiae.

[0054] Mouse FGF8b protein test group: Staphylococcus aureus S. aureus, Streptococcus agalactiae S. agalactiae and Micrococcus luteus M. luteus. (1) Detection of bactericidal activity of grass carp FGF8a and mouse FGF8b

[0055] 1) Take 11 strains frozen at -80°C and streak them on TSA plates, and culture them at 37°C (Escherichia coli, Yersinia ruckeri, Pseudomonas fluorescens, Staphylococcus aureus, Streptococcus agalactiae, Micrococcus luteus and Streptococcus dysgalactiae) or 28°C (Aeromonas hydrophila, Edwardsiella ictaluri, Vibrio fluvii and Aeromonas sobria) for 18-24 h; select a single colony on the TSA plate and inoculate it into 20 mL TSB medium, shake it to the logarithmic phase (3-5 h), and centrifuge (5000g, 10 min) to collect the bacteria;

[0056] 2) Wash the bacteria twice with 20 mM Tris (pH 7.4) (5000 g, 10 min) and adjust the concentration of the bacterial solution to 5 × 10 7 CFU / mL.

[0057] 3) The bacterial suspension (2 μL) of the grass carp FGF8a protein and mouse FGF8b protein test strains were mixed evenly with different concentrations of the corresponding proteins (48 μL) or an equal volume of Tris buffer, and incubated at 37°C or 28°C for 3 h. The bacterial count in each group was then calculated using the dilution plate method combined with the CFU counting method.

[0058] An equal volume of Tris buffer was used instead of FGF8a protein as a negative control.

[0059] 4) Calculate the antibacterial rate according to the following formula:

[0060] Bacterial inhibition rate = (number of colonies in the negative control group - number of colonies in the experimental group) / number of colonies in the negative control group × 100%

[0061] according to Figure 2 and Figure 4 The test results showed that grass carp FGF8a and mouse FGF8b had good bactericidal activity against both Gram-negative and Gram-positive bacteria and could be used to prepare antibacterial agents.

[0062] Table 1 Antibacterial rate of grass carp FGF8a on bacteria

[0063]

[0064]

[0065] Table 2 Antibacterial rate of mouse FGF8b against bacteria

[0066]

[0067] The above description is only a preferred specific implementation manner of the present invention, but the protection scope of the present invention is not limited thereto. Any changes or substitutions that can be easily conceived by any technician familiar with the technical field within the technical scope disclosed by the present invention should be covered within the protection scope of the present invention.

Claims

1. Use of fibroblast growth factor 8 protein or its encoding gene in the preparation of antibacterial agents.

2. Use of fibroblast growth factor 8 protein or its encoding gene in the preparation of drugs for treating or preventing bacterial infections.

3. The use according to claim 1 or 2, characterized in that: The fibroblast growth factor 8 is mammalian or / and oviparous animal fibroblast growth factor 8.

4. The use according to claim 3, characterized in that: The mammal is a mouse; the oviparous animal is a fish.

5. The use according to claim 4, characterized in that: The fibroblast growth factor 8 is grass carp FGF8a protein and / or mouse FGF8b protein. The grass carp FGF8a protein includes the sequence shown in SEQ ID NO.1, and the mouse FGF8b protein includes the sequence shown in SEQ ID NO.

2.

6. The use according to claim 1 or 2, characterized in that: The fibroblast growth factor 8 contains a protein purification tag.

7. The use according to claim 1 or 2, characterized in that: The bacteria are Gram-negative bacteria and / or Gram-positive bacteria.

8. The use according to claim 7, characterized in that: The Gram-negative bacteria include: Escherichia coli ( Escherichia coli )、Aeromonas hydrophila( Aeromonas hydrophila ), Yersinia ruckeri ( Yersinia ruckeri ), Pseudomonas fluorescens ( Pseudomonas fluorescens ictaluri ( Edwardsiella ictaluri )、Vibrio fluvibrios( Vibrio fluvialis ) and / or Aeromonas sobria ( Aeromonas sobria ); The Gram-positive bacteria include: Staphylococcus aureus ( Staphylococcus aureus )、Streptococcus agalactiae( Streptococcus agalactiae ), Micrococcus luteus ( Micrococcus luteus ) and / or Streptococcus dysgalactiae ( Streptococcus dysgalactiae ).

9. The use according to claim 5, wherein the coding gene of the grass carp FGF8a protein is shown in SEQ ID NO.3, and the coding gene of the mouse FGF8b protein is shown in SEQ ID NO.4.

Images