Non-effective pseudomonas YC8 for promoting early growth and quick germination of tobacco at low temperature and application thereof
By isolating and identifying null Pseudomonas YC8, using its nitrogen fixation, phosphorus decomposition, iron production carrier and IAA production capacity, the soil quality and pest control problems in tobacco planting were solved, and the early growth and rapid development and agronomic properties of tobacco plants were significantly improved. , achieving the improvement of the healthy growth of tobacco.
Patent Information
- Application Number
- CN202411341869.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-09-25
- Publication Date
- 2024-12-27
AI Technical Summary
The soil quality and biological activity in tobacco planting have decreased, resulting in limited healthy growth and yield improvement of tobacco, unscientific seedling management, limited pest control effects, and soil complexity hinders the colonization and proliferation of rhizosphere microorganisms, making it difficult to promote tobacco plant growth effect.
A strain of null Pseudomonas YC8, which was effective at low temperature, was determined by 16S rRNA sequencing, and the production capacity of nitrogen fixation, phosphorus decomposition, iron production carrier and IAA were determined at 20°C, combined with ultrasonic cleaning. Treatment with surfactant, the root colonization effect of YC8 strain was obtained, and the YC8 fermentation broth was prepared for tobacco root inoculation, which significantly increased the biomass and plant height of the tobacco strain.
The YC8 strain significantly colonized the tobacco root surface at low temperature and proliferated 20 times, improving the early growth and rapid development ability and agronomic traits of the tobacco strain, improving the growth performance of the tobacco strain, and being easy to promote and apply.
Smart Images
Figure CN119193383A_ABST
Abstract
Description
Technical Field
[0001] The invention relates to an ineffective pseudomonas YC8 capable of promoting early growth and rapid development of tobacco at low temperature and application thereof, belonging to the technical field of tobacco production. Background Art
[0002] The soil quality in tobacco-growing areas has generally declined, the physical and chemical properties have deteriorated, the fertility is insufficient, and the biological activity is gradually declining, which seriously restricts the healthy growth of tobacco and the improvement of yield quality. The extensive management of the seedling raising process and the lack of scientific and standardized operations have also led to uneven quality of tobacco seedlings, which in turn affects subsequent growth and yield. In addition, tobacco is also susceptible to pests and diseases during its growth process. Traditional prevention and control measures have limited effects and may cause pollution to the environment. In domestic tobacco planting, tobacco early growth and rapid development management technologies, including improved seedling raising methods, nutrient soil formulas, and mulching technologies, have achieved remarkable results in practical applications. However, the technology is difficult to promote, and the problem of variety adaptability still exists. The lagging soil improvement and irrigation facility construction also restrict the early growth and rapid development of tobacco. Therefore, the use of microbial means is of great significance in solving the problem of early growth and rapid development of tobacco. They can improve the soil microecological environment, enhance soil fertility, and promote the growth of tobacco roots.
[0003] The rhizosphere environment includes many components, such as carbohydrates, amino acids, and growth substances. At the same time, the number of microorganisms in the rhizosphere soil ranges from tens of thousands to hundreds of millions, among which bacteria are the largest. There are many ways for rhizosphere microorganisms to promote plant growth, including decomposing insoluble substances, improving plant stress resistance, and producing secondary metabolites. Many studies in recent years have pointed out that only by restoring or improving the health of the microscopic soil ecosystem in the root zone of tobacco can the problem of healthy tobacco growth be fundamentally solved. However, the main problem at present is that the complexity of the soil has caused many factors to restrict the colonization and proliferation of antagonistic bacteria in the soil, making it difficult for them to play their due role. Therefore, how to give full play to the role of rhizosphere microorganisms in promoting tobacco plant growth requires further research and exploration. Summary of the invention
[0004] Purpose of the invention: The technical problem to be solved by the present invention is to provide an ineffective Pseudomonas YC8 strain that promotes early growth and rapid development of tobacco at low temperatures and its application.
[0005] Technical solution: In order to solve the above technical problems, the present invention provides a strain of ineffective Pseudomonas (Pseudomonas inefficax) YC8, which is deposited in the General Microbiological Center of China Microbiological Culture Collection Administration, with a deposit address of CGMCC NO.29989 in Beijing, China, a deposit date of March 11, 2024, and a classification name of Pseudomonas inefficax.
[0006] The present invention also provides the acquisition of the YC8 strain on the tobacco root surface:
[0007] (1) Tobacco seedlings were grown at low temperature (20°C) for 20 days. Well-grown tobacco plants were selected, the aboveground parts of the plants were cut off, and the roots were clamped with sterile tweezers and stirred vigorously in a conical bottle filled with PBS buffer so that all the soil on the root surface entered the buffer. The roots were then rinsed with PBS buffer and placed in a test tube filled with a surfactant (0.5 mmol / L Tween 80) to just immerse the roots. The roots were ultrasonically cleaned twice in an ultrasonic cleaner with ice cubes for 30 seconds each time, and the roots were taken out to obtain the tobacco root surface microbiome suspension.
[0008] (2) Take 1 mL of tobacco root microbial suspension and dilute it by 10 -2 , 10 -3 , 10 -4 , 10 -5 and 10 -6 For the series of gradients, take 200 μL of 10 -4 , 10 -5 , 10 -6 The suspension of different concentrations was evenly spread on 0.1TSA medium (containing cycloheximide, 100 mg / L), and each concentration gradient was repeated twice, and cultured in the dark at 20°C for 5 days. According to the morphology, color and size of bacteria, single colonies were picked from the plates with appropriate concentration gradients, and lines were drawn on the plate separation medium for purification and culture. The strains obtained after purification and culture were used as test strains and inoculated on beef extract peptone slant for temporary storage.
[0009] (3) Extract DNA from the test strain and perform 16S rRNA sequencing to determine the taxonomic status of the strain.
[0010] (4) The growth-promoting ability of the strain at low temperature (20°C) was tested, including nitrogen fixation, phosphate solubilization, siderophore production, and IAA production.
[0011] The present invention also provides the method for determining the root surface colonization effect of the strain through the sterile seedling colonization test.
[0012] (1) Prepare 1 / 2 strength MS medium: Dissolve 2.2 g Murashige Skoog medium (containing vitamins) dry powder, 10 g sucrose and 8 g agar powder in 1 L sterile deionized water, adjust pH to 5.8, and sterilize by autoclave at 121°C for 15 minutes. Dispense into 13 cm square culture dishes in a clean bench, 50 ml per dish.
[0013] (2) Tobacco seedling culture: Tobacco seeds were surface sterilized with 75% ethanol (30 s) and 3% NaClO (15 min, 3 times), and then placed in 1 / 2 strength MS medium. After germination for 7 days, the seedlings were transferred to MS medium, with 3 seedlings per medium. The medium was maintained at 20°C for 16 h of light and 8 h of darkness for 7 days.
[0014] (3) Preparation of YC8 fermentation broth: YC8 was fermented at 20°C and 170 rpm for 2 days, and the concentration of the bacterial broth was adjusted to OD 600 =0.1. Each strain was inoculated with 50 μl of bacterial suspension. After 14-28 days of inoculation, bacteria were recovered once a week for a total of 3 times. The tobacco roots were rinsed with sterile water to remove floating bacteria. The roots were then placed in PBS buffer for 5 minutes to extract bacteria on the tobacco root surface. After removing the roots, the suspension was diluted and plated. The YC8 strain grew on the plate, indicating that it was able to colonize the tobacco root surface.
[0015] Wherein, the ineffective Pseudomonas (Pseudomonas inefficax) YC8 is isolated at 20°C.
[0016] The 16s rDNA base sequence of Pseudomonas inefficax YC8 is shown in SEQ ID No.1.
[0017] The present invention also provides a bacterial agent or preparation, wherein the bacterial agent or preparation contains one or more of the ineffective Pseudomonas inefficax YC8 or its fermentation liquid and sterile supernatant.
[0018] The present invention also provides the use of the ineffective Pseudomonas inefficax YC8 or the bacterial agent or preparation in promoting tobacco growth, thereby effectively improving the agronomic traits of tobacco plants and the quality of flue-cured tobacco. The method of the present invention has strong specialization and stable effect.
[0019] The method comprises the following steps: applying the ineffective Pseudomonas inefficax YC8 described in any one of claims 1 to 5 or the bacterial agent or preparation described in claim 4 to tobacco.
[0020] Wherein, the concentration of the ineffective Pseudomonas inefficax YC8 is 5×10 8 cfu / ml~7×10 8 cfu / ml.
[0021] The present invention also provides verification of the early growth and rapid development effect of the YC8 strain. YC8 bacterial solution was inoculated into the roots of sterile tobacco seedlings. Compared with no inoculation, YC8 significantly increased the biomass and plant height of tobacco plants at low temperatures. Strain YC8 can promote the growth of tobacco by colonizing the root surface at low temperatures, producing IAA and iron carriers, fixing nitrogen and solubilizing phosphorus.
[0022] The invention provides a screening system for fast-growing bacterial strains. The culture temperature for separating the bacterial strains is 20° C., and the tobacco is a tobacco seedling transplanted for 30 to 50 days.
[0023] The present invention also provides application of the growth-promoting strain in promoting the growth of tobacco seedlings and improving the agronomic traits of tobacco plants.
[0024] Beneficial effects: Compared with the prior art, the present invention has the following significant advantages: 1. The present invention is the first to isolate and screen out a specific strain YC8 from the tobacco root surface at low temperature (20°C), and determine the growth-promoting characteristics based on IAA and iron carrier production, nitrogen fixation and phosphorus solubilization capabilities; 2. YC8 significantly colonizes on the tobacco root surface at low temperatures and proliferates 20 times, which has a significant early growth and rapid development effect on the tobacco plants, and at the same time has a significant improvement effect on the agronomic traits of the tobacco plants; 3. The strain described in the present invention has an early growth and rapid development effect and improves the agronomic traits of the tobacco plants, and is easy to promote. BRIEF DESCRIPTION OF THE DRAWINGS
[0025] Figure 1 is the growth effect of YC8 on nitrogen-fixing medium;
[0026] Figure 2 is the growth effect of YC8 on phosphate-dissolving medium;
[0027] Figure 3 is the growth effect of YC8 on CAS medium;
[0028] Figure 4 The colonization effect of sterile tobacco seedlings inoculated with YC8 in the fourth week;
[0029] Figure 5 The pot experiment was conducted to verify the growth-promoting effect of growth-promoting strains on tobacco plant biomass and plant height. DETAILED DESCRIPTION
[0030] The technical solution of the present invention is further described below in conjunction with the accompanying drawings.
[0031] Embodiment 1:
[0032] (1) Soil sample acquisition: The sampling site is located in 4 representative soils in Yongzhou, Hunan Province (26°42'N, 111°70'E), which has a history of rice and tobacco rotation. Samples were collected 20 days after tobacco sowing and transplanting. The aboveground part of the plant was cut off, and the roots were clamped with sterile tweezers and stirred vigorously in a conical bottle filled with PBS buffer so that all the soil on the root surface entered the buffer. The roots were then rinsed with PBS buffer and placed in a test tube containing a surfactant (0.5mmol / L Tween80) so that the surfactant just submerged the roots. The roots were ultrasonically cleaned twice in an ultrasonic cleaner with ice cubes for 30 seconds each time, and the roots were taken out to obtain the tobacco root surface microbiome suspension.
[0033] (2) Spreading, isolation, culture and purification: 1 mL of tobacco root microbial suspension was taken and diluted to 10 -2 , 10 -3 , 10 -4 , 10 -5 and 10 -6 For the series of gradients, take 200 μL of 10 -4 , 10 -5 , 10 -6 The suspension of different concentrations was evenly spread on 0.1TSA medium (containing cycloheximide, 100 mg / L), and each concentration gradient was repeated twice, and cultured in the dark at 20°C for 5 days. Single colonies were picked from the plates with appropriate concentration gradients according to bacterial morphology, color, and size.
[0034] (3) Determination of taxonomic status: DNA of bacteria was extracted using a DNA extraction kit (TIANamp Bacteria DNA Kit, TIANGEN). The extracted DNA was subjected to PCR amplification of 16S rDNA. PCR primers 27F and 1492R were used to amplify the target region. The PCR cycle included initial denaturation at 94°C for 5 minutes; denaturation at 94°C for 1 minute, annealing at 54°C for 1 minute, and extension at 72°C for 1 minute, for a total of 35 cycles. The length of the PCR amplification product was detected by 1% agarose gel electrophoresis, and the PCR amplification product was then sent to Shanghai Sangon Biotechnology Technology Service Co., Ltd. for sequencing. The sequencing results were subjected to Blast comparative analysis on NCBI and compared with the gene sequences of other strains in Genbank for homology. The sequence results are shown in SEQ ID No: 1:
[0035] TGCTCCTTGATTCAGCGGCGGACGGGTGAGTAATGCCTAGGAATCTGCCTGGTAGTGGGGGACAACGTTTCGAAAGGAACGCTAATACCGCATACGTCCTACGGGAGAAAGCAGGGGACCTTCGGGCCTTGCGCTATCAGATGAGCCTAGGTCGGATTAGCTAGTTGGTGGGGTAATGGCTCACCAAGGCGACGATCCGTAACTGGTCTGAGAGGATGATCAGTCACACTGGAACTGAGACACGGTCCAGACTCCTACGGGAGGCAGCAGTGGGGAATATTGGACAATGGGCGAAAGCCTGATCCAGCCATGCCGCGTGTGTGAAGAAGGTCTTCGGATTGTAAAGCACTTTAAGTTGGGAGGAAGGGCAGTAAGTTAATACCTTGCTGTTTTGACGTTACCGACAGAATAAGCACCGGCTAACTCTGTGCCAGCAGCCGCGGTAATACAGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCGCGTAGGTGGTTCGTTAAGTTGGATGTGAAAGCCCCGGGCTCAACCTGGGAACTGCATCCAAAACTGGCGAGCTAGAGTACGGTAGAGGGTGGTGGAATTTCCTGTGTAGCGGT.
[0036] (4) This strain belongs to the Proteobacteria, γ-Proteobacteria, Pseudomonadales, Pseudomonas family, and Pseudomonas genus. It was deposited in the General Microbiology Center of China Microorganism Culture Collection Administration on March 11, 2024, with the deposit number CGMCC No.29989, and its classification name is: Pseudomonas inefficax.
[0037] Experimental Example 2: Determination of the growth-promoting ability of strains
[0038] The growth-promoting ability test was performed using the purified strains of Example 1: the strains were cultured in TSB medium at 20°C for 48 h, the bacteria were collected by centrifugation, and resuspended in appropriate sterile water to a final density of 10 8 cells / mL was used as the bacterial suspension. 2 μL of bacterial solution was respectively spotted on nitrogen-free medium, inorganic phosphorus medium and CAS detection medium to detect the strain's ability to fix nitrogen, solubilize phosphorus and produce siderophores, and cultured at 20°C for 7 days. The appearance of obvious hydrolysis circles on the nitrogen-free medium and inorganic phosphorus medium, and the appearance of orange hydrolysis circles on the CAS medium were taken as positive reactions indicating that the strain had the corresponding promoting ability. The strength of the bacterial growth promoting ability was preliminarily determined by the ratio (D / d) of the hydrolysis circle diameter (D) to the colony diameter (d), with 4 parallel experiments in each group. The nitrogen fixation, phosphorus solubilization and siderophore production abilities of YC8 were 2.36, 2.4 and 2.65, respectively. The results are shown in the figure. Figure 1-3 .
[0039] The seed solution (6×10 8 cfu / ml) was inoculated into TSA liquid medium containing 5mmol / L tryptophan, and cultured at 20℃170r / min for 48h. The supernatant was obtained by high-speed centrifugation at 10000r / min for 5min. 1mL of supernatant was added with an equal amount of Salkawski colorimetric reagent and placed in the dark for 30min for IAA colorimetric reaction. The color of the solution turned pink as a positive reaction for the strain to produce IAA hormone. At the same time, a standard curve with IAA concentrations of 0, 20, 40, 60, 80 and 100μg / mL was prepared. The OD value was measured at 530nm by an enzyme reader (Cytation 5, BioTek). The standard curve (y=0.0183x+0.023, R 2 =0.998) The IAA production of YC8 was calculated to be 47.23 mg / L, indicating that YC8 has the ability to produce IAA auxin.
[0040] Example 3: Colonization ability of YC8 on tobacco root surface
[0041] Yunyan 87 tobacco seeds were surface sterilized with 75% ethanol (30 s) and 3% NaClO (15 min, 3 times), respectively, and then placed in 1 / 2 strength Murashige and Skoog (MS) complete medium (Solarbio) containing 2% (wt / vol) sucrose and 0.8% (wt / vol) agar.
[0042] After germination for 7 days, the seedlings were transferred to 1 / 2MS medium, with 3 seedlings per medium, in a light condition of 20°C for 16 h and darkness of 15°C for 8 h for 7 days.
[0043] The growth-promoting bacteria YC8 was selected and fermented at 30°C and 170 r / min. The bacterial solution concentration was adjusted to OD 600 = 0.1. Each strain was inoculated with 50 μL of bacterial suspension, and the bacteria were collected once a week starting from 14 days after inoculation, for a total of 3 times.
[0044] The tobacco roots were rinsed with sterile water to remove floating bacteria. The roots were then placed in PBS buffer for 5 min to extract bacteria on the tobacco root surface. After removing the roots, the suspension was diluted and plated to determine the bacteria colonizing on the root surface.
[0045] Through Table 1 and Figure 4 It can be seen that YC8 proliferated significantly on the root surface 2 weeks after inoculation. The colonization rate stabilized 3 weeks after inoculation, and the bacteria on the root surface increased nearly 20 times. The results showed that YC8 could colonize on the tobacco root surface and promote the growth of tobacco seedlings.
[0046] Table 1 Colonization rate of YC8 on tobacco root surface
[0047] deal with 2 weeks 3 weeks 4 weeks YC8 918％ 1767％ 1749％
[0048] Example 4: Potted plant experiment to verify the growth-promoting effect of the strain on tobacco plants
[0049] After the strain was cultured in TSB medium at 20°C for 48 h, the bacteria were collected by centrifugation and resuspended in appropriate sterile water to a final density of 10 8 Cells / mL were used as bacterial suspension. Uniformly grown tobacco seedlings were selected and planted in pots containing sterile soil and vermiculite (1:1, v / v) at low temperature (20°C). On the 10th and 30th days, 10 mL of bacterial suspension was inoculated, and the control group was inoculated with the same amount of sterile water. After 45 days of planting at low temperature, the biomass and plant height increment of tobacco plants were measured.
[0050] Results Figure 5 The results showed that YC8 significantly increased tobacco biomass and plant height and promoted tobacco growth.
Claims
1. A strain of Pseudomonas inefficax YC8, characterized in that: It is deposited in the General Microbiology Center of China Microbiological Culture Collection Administration, with the deposit address: Beijing, China, the deposit number is CGMCCNO.29989, the deposit date is March 11, 2024, and its classification name is: Pseudomonas inefficax.
2. The ineffective Pseudomonas inefficax YC8 according to claim 1, characterized in that The Pseudomonas inefficax YC8 was isolated at 20°C.
3. The ineffective Pseudomonas inefficax YC8 according to claim 1, characterized in that The 16s rDNA base sequence is shown in SEQ ID No.
1.
4. A bacterial agent or preparation, characterized in that: The bacterial agent or preparation contains one or more of the ineffective Pseudomonas inefficax YC8 or its fermentation liquid and sterile supernatant as described in any one of claims 1 to 3.
5. Use of the ineffective Pseudomonas inefficax YC8 according to any one of claims 1 to 3 or the bacterial agent or preparation according to claim 4 in promoting tobacco growth.
6. The use according to claim 5, characterized in that: The following steps are involved: The Pseudomonas inefficax YC8 according to any one of claims 1 to 3 or the bacterial agent or preparation according to claim 4 is applied to tobacco.
7. The use according to claim 5 or 6, characterized in that: The dosage of the ineffective Pseudomonas inefficax YC8 is 5×10 9 ~7×10 9 Pieces / plant.
8. The use according to claim 5 or 6, characterized in that: The concentration of Pseudomonas inefficax YC8 in the bacterial agent or preparation is 5×10 8 cfu / ml~7×10 8 cfu / ml.
9. The use according to any one of claims 5 to 8, characterized in that: The application temperature of the ineffective Pseudomonas inefficax YC8 or bacterial agent or preparation is 15-20°C.