Kazakstan yeast, grapefruit enzyme and application of Kazakstan yeast and grapefruit enzyme in parasite expelling or insecticide preparation

Abstract

The invention discloses Kazakstan yeast, grapefruit enzyme and application of the Kazakstan yeast and the grapefruit enzyme in parasite expelling or insecticide preparations, and belongs to the technical field of fermentation engineering. The grapefruit enzyme disclosed by the invention is obtained by taking grapefruits as a main raw material, inoculating Kazakstan yeast EY02 and / or lactobacillus casei EL01 and lactobacillus plantarum CICC20270 and fermenting. Wherein the Kazakstan yeast EY02 is preserved in the China Center for Type Culture Collection on July 6, 2023, and the preservation number of the Kazakstan yeast EY02 is CCTCC (China Center for Type Culture Collection) M20231205. The grapefruit enzyme prepared by the invention has a good insect repelling / killing effect on pests such as cnaphalocrocis medinalis in crop planting, and the insect repelling / killing rate reaches 93% or above. The method has a good application prospect in the aspect of promoting wide planting of the organic rice.

Description

Technical Field

[0001] The invention relates to the technical field of fermentation engineering, in particular to a strain of Kazakhstan yeast, grapefruit enzyme and applications thereof in anthelmintic or insecticide preparations. Background Art

[0002] Rice is one of the most important food crops in the world and is widely planted in many countries and regions. There are differences in rice planting area, varieties, planting techniques, and environmental and climatic conditions in different regions. Rice is easily attacked by a variety of pests and diseases during its growth process. Common pests and diseases include rice leaf roller, aphids, and red spiders. The occurrence of pests and diseases will have a serious impact on the growth, development and yield of rice. If prevention and control are not timely or inappropriate measures are taken, it may lead to a reduction in rice production or even a total loss. Among them, the rice leaf roller, also known as the scraping worm, white leaf worm, and leaf bract, is one of the main pests in China's rice-producing areas and is widely distributed in various rice-producing areas. In addition to harming rice, it can also feed on crops such as barley, wheat, sugarcane, and millet, as well as weeds such as barnyard grass, Li's grass, paspalum, double-spiked paspalum, crabgrass, foxtail grass, cricket grass, thatch, and reeds. The larvae damage rice, forming leaves into longitudinal bracts, hiding in them and feeding on the upper epidermis and mesophyll, leaving only the white lower epidermis. Damage to the seedling stage affects the normal growth of rice, and even causes death; damage to the tillering stage to the jointing stage reduces tillering, shortens the plant, and delays the growth period; after heading, especially during the heading to full heading stage, the sword leaf is damaged, affecting flowering and fruiting, increasing the empty shell rate, and reducing the thousand-grain weight.

[0003] At present, the methods of pest control and repellent include chemical control, physical control and biological control. Chemical control refers to the rapid and effective control of the occurrence and development of pests and diseases by using chemical pesticides. However, the long-term and large-scale use of chemical pesticides may bring about problems such as environmental pollution, pesticide residues, and increased pest resistance. Physical control refers to the use of physical methods to control pests and diseases, such as using insecticidal lamps to lure and kill pests, and using the phototaxis of insects to attract and kill them; but its cost is high, the scope of application is limited, and the operation and maintenance requirements are high. Biological control refers to the use of natural enemies of pests to control the number of pests, or the use of biological pesticides for control. With the continuous advancement of science and technology and people's attention to environmental protection and food safety, in the future, in terms of rice pest control and repellent, more attention will be paid to the research and development and application of green control technologies, the use of chemical pesticides will be reduced, and biological control will be promoted to achieve sustainable rice production and food security.

[0004] The plant and Chinese medicine repellents / insecticides reported so far are mainly used after simple grinding or extraction of active ingredients with chemical solvents. Patent No. 202110702449.2 discloses a grapefruit oil with cowpea aphid insecticide activity and its insecticide and application, which mainly uses organic solvents to extract plant secondary metabolites from grapefruit seeds for cowpea aphid insecticide. However, there are some disadvantages, such as: due to the use of organic solvent extraction, after extraction, when crops are used in agriculture, there will be organic solvent residues; at the same time, there are few grapefruit seeds, etc., which leads to insufficient raw materials when extracting and preparing insecticides. Patent No. 201811280006.3 discloses a special biological insecticide for leek and its preparation method, which uses pyrethrin, total alkaloids of sophora flavescens, morning glory stems and leaves, cucumber vines, purslane, garlic, pomegranate peel, etc., and uses ethanol extraction for biological insecticide in leek planting. However, there are some disadvantages, such as: the use of organic solvent - ethanol for extraction, used in leek planting, there are organic solvent residues and high costs; various stabilizers are added, such as fatty alcohol polyoxyethylene ether, etc., there are organic solvent residues and high costs; waste residues cannot be treated.

[0005] Therefore, in order to solve the above problems and the disadvantages of organic solvent extraction, high cost, insufficient raw materials, etc., it is urgent to provide a method for repelling / killing insects without adding organic solvents, polluting the environment, having sufficient raw materials and low cost. Summary of the invention

[0006] In order to solve the above problems, the present invention provides a strain of Kazakhstan yeast of servazzii, grapefruit enzyme and their application in anthelmintic or insecticide preparations. The present invention adopts a microbial fermentation method, takes grapefruit of natural origin as raw material, and adds auxiliary ingredients such as molasses, water, pepper, and wormwood at the same time, and uses a self-screened new Kazakhstan yeast of servazzii (kazochstaniacervazzii) EY02 (preservation number is CCTCC NO: M 20231205) and / or Lactobacillus casei and Lactobacillus plantarum for fermentation to produce a liquid anthelmintic / insecticide with high efficiency of anthelmintic / insecticide effect. The fermented liquid anthelmintic / insecticide enzyme is applied to the process of crop planting, and has a good anthelmintic / insecticide effect on pests in the process of crop planting. The method of mutualism and mutual restraint is used to grow organic crops well, and the production and management of crops can be developed with high quality and high yield.

[0007] The present invention is achieved through the following technical solutions:

[0008] The first object of the present invention is to provide a Kazakhstan yeast (kazochstania cervazzii) EY02, which has been deposited in the China Center for Type Culture Collection on July 6, 2023, with a deposit number of CCTCC NO: M 20231205; the deposit address is Wuhan University.

[0009] The second object of the present invention is to provide a microbial preparation containing the Kazakhstan yeast EY02.

[0010] The third object of the present invention is to provide the use of the Kazakhstan yeast EY02 or the microbial preparation in the preparation of grapefruit enzyme.

[0011] The fourth object of the present invention is to provide a method for preparing grapefruit enzyme using the Kazakhstan yeast EY02, comprising the following steps:

[0012] The grapefruit enzyme is obtained by inoculating a mixture of grapefruit and water with Kazakhstan yeast EY02 for fermentation; the inoculation amount of Kazakhstan yeast EY02 is 0.5%-10%;

[0013] And / or, using a mixture of grapefruit and water as a raw material, inoculating Kazakhstan Saccharomyces cerevisiae EY02 and Lactobacillus casei for fermentation to obtain the grapefruit enzyme; the inoculation amounts of Kazakhstan Saccharomyces cerevisiae EY02 and Lactobacillus casei are independently 0.5%-10%;

[0014] And / or, a mixture of grapefruit and water is used as a raw material, and Kazakhstan Saccharomyces cerevisiae EY02 and Lactobacillus plantarum are inoculated for fermentation to obtain the grapefruit enzyme; the inoculation amounts of Kazakhstan Saccharomyces cerevisiae EY02 and Lactobacillus plantarum are independently 0.5%-10%.

[0015] In one embodiment of the present invention, the Lactobacillus casei is Lactobacillus casei EL01;

[0016] And / or, the Lactobacillus plantarum is Lactobacillus plantarum CICC20270;

[0017] And / or, the fermentation temperature is 5°C-38°C;

[0018] And / or, the fermentation is carried out by stirring fermentation, and the stirring speed is 10rpm-300rpm;

[0019] And / or, the fermentation period is 7 days to 20 days.

[0020] In one embodiment of the present invention, the pomelo is selected from one or more of landscape pomelo, field pomelo, pomelo, golden pomelo, Dianjiang white pomelo, Jinlan pomelo, Pingshan pomelo, Changshan pomelo, four seasons pomelo, Chuhong pomelo and Guanxi honey pomelo.

[0021] In one embodiment of the present invention, the concentration of grapefruit in the raw material is 5wt%-60wt%.

[0022] In one embodiment of the present invention, the raw materials further include one or more of molasses, chili pepper and mugwort.

[0023] In one embodiment of the present invention, the contents of molasses, water, chili pepper and wormwood are 2wt%-20wt%, 40wt%-80wt%, 1wt%-15wt% and 0.5wt%-20wt%, respectively.

[0024] In one embodiment of the present invention, the pepper is selected from one or more of green pepper, red pepper, millet pepper, wild pepper, lantern pepper, bullet pepper, erjingtiao, Qin pepper, seven-star pepper, yellow lantern pepper and devil pepper.

[0025] The fifth object of the present invention is to provide grapefruit enzyme prepared by the method.

[0026] The sixth object of the present invention is to provide the use of the grapefruit enzyme in preparing anthelmintic or insecticide preparations for crops.

[0027] In one embodiment of the present invention, the insect is one or more of rice leaf folder, aphid and red spider.

[0028] In one embodiment of the present invention, the method for repelling or killing insects is: spraying the grapefruit enzyme obtained by fermentation on crops; spraying once every 4 to 15 days, and the spraying amount per mu of land each time is 0.5 kg to 5.0 kg.

[0029] In one embodiment of the present invention, the Kazakhstan yeast (kazochstania cervazzii) EY02 and Lactobacillus casei EL01 are yeast and lactic acid bacteria obtained by screening soil samples.

[0030] The grapefruit enzyme of the present invention is applied in the rice planting process and has a good insect repelling / killing effect on the rice leaf folder in the rice.

[0031] The present invention uses Kazakhstan yeast EY02, Kazakhstan yeast EY02 and Lactobacillus casei or Lactobacillus plantarum for fermentation, and optimizes the enzyme fermentation raw material components (such as adding different amounts of peppers for synergistic fermentation) to prepare grapefruit enzyme. The application effect of the fermentation enzyme in killing and repelling insects is further verified through field experiments on rice cultivation.

[0032] The above technical solution of the present invention has the following advantages compared with the prior art:

[0033] The invention provides a strain of Kazakhstan yeast of cervazzii, grapefruit enzyme and application thereof in an anthelmintic or insecticide preparation. The invention adopts a self-screened novel strain of Kazakhstan yeast of cervazzii EY02 and Lacticaseibacillus casei to ferment mature landscape grapefruit and other auxiliary ingredients (molasses, water, pepper and wormwood), and the cultured Kazakhstan yeast of cervazzii EY02 and Lacticaseibacillus casei are fermented to obtain a mature landscape grapefruit and other auxiliary ingredients (molasses, water, pepper and wormwood). casei) liquid bacterial liquid is inoculated into a fermentation medium at an inoculation rate of 0.5%-10%, the content of grapefruit is 10%-50%, the contents of molasses, water, grass charcoal and wormwood are 2%-20%, 40%-80%, 1%-15% and 0.5%-20% respectively, and the fermentation temperature is 5°C-38°C; stirring fermentation is adopted, and the stirring speed is 10rpm-300rpm; the fermentation cycle is 7d-20d, and the fermented liquid insect repellent / insecticidal enzyme is applied in the rice planting process, and has a good insect repellent / insecticidal effect on rice leaf rollers in rice.

[0034] Biodeposit Information:

[0035] Kazakhstan yeast (kazochstania cervazzii) EY02 was deposited in the China Center for Type Culture Collection (CCTCC) on July 6, 2023, with the deposit number CCTCC NO: M 20231205, and the deposit address is Wuhan University; it is classified and named Kazakhstan yeast (kazochstania cervazzii) EY02.

[0036] Lactobacillus casei EL01 was deposited in the China Center for Type Culture Collection (CCTCC) on July 6, 2023, with the deposit number CCTCC NO: M 20231203, and the deposit address is Wuhan University; the classification name is Lacticaseibacillus casei EL01.

[0037] Hanseniaspora valbyensis EY01 was deposited in the China Center for Type Culture Collection (CCTCC) on July 6, 2023, with the deposit number CCTCC NO: M 20231204, and the deposit address is Wuhan University; the classification name is Hanseniaspora valbyensis EY01. BRIEF DESCRIPTION OF THE DRAWINGS

[0038] In order to make the content of the present invention more clearly understood, the present invention is further described in detail below according to specific embodiments of the present invention in conjunction with the accompanying drawings, wherein:

[0039] Figure 1 This is the nucleic acid electrophoresis diagram of Kazakhstan yeast (kazochstania cervazzii) EY02 in Example 1 of the present invention;

[0040] Figure 2 The effect of different strains on the field application effect of liquid insect repellent / insecticide grapefruit enzyme fermentation production in Example 2 of the present invention;

[0041] Figure 3 The effects of different carbon source supplements on the field application of liquid repellent / insecticide grapefruit enzyme fermentation production in Example 3 of the present invention;

[0042] Figure 4 The effect of pepper supplementation on the field application effect of liquid insect repellent / insecticide grapefruit enzyme fermentation production in Example 4 of the present invention;

[0043] Figure 5 This is a diagram showing the effect of spraying the liquid insect repellent / insecticide grapefruit enzyme of the molasses+chili+wormwood group in Example 4 of the present invention in a rice field. DETAILED DESCRIPTION

[0044] The present invention is further described below in conjunction with the accompanying drawings and specific embodiments so that those skilled in the art can better understand the present invention and implement it, but the embodiments are not intended to limit the present invention.

[0045] Unless otherwise specified, the materials and reagents used in the following examples can be obtained from commercial sources.

[0046] Example 1 Screening and identification of Kazakhstan yeast (kazochstania cervazzii) EY02.

[0047] Take 50g of grapes, peaches, cowpeas and peppers harvested from the farm, wash with water, chop, add 1200mL of purified water, add 150g of molasses, and ferment in a water-sealed kimchi jar, control 30℃, and ferment for 7 days. After sampling, YPD solid medium (1% yeast extract, 2% protein Chen, 2% glucose, 2% agar powder) was used to screen yeast. A yeast strain was obtained by screening. The yeast genome was extracted using the Tiangen Biochemical Yeast Genomic DNA Extraction Kit (purchased from Tiangen Biochemical Technology Co., Ltd.; Cat. No.: DP307-02) according to the instructions. The yeast genome was used as a template, the primers were ITS1:TCCGTAGGTGAACCTGCGG (SEQ ID No. 2), ITS4:TCCTCCGCTTATTGATATGC (SEQ ID No. 3), and Ex-Taq enzyme was used for PCR amplification. The PCR conditions were: 94°C 30s, 55°C 30s, 72°C 0.7min, 30 cycles, and the conservative sequence gene fragment was obtained ( Figure 1 ). The conservative sequence of the above strain was sequenced to obtain a gene sequence (as shown in SEQ ID No.1). The gene sequence obtained by gene sequencing was compared with the NCBI database (BLAST), and the yeast strain obtained by screening was determined to be Kazochstania cervazzii, named Kazochstania cervazzii EY02. Compared with all the conservative gene sequences of microorganisms in the NCBI database, the highest similarity of Kazochstania cervazzii EY02 was only 91% (compared with the strain Saccharomyces servazzii D89895.1, where the synonym of Saccharomyces servazzii is kazochstania cervazzii), which fully shows that the strain obtained by screening is a new strain.

[0048] SEQ ID No. 1 is as follows:

[0049] TTATTGACATGCATAAGGCTTCAGAGGGTAATCCTACCTGACTTGAGGACAGACTTAAAAGAACACTGTTCACCATGGTACAACTTAGTAAAAGCACTACACTGACTGCAGATCTCCCCGCTAACCGTCTACGAAGTTGGTAGAAGCTAATACGAAGAAGTCCAGCACGACGTCCCTTAA AGCAGCTAGCGCACTCCGCGAACGGAGACACTCAACCACTACAGCCATCGCCCAGCAATTTCTAGCTATCTCCCAAAGGGTATCCCTCAGAACCATACATTCCTGATTGAGAAGGAAATGACACTCAATCAGGCATTCCCCTGGAATACCAGAGGGCGCAATGTGCGTTCAAAGATTCGA TGATTCACGGAATCCTGCAATTCACATTACGTATCGCGTTTCGCTGCGTTCTTCATCCATGCCAGACCCAAGAGATCCGATGTTGAAAGTATTAATAATTGTTTTAATATTAGAAAGAGATAAATCTTCCGGGAATTCTGGTGTTGACTGGTTCATTAAATTACATAATTGTTTGTGATTG TCACTCATGGGCAGCCGAAGCAGCCCAAAGTAGCATGCAACGAATTATAAAGATCTCCACTGGGTGTAATGGTGCTACTGAACTACAGAAACCCACAAAACCGCGCAATTAAGCGCTGGTTCAGCAATATAGTGTCTCCACGCAAAGCAACGAAAAATTATATTTCTATAATGATCCTTCC GCAGGTTCACCCT.

[0050] Example 2 Effect of different strains on the field application effect of liquid insect repellent / insecticide grapefruit enzyme fermentation production.

[0051] Kazochstania cervazzii EY02 and Lactobacillus casei EL01 obtained by screening were inoculated into YPD liquid medium (1% yeast extract, 2% peptone, 2% glucose) and optimized MRS liquid medium (1% tryptone, 1% beef extract, 0.5% yeast extract, 2% glucose, 8% Tween, 0.2% K2HPO4, 0.5% sodium acetate, 0.2% citrate, 0.005% MgSO4·4H2O). When Kazochstania cervazzii EY02 seeds were cultured, the liquid volume was 1000mL in a 5L triangular bottle, and cultured at 200rpm and 30℃ for 36h. When Lacticaseibacillus casei EL01 seeds were cultured, the liquid volume was 1000 mL in a 5 L triangular bottle, and the culture was carried out at 200 rpm and 37° C. for 36 h.

[0052] After crushing the landscape pomelo, mix it with other auxiliary ingredients (water) to obtain a fermentation medium. Inoculate them separately as follows: 1) Inoculate the cultured Kazakhstan yeast (kazochstania cervazzii) EY02 into the fermentation medium at an inoculation rate of 1%. 2) Inoculate the cultured Hanseniaspora valbyensis EY01 seed liquid into the fermentation medium at an inoculation rate of 1%. 3) Inoculate the cultured Saccharomyces cerevisiae BY47 seed liquid into the fermentation medium at an inoculation rate of 1%. 4) Inoculate the cultured Kazakhstan yeast (kazochstania cervazzii) EY02 and Lactobacillus casei (Lacticaseibacillus casei) EL01 seed liquid into the fermentation medium at an inoculation rate of 1%. 5) The cultured Hansenia spora valbyensis EY01 and Lactobacillus casei EL01 seed solutions were inoculated into the fermentation medium at an inoculation rate of 1%, respectively. 6) The cultured Kazakhstan yeast EY02 and Lactobacillus plantarum CICC20270 seed solutions were inoculated into the fermentation medium at an inoculation rate of 1%, respectively. 7) No exogenous microorganisms were inoculated and fermentation was performed directly (control).

[0053] Among them, the grapefruit content is 20%, the water content is 80%, and the fermentation temperature is 30°C; stirring fermentation is adopted, and the stirring speed is 50rpm; the fermentation cycle is 10d. After the fermentation is completed, after filtering through filter cloth, the fermentation liquid is centrifuged by a disc centrifuge to clarify it before use. Among them, the waste residue produced can be used as organic fertilizer after further composting and fermentation. When spraying in farmland, the fermented enzyme does not need to be diluted with water. Using drones, spray twice within 14 days (once every 7 days), and the amount of spraying per acre of rice field each time is 1.3kg. Figure 2 As shown in the figure, the insect repellent / killing rate (rice leaf roller) of the enzyme that was not inoculated with bacteria and only fermented naturally was only 29%. The insect repellent / killing rate of the enzyme fermented by Kazochstania cervazzii EY02 alone was better than that of Hanseniaspora valbyensis EY01 (49%) and Saccharomyces cerevisiae BY47 strain (38%), reaching 58%. The insect repellent / killing rate of the fermentation enzyme of Kazochstania cervazzii EY02 and Lacticaseibacillus casei EL01 was better than that of Hanseniaspora valbyensis EY01 and Lacticaseibacillus casei EL01 (59%), Kazochstania cervazzii EY02 and Lactobacillus plantarum CICC20270 (60%), and the insect repellent / killing rate reached 65%.

[0054] Example 3 Effects of different carbon source supplements on the field application of liquid insect repellent / insecticide grapefruit enzyme fermentation production.

[0055] Kazochstania cervazzii EY02 and Lactobacillus casei EL01 obtained by screening were inoculated into YPD liquid medium (1% yeast extract, 2% peptone, 2% glucose) and optimized MRS liquid medium (1% tryptone, 1% beef extract, 0.5% yeast extract, 2% glucose, 8% Tween, 0.2% K2HPO4, 0.5% sodium acetate, 0.2% citrate, 0.005% MgSO4·4H2O). When Kazochstania cervazzii EY02 seeds were cultured, the liquid volume was 1000mL in a 5L triangular bottle, and cultured at 200rpm and 30℃ for 36h. When Lacticaseibacillus casei EL01 seeds were cultured, the liquid volume was 1000 mL in a 5 L triangular bottle, and the culture was carried out at 200 rpm and 37° C. for 36 h.

[0056] After crushing the landscape pomelo, 80% water (control group), 60% water + 15% molasses (honey group), 60% water + 15% sucrose (sucrose group), and 60% water + 15% glucose (glucose group) were mixed respectively. Inoculate in the following manner: the cultured Kazakhstan yeast (kazochstania cervazzii) EY02 and Lactobacillus casei (Lacticaseibacillus casei) EL01 seed liquid were inoculated into the fermentation medium at an inoculation rate of 0.5%. Among them, the fermentation temperature is 30°C; stirring fermentation is adopted, and the stirring speed is 50rpm; the fermentation cycle is 10d. After the fermentation is completed, after filtering through filter cloth, the fermentation liquid is centrifuged by a disc centrifuge to clarify it before use. Among them, the waste residue produced can be used as organic fertilizer after further composting and fermentation. When spraying in farmland, the fermented enzyme does not need to be diluted with water.

[0057] Using drones, spraying is done twice within 14 days (once every 7 days), and the amount of spraying per mu of rice field each time is 1.3 kg. Figure 3 As shown in the figure, the insect repelling / killing rates of the liquid insect repelling / killing grapefruit enzyme in the molasses group, sucrose group, and glucose group were higher than those of the enzyme without any carbon source added (control group), and their insect repelling / killing rates were 80%, 71%, and 69%, respectively. However, the insect repelling / killing rate of the enzyme without any carbon source added was only 65%.

[0058] Example 4 Effect of adding different key ingredients on the field application effect of liquid insect repellent / insecticide grapefruit enzyme fermentation production.

[0059] Kazochstania cervazzii EY02 and Lactobacillus casei EL01 obtained by screening were inoculated into YPD liquid medium (1% yeast extract, 2% peptone, 2% glucose) and optimized MRS liquid medium (1% tryptone, 1% beef extract, 0.5% yeast extract, 2% glucose, 8% Tween, 0.2% K2HPO4, 0.5% sodium acetate, 0.2% citrate, 0.005% MgSO4·4H2O). When Kazochstania cervazzii EY02 seeds were cultured, the liquid volume was 1000mL in a 5L triangular bottle, and cultured at 200rpm and 30℃ for 36h. When Lacticaseibacillus casei EL01 seeds were cultured, the liquid volume was 1000 mL in a 5 L triangular bottle, and the culture was carried out at 200 rpm and 37° C. for 36 h.

[0060] After crushing the landscape pomelo, 65% water + 15% molasses (molasses group), 63% water + 15% molasses + 2% pepper (molasses + pepper group), and 61% water + 15% molasses + 2% pepper + 2% wormwood (molasses + pepper + wormwood group) were mixed respectively. Inoculate in the following manner: the cultured Kazakhstan yeast (kazochstania cervazzii) EY02 and Lactobacillus casei (Lacticaseibacillus casei) EL01 seed liquid were inoculated into the fermentation medium at an inoculation rate of 0.5%. Among them, the fermentation temperature is 30°C; stirring fermentation is adopted, and the stirring speed is 50rpm; the fermentation cycle is 10d. After the fermentation is completed, after filtering through a filter cloth, the fermentation liquid is centrifuged by a disc centrifuge or the like until it is clarified and then used. Among them, the waste residue produced can be used as organic fertilizer after further composting and fermentation. When spraying in farmland, the fermented enzyme does not need to be diluted with water.

[0061] Using drones, spraying is done twice within 14 days (once every 7 days), and the amount of spraying per mu of rice field each time is 1.3 kg. Figure 4 As shown in the figure, the liquid insect repellent / insecticidal grapefruit enzyme in the molasses + chili group and the molasses + chili + wormwood group had a higher insect repellent / insecticidal rate (rice leaf folder) than the enzyme in the molasses group, which were 86% and 93% respectively. However, the insect repellent / insecticidal rate of the enzyme in the molasses group was only 80%. The fermented liquid insect repellent / insecticidal enzyme was applied in the rice planting process, and had a good insect repellent / insecticidal effect on rice leaf folder ( Figure 5 ).

[0062] Obviously, the above embodiments are merely examples for clear explanation and are not intended to limit the implementation methods. For those skilled in the art, other different forms of changes or modifications can be made based on the above description. It is not necessary and impossible to list all the implementation methods here. The obvious changes or modifications derived from these are still within the protection scope of the invention.

Claims

1. A Kazakh yeast EY02, characterized in that The Kazakh yeast EY02 was deposited in the China Center for Type Culture Collection on July 6, 2023, with the deposit number CCTCC NO: M 20231205; the deposit address is Wuhan University.

2. A microbial preparation containing the Kazakh yeast EY02 according to claim 1.

3. Use of the Kazakh yeast EY02 described in claim 1 or the microbial preparation described in claim 2 in the preparation of grapefruit enzyme.

4. A method for preparing grapefruit enzyme using the Kazakh yeast EY02 of claim 1, characterized in that: The following steps are involved: The grapefruit enzyme is obtained by inoculating a mixture of grapefruit and water with Kazakhstan yeast EY02 for fermentation; the inoculation amount of Kazakhstan yeast EY02 is 0.5%-10%; And / or, using a mixture of grapefruit and water as a raw material, inoculating Kazakhstan Saccharomyces cerevisiae EY02 and Lactobacillus casei for fermentation to obtain the grapefruit enzyme; the inoculation amounts of Kazakhstan Saccharomyces cerevisiae EY02 and Lactobacillus casei are independently 0.5%-10%; And / or, a mixture of grapefruit and water is used as a raw material, and Kazakhstan Saccharomyces cerevisiae EY02 and Lactobacillus plantarum are inoculated for fermentation to obtain the grapefruit enzyme; the inoculation amounts of Kazakhstan Saccharomyces cerevisiae EY02 and Lactobacillus plantarum are independently 0.5%-10%.

5. The method according to claim 4, characterized in that The Lactobacillus casei is Lactobacillus casei EL01; And / or, the Lactobacillus plantarum is Lactobacillus plantarum CICC20270; And / or, the fermentation temperature is 5°C-38°C; And / or, the fermentation is carried out by stirring fermentation, and the stirring speed is 10rpm-300rpm; And / or, the fermentation period is 7 days to 20 days.

6. The method according to claim 4, characterized in that The pomelo is selected from one or more of landscape pomelo, field pomelo, pomelo, golden pomelo, Dianjiang white pomelo, Jinlan pomelo, Pingshan pomelo, Changshan pomelo, four-season pomelo, Chuhong pomelo and Guanxi honey pomelo.

7. The method according to claim 4, characterized in that The concentration of grapefruit in the raw material is 5wt%-60wt%.

8. The method according to claim 4, characterized in that The raw materials also include one or more of molasses, chili pepper and wormwood.

9. The grapefruit enzyme prepared by the method according to any one of claims 1 to 8.

10. Use of the grapefruit enzyme according to claim 9 in preparing anthelmintic or insecticide preparations for crops.

Images