Lactobacillus brevis
Through the inhibition of the Northeast sauerkraut spoilage bacteria by Lactobacillus shorten HSDF-1bn-2023, the problem of spoilage microorganisms breeding during sauerkraut fermentation was solved, and the quality and food safety of sauerkraut were improved.
Patent Information
- Application Number
- CN202411594340.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-11-09
- Publication Date
- 2024-12-27
AI Technical Summary
The breeding of spoiled microorganisms during fermentation of sauerkraut leads to unstable product quality and potential food safety problems. Existing control methods such as chemical and physical methods have limitations, and it is difficult to effectively inhibit the selection of suitable strains by biological methods.
A strain of Lactobacillus brevis (Levilactobacillus brevis) HSDF-1bn-2023 was provided. By inhibiting Pichia kudriavzevii, which causes Northeast sauerkraut, the co-fermentation experiment of lactic acid bacteria and spoilage bacteria was used. The study found that this strain had a significant inhibitory effect on spoilage bacteria. Can be used as a biopreservative.
Effectively inhibit sauerkraut spoilage bacteria, extend food shelf life, reduce sauerkraut pH and bioamine content, and improve food safety and quality.
Smart Images
Figure CN119193424A_ABST
Abstract
Description
Technical Field
[0001] The invention belongs to the technical field of fermentation, and in particular relates to a strain of Lactobacillus breve. Background Art
[0002] Sauerkraut is a traditional food that is made by naturally fermenting the juice extracted from cabbage using salt. The complex flora (lactic acid bacteria, enterobacteria, pseudomonas and yeast) in the raw materials and the environment make the fermentation process of sauerkraut uncontrollable, resulting in prolonged fermentation time and unstable product quality, which in turn becomes a bottleneck for industrial fermentation. Due to the spontaneity of the sauerkraut production process, the vegetable raw materials are not sterilized, so during the fermentation process, corrupt microorganisms multiply in large numbers, causing the sauerkraut to spoil. Generally, in the late fermentation stage, corrupt microorganisms use the residual sugar or organic acid in the sauerkraut brine as a carbon source or energy source to reproduce and metabolize, which increases the pH of the sauerkraut system, forms a corrupt film, and produces an unpleasant odor. The plant cell wall degrading enzymes produced by metabolism soften the sauerkraut tissue, causing the sauerkraut to spoil. Common spoilage microorganisms of sauerkraut include Pichia kudriavzevii, Geotrichum candidum and Bacillus, especially Pichia kudriavzevii, which can cause discoloration, film formation, softening of tissue, and production of odor, thus leading to spoilage of sauerkraut. The presence of spoilage microorganisms can cause potential food safety problems and lead to significant economic losses.
[0003] At present, the main methods for controlling sauerkraut spoilage bacteria are chemical, physical and biological methods. In the chemical method, high-salinity pickling is generally used to inhibit spoilage bacteria, but this method also has obvious disadvantages, such as limiting the growth of certain normal fermentation bacteria, thereby inhibiting the formation of unique flavor. In the physical method, heat treatment is the most commonly used method, but this method will also lead to the loss of sensory and nutritional properties of sauerkraut. Biological methods have become the main research direction in recent years due to their safety, but how to select suitable strains to control sauerkraut spoilage is a key issue. Northeastern sauerkraut, as a typical representative of sauerkraut, is widely consumed in northern my country for its unique flavor and potential health benefits, but there is also the problem of sauerkraut spoilage bacteria contamination. Screening lactic acid bacteria that have the effect of inhibiting Northeastern sauerkraut spoilage bacteria can effectively control the occurrence of Northeastern sauerkraut spoilage, improve product quality, and extend the shelf life of commodities. At present, there is no report on the inhibition of Northeastern sauerkraut spoilage bacteria by Lactobacillus breve. Summary of the invention
[0004] In view of the problems existing in the prior art, the present invention provides a strain of Lactobacillus breve to inhibit sauerkraut spoilage bacteria.
[0005] The technical solution of the present invention to solve the above technical problems is as follows:
[0006] The present invention provides a strain of Lactobacillus brevis, the strain name is Lactobacillus brevis (Levilactobacillus brevis) HSDF-1bn-2023, the preservation number is CGMCC No.30582, the strain was deposited in the General Microbiology Center of China Culture Collection Administration (CGMCC) on May 10, 2024, and the preservation address is Institute of Microbiology, Chinese Academy of Sciences, No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, China.
[0007] The Lactobacillus breve separated from naturally fermented Northeastern sauerkraut of the present invention can be used to inhibit Pichia kudriavzevii HSDF-pks-2023 (pks) which causes corruption of Northeastern sauerkraut. Through the size of the inhibition zone of the spoilage bacteria pks and the co-fermentation experiment of lactic acid bacteria and spoilage bacteria, it is found that the lactic acid bacteria HSDF-1bn-2023 has the advantage of good inhibitory effect on pks. The present invention provides a new method for inhibiting the corruption of Northeastern sauerkraut by biological methods of fermented food. The strain can be used as a biological preservative to inhibit the growth of sauerkraut spoilage bacteria through multiple mechanisms, which can effectively extend the shelf life of food and improve food safety.
[0008] HSDF-1bn-2023 had a good inhibitory effect on the spoilage bacteria pks, with the lowest pH being 3.34, the highest organic acid being 62.10 mg / mL, and the minimum number of live spoilage bacteria being 5.00×10 6 CFU / mL, the minimum amount of biofilm formed by spoilage bacteria is 0.021g, and the types and contents of biogenic amines produced are relatively small, among which tyramine (31.17mg / L), histamine (5.39mg / L), cadaverine (6.66mg / L), and putrescine (7.56mg / L). It can be shown that HSDF-1bn-2023 has a significant inhibitory effect on sauerkraut spoilage bacteria pks, and the present invention provides a new method for inhibiting the spoilage of Northeast sauerkraut by biological fermentation of food.
[0009] The present invention provides a bacterial agent, comprising the supernatant of the above-mentioned Lactobacillus breve and / or Lactobacillus levorotatory.
[0010] The microbial agent provided by the present invention can effectively inhibit sauerkraut spoilage bacteria and sauerkraut spoilage, reduce sauerkraut film formation, reduce sauerkraut pH and biogenic amine content, increase organic acid content, improve sauerkraut quality, and improve food safety.
[0011] The invention provides a fermentation method of Lactobacillus breve, comprising the following steps: inoculating Lactobacillus breve into a culture medium and performing fermentation culture.
[0012] The present invention provides a method for preparing a bacterial agent, comprising the following steps: inoculating a culture medium with Lactobacillus breve and fermenting the culture medium, and further comprising the step of centrifuging the fermented cultured bacterial solution and taking the supernatant.
[0013] The bacterial agent prepared by the method can effectively inhibit sauerkraut spoilage bacteria and sauerkraut spoilage, reduce sauerkraut film formation, reduce sauerkraut pH and biogenic amine content, increase organic acid content, improve sauerkraut quality, and improve food safety.
[0014] The present invention provides the use of the Lactobacillus breve and / or the bacterial agent in preparing sauerkraut. The Lactobacillus breve and / or the bacterial agent can improve the quality of sauerkraut.
[0015] The present invention provides application of the Lactobacillus breve and / or the bacterial agent in inhibiting sauerkraut spoilage bacteria.
[0016] For example, it can be used to prepare biological preservatives.
[0017] The present invention provides a method for using the Lactobacillus breve and the bacterial agent, comprising the following steps: adding the Lactobacillus breve and / or the bacterial agent during the process of preparing sauerkraut.
[0018] The invention provides a method for inhibiting sauerkraut spoilage bacteria, comprising the following steps: adding the Lactobacillus breve and / or the bacterial agent during the sauerkraut preparation process.
[0019] The above method can effectively inhibit sauerkraut spoilage bacteria and sauerkraut spoilage, reduce sauerkraut film formation, reduce sauerkraut pH and biogenic amine content, increase organic acid content, improve sauerkraut quality, and improve food safety.
[0020] The present invention provides a sauerkraut spoilage indicator bacteria, the strain name is Pichia kudriavzevii HSDF-pks-2023, the deposit number is CGMCC No.30584, and it was deposited in the General Microbiology Center of China Microorganism Culture Collection Administration (CGMCC) on May 10, 2024, and the deposit address is Institute of Microbiology, Chinese Academy of Sciences, No. 3, Yard No. 1, Beichen West Road, Chaoyang District, Beijing, China. It can also be referred to as pks.
[0021] The present invention provides application of the above-mentioned sauerkraut spoilage indicator bacteria in screening or verifying a strain inhibiting spoilage bacteria.
[0022] The isolated Pichia kudriavzevii pks of the present invention can increase the pH of sauerkraut during the fermentation process of sauerkraut, and can utilize lactic acid, acetic acid and citric acid to produce pectinase, which causes the sauerkraut to become white, soft, discolored, and produce an unpleasant odor. Therefore, pks can be used as an indicator bacteria for sauerkraut corruption to measure whether the sauerkraut is deteriorated, and can also be used to screen or verify Lactobacillus breve that can effectively inhibit corruption bacteria. BRIEF DESCRIPTION OF THE DRAWINGS
[0023] Figure 1 The colony morphology (left) and microscope observation (right) of strain HSDF-1bn-2023.
[0024] Figure 2 The following are the photos of the putrefactive bacteria pks colonies (left) and microscopic examination images (right).
[0025] Figure 3 These are the results of the effect of strain HSDF-1bn-2023 on the number of live pks bacteria in sauerkraut.
[0026] Figure 4 These are photos of strain HSDF-1bn-2023 inhibiting film formation of sauerkraut spoilage bacteria.
[0027] Figure 5 These are the results of the effect of strain HSDF-1bn-2023 on the amount of biofilm formed in sauerkraut.
[0028] Figure 6 The results show the effect of strain HSDF-1bn-2023 on the pH value in sauerkraut.
[0029] Figure 7 These are the results of the effect of strain HSDF-1bn-2023 on the content of organic acids in sauerkraut.
[0030] Figure 8 These are the results of the effect of strain HSDF-1bn-2023 on the content of biogenic amines in sauerkraut. DETAILED DESCRIPTION
[0031] The principles and features of the present invention are described below in conjunction with the accompanying drawings. The examples given are only used to explain the present invention and are not used to limit the scope of the present invention.
[0032] The present invention isolates a strain of Lactobacillus breve HSDF-lbn-2023 from naturally fermented Northeastern pickled cabbage, and the strain can be used to inhibit Pichia kudriavzevii, which causes the corruption of Northeastern pickled cabbage. Through the screening experiment of the size of the inhibition zone of Pichia kudriavzevii and the co-fermentation experiment of lactic acid bacteria and spoilage bacteria, it is found that HSDF-lbn-2023 has a good inhibitory effect on the spoilage bacteria Pichia kudriavzevii HSDF-pks-2023, with the lowest pH of 3.34, the highest organic acid of 62.10 mg / mL, and the minimum number of live spoilage bacteria of 5.00×10 6CFU / mL, the minimum amount of biofilm formed by spoilage bacteria is 0.021g, the types and contents of biogenic amines are small, tyramine is 31.17mg / L, histamine is 5.39mg / L, cadaverine is 6.66mg / L and putrescine is 7.56mg / L. HSDF-lbn-2023 has a significant inhibitory effect on sauerkraut spoilage bacteria, can improve the quality of sauerkraut, and provides a new method for the biological method of fermented food to inhibit the spoilage of Northeast sauerkraut.
[0033] The experimental methods used in the examples are conventional methods in the art unless otherwise specified. The materials, reagents, methods and instruments used are conventional materials, reagents, methods and instruments in the art unless otherwise specified, and can be obtained through commercial channels or prepared by conventional methods by those skilled in the art. The solutions involved in the present invention are prepared with water as the solvent unless otherwise specified.
[0034] Lactobacillus brevis HSDF-lba-2023 (derived from kimchi), Lactobacillus brevis HSDF-lbb-2023 (derived from silage), Lactobacillus brevis HSDF-lbc-2023 (derived from milk), and Lactobacillus brevis brevis HSDF-lbd-2023 (derived from liquor) were isolated from naturally fermented sauerkraut samples from farmers in Acheng District, Harbin, and stored in the Food Fermentation Laboratory of Harbin University of Commerce. The public can obtain the above strains for non-commercial purposes only to repeat the contents recorded in the embodiments of the present invention.
[0035] Pichia membranifaciens was purchased from China Industrial Microorganism Culture Collection Administration Center with the strain number CICC 33338. Pichia jadinii was purchased from China Industrial Microorganism Culture Collection Administration Center with the strain number CICC 1269. Pichia guilliermondii was purchased from China Industrial Microorganism Culture Collection Administration Center with the strain number CICC 31485. Pichia fermentans was purchased from China Industrial Microorganism Culture Collection Administration Center with the strain number CICC 32388. Pichia kudriavzevii (isolated from liquor) was purchased from China Industrial Microorganism Culture Collection Administration Center with the strain number CICC33196.
[0036] PDA (potato dextrose agar) medium: purchased from Beijing Aoboxing Biotechnology Co., Ltd. (catalog number 02-023), used for activation, cultivation and counting of spoilage fungi.
[0037] YPD liquid medium: 20g peptone, 20g glucose, 10g yeast extract, per 1000mL distilled water, sterilized at 121℃ for 15min. Used for activation and cultivation of fungi.
[0038] MRS broth: purchased from Beijing Aoboxing Biotechnology Co., Ltd. (catalog number 02-291), used for activation and cultivation of lactic acid bacteria.
[0039] MRS solid culture medium: purchased from Beijing Aoboxing Biotechnology Co., Ltd. (catalog number 02-293), used for activation, cultivation and counting of lactic acid bacteria.
[0040] Seven biogenic amine standards (putrescine, cadaverine, histamine, tyramine, phenylethylamine, spermidine and spermine) were purchased from Shanghai Yuanye Biotechnology Co., Ltd.
[0041] Physiological and biochemical identification tubes were purchased from Qingdao High-Tech Industrial Park Haibo Biotechnology Co., Ltd., product number: SHBG13.
[0042] LC-2030 high performance liquid chromatograph, Carbomix H-NP10:8% chromatographic column (7.8 mm×300 mm, 10 μm) were purchased from Suzhou Saifen Technology Co., Ltd.; Ultimate Amino Acid chromatographic column (4.6 mm×250 mm, 5 μm) was purchased from Yuexu Technology (Shanghai) Co., Ltd.
[0043] If the test index is involved, three repeated tests are performed. If data analysis is involved, Duncan analysis method is used for variance analysis (ANOVA) to determine whether there are significant differences, and SPSS22.0 software is used for difference analysis between groups. Origin 2021 software is used for drawing.
[0044] The following is an introduction through specific embodiments.
[0045] Example 1 Isolation, screening and identification of Lactobacillus breve
[0046] In December 2022, naturally fermented sauerkraut samples were collected from farmers in Acheng District, Harbin. The fermented broth of the sauerkraut sample was diluted 10 times with sterile saline and vortexed to obtain the sauerkraut brine sample. 5 mL of the sauerkraut brine sample was transferred to 45 mL of sterile water and shaken to obtain a dilution (10 -110-fold gradient dilution), pipette 0.5 mL of the diluent into a sterilized test tube containing 4.5 mL of distilled water and continue to dilute by 10 times. Repeat the previous step until the dilution reaches the appropriate gradient. Select 3 appropriate dilution gradients (10 -4 times, 10 -5 Times and 10 -6 0.1 mL of the dilution (times) was applied evenly to an MRS solid medium containing methylene phenol green (final concentration 0.1 g / L) and cultured at 37°C for 48 hours. After the colonies grow, pick the yellow or yellow-green colonies and streak them on an MRS solid medium containing methylene phenol green (final concentration 0.1 g / L). Repeat 3-5 times until pure colonies are obtained. Pick a single colony for Gram staining and microscopic examination. By observing the size, color and other characteristics of different colonies, select a single colony for microscopic examination, observe the characteristics such as bacterial morphology, and screen out Gram-positive strains. The strain obtained by the above method was named strain HSDF-1bn-2023, which was used in subsequent experiments.
[0047] Use an inoculation loop to pick up a single colony of HSDF-lbn-2023 isolated and purified on an MRS solid medium plate, inoculate it into MRS solid medium, and culture it in a 37°C constant temperature incubator for 48 hours before taking it out and observing the colony morphology. Figure 1 As shown, the colonies of HSDF-lbn-2023 are round and shiny, white in color and do not produce pigments. The bacteria are short rod-shaped with a length-to-width ratio of 4:1-2:1.
[0048] The strain HSDF-lbn-2023 was subjected to physiological and biochemical identification tests to preliminarily identify the strain. The identification method includes the following steps: using an inoculation loop to pick a purified cultured HSDF-lbn-2023 single colony from an MRS plate and inoculate it into a physiological and biochemical identification tube, sealing it with a sealing film, placing it in a 37°C constant temperature incubator for 48 hours, and then taking it out. According to the color reaction of the identification tube, it is compared with the instructions for use of the physiological and biochemical identification tube to determine the test results. The identification results are shown in Table 1. It can be seen that the strain HSDF-lbn-2023 can utilize esculin and maltose.
[0049] Table 1
[0050]
[0051] The strain HSDF-lbn-2023 was subjected to 16S rDNA identification, and the identification method included the following steps: dsDNA HS Assay Kit was used to detect bacterial DNA. The strain DNA was sent to Suzhou Jinweizhi Biotechnology Co., Ltd. for 16S rDNA amplification and sequencing. According to the sequencing results of 16SrDNA, the strain was identified as Levilactobacillus brevis.
[0052] The 16S r DNA sequence of HSDF-lbn-2023 is shown in SEQ ID NO:1.
[0053]
[0054] The strain HSDF-1bn-2023 was deposited in the General Microbiology Center (CGMCC) of the China Microbiological Culture Collection Administration, and the deposit address is the Institute of Microbiology, Chinese Academy of Sciences, No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, China. The deposit date is May 10, 2024. The strain name is Levilactobacillus brevis HSDF-1bn-2023, the deposit number is CGMCC No.30582, and the recommended classification name is Levilactobacillus brevis.
[0055] Example 2 Spoilage bacteria pks
[0056] In October 2023, naturally fermented sauerkraut liquid was collected from farmers in Daoli District, Harbin, Heilongjiang Province. After the sauerkraut liquid was placed in a sterile reagent bottle and transported back to the laboratory at low temperature, 5 mL of the fermented sauerkraut liquid was taken and thoroughly mixed in 45 mL of sterile water. 0.5 mL of the dilution was drawn into a sterilized small test tube containing 4.5 mL of distilled water and continued to dilute 10 times. After vortexing, 10 -4 , 10 -5 , 10 -6 , 10 -7 Spread 0.1 mL of the dilution gradient on PDA medium and culture at 28°C for 48 h. After the colonies grow, pick a single colony and streak it on PDA medium. Repeat 3-5 times until pure colonies are obtained.
[0057] The spoilage bacteria were screened by the following method: the strain was inoculated into YPD liquid medium, and the second-generation bacterial solution was obtained after shaking culture at 28°C and 150 r / min for 24 h. The second-generation bacterial solution was then inoculated into YPD liquid medium at a 1% (volume percentage) inoculation rate, and the culture was placed in a constant temperature shaker at 28°C and 150 r / min for 24 h to obtain the third-generation bacterial solution, ensuring that the number of viable bacteria was about 1×10 8 CFU / mL. Cut fresh cabbage into slices, weigh, add sterile saline (final concentration of sodium chloride is 2%, mass percentage), inoculate with bacterial solution, inoculate at 2% (volume percentage), place in a sealed incubator at 22°C for 7 days, observe and record. At the same time, take naturally fermented samples as controls. Screen out strains that can make the brine of sauerkraut samples turbid, form a visible fragmented white film on the surface, have a strong sour smell, and soften the sauerkraut.
[0058] The strain with the best spoilage effect was screened out by the above method and named pks. pks was inoculated in PDA medium and placed in a constant temperature incubator at 28℃ for 48h. It was observed that the colonies of the spoilage bacteria pks on the PDA medium were white and had a dragon-like shape. The colonies were larger ( Figure 2 Left image); Microscopic examination shows an irregular spindle shape, with a round shield at one end and a pointed end, with a length-to-width ratio of 1:1 to 3:1 ( Figure 2 (right image).
[0059] Using San Diego's Fast Total DNA was obtained using the Spin Kit for Soil DNA extraction kit. The strain DNA was sent to Suzhou Jinweizhi Biotechnology Co., Ltd. for 16S r DNA amplification and sequencing. The strain was identified as Pichia kudriavzevii.
[0060] The 16S r DNA sequence of pks is shown in SEQ ID NO:2.
[0061] AGGATCATTACTGTGATTTAGTACTACACTGCGTGAGCGGAACGAAAACAACAACACCTAAAATGTGGAATATAGCATATAGTCGACAAGAGAAATCTACGAAAAACAAACAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAGCGCAGCGAAATGCGATACCTAGTGTGAATTGCAGCCATCGTGAATCATCGAGTTCTTGAACGCACATTGCGCCCCTCGG CATTCCGGGGGGCATGCCTGTTTGAGCGTCGTTTCCATCTTGCGCGTGCGCAGAGTTGGGGGAGCGGAGCGGACGACGTGTAAAGAGCGTCGGAGCTGCGACTCGCCTGAAAGGGAGCGAAGCTGGCCGAGCGAACTAGACTTTTTTTCAGGGACGCTTGGCGGCCGAGAGCGAGTGTTGCGAGACAACAAAAAGCTCGACCTCAAATCAGGTAGGAATACCCGCTGAACTTAAG
[0062] On May 10, 2024, pks was deposited in the General Microbiology Center of China Microorganism Culture Collection (CGMCC), the deposit address is Institute of Microbiology, Chinese Academy of Sciences, No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, China. The strain name is Pichia kudriavzevii HSDF-pks-2023, and the deposit number is CGMCC No.30584.
[0063] The pks was subjected to physiological and biochemical identification. The experimental method included the following steps: using an inoculation loop to pick a purified cultured pks single colony from a PDA plate and inoculate it into a physiological and biochemical identification tube, sealing it with a sealing film, placing it in a 37°C constant temperature incubator for 48 hours, and then taking it out. According to the color reaction of the identification tube, it was compared with the instructions for use of the physiological and biochemical identification tube to determine the test results. The experimental results are shown in Table 2. From the perspective of the ability to utilize sugars, the spoilage bacteria pks can utilize lactose, sucrose, fructose, starch and esculin.
[0064] Table 2
[0065]
[0066]
[0067] The ability of the spoilage bacteria pks to utilize organic acids is tested. The experimental method includes the following steps:
[0068] Preparation of pks bacterial solution: The frozen strain was activated in YPD liquid medium, and the second-generation bacterial solution was obtained after shaking culture at 28°C and 150 r / min constant temperature shaker for 24 h. The second-generation bacterial solution was then inoculated into YPD liquid medium at a 1% (volume percentage) inoculum, and placed in a constant temperature shaker at 28°C and 150 r / min for 24 h to obtain the third-generation bacterial solution, ensuring that the number of viable pks bacteria was about 1×10 8 CFU / mL was used as the seed solution, and the third-generation bacterial solution was used in subsequent experiments.
[0069] The pks bacterial solution was inoculated into YPD liquid medium containing different organic acids (lactic acid, acetic acid, citric acid, malic acid, succinic acid, adipic acid and fumaric acid) at an inoculum volume of 2% (volume ratio), and the growth of pks was observed after culturing in a constant temperature incubator at 28°C for 7 days under anaerobic conditions. The experimental results are shown in Table 3, from which it can be seen that the spoilage bacteria pks can utilize lactic acid, acetic acid and citric acid.
[0070] Table 3
[0071]
[0072] The ability of pks to form spoilage membranes in sauerkraut juice within 3 days was compared with that of other Pichia pastoris. The experimental method included the following steps:
[0073] Preparation of Pichia pastoris bacterial solution: Activate the frozen Pichia pastoris strain in YPD liquid medium, and culture it on a constant temperature shaker at 28°C and 150 r / min for 24 h to obtain the second-generation bacterial solution. Then, inoculate the second-generation bacterial solution into YPD liquid medium at a 1% (volume percentage) inoculum amount, and culture it on a constant temperature shaker at 28°C and 150 r / min for 24 h to obtain the third-generation bacterial solution, ensuring that the number of viable Pichia pastoris is about 1×10 8 CFU / mL was used as the seed solution, and the third-generation bacterial solution was used in subsequent experiments.
[0074] The naturally fermented and matured Northeastern sauerkraut without spoilage bacteria contamination was subjected to juicing, centrifugation and membrane filtration; different Pichia yeast liquids were inoculated into the sauerkraut juice after membrane filtration at an inoculation rate of 2% (volume percentage), and fermented in an incubator at 22°C under anaerobic conditions. The amount of biofilm formed on the sauerkraut liquid surface was observed on the third day of fermentation. As can be seen from Table 4, the pks provided by the present invention is superior to other Pichia yeasts in terms of film-forming ability. Therefore, pks was selected for the subsequent embodiments.
[0075] Table 4
[0076]
[0077] Note: In Table 4, - means no biofilm appears on the surface of the sauerkraut liquid; + means a small amount of scattered flaky biofilm can be seen on the surface of the sauerkraut liquid; ++ means a large amount of scattered flaky biofilm can be seen on the surface of the sauerkraut liquid; +++ means a large amount of thickened biofilm can be seen on the surface of the sauerkraut liquid.
[0078] Example 3
[0079] The Oxford cup method antibacterial test was used to detect the inhibitory effect of strain HSDF-1bn-2023 on sauerkraut spoilage bacteria pks, including the following steps:
[0080] (1) Preparation of supernatant
[0081] The frozen strain HSDF-1bn-2023 was activated in MRS broth and cultured at 37°C for 24 h to obtain the second-generation bacterial solution, which was then inoculated into MRS broth at a 1% (volume percentage) inoculation rate to obtain the third-generation bacterial solution, ensuring that the number of viable cells of HSDF-1bn-2023 was approximately 1×10 8 CFU / mL was used as the seed solution, and the third-generation bacterial solution was used in subsequent experiments.
[0082] The HSDF-1bn-2023 bacterial solution was inoculated into MRS broth at an inoculum rate of 0.1% (volume percentage), cultured at 37° C. for 24 h, centrifuged at 8000 r / min for 5 min, and the supernatant was taken for later use (ie, HSDF-1bn-2023 supernatant).
[0083] (2) Preparation of Pichia kuehei yeast solution
[0084] The frozen strain was activated in YPD liquid medium, and the second-generation bacterial solution was obtained after shaking culture at 28°C and 150 r / min constant temperature shaker for 24 h. The second-generation bacterial solution was then inoculated into YPD liquid medium at a 1% inoculum amount and placed in a constant temperature shaker at 28°C and 150 r / min for 24 h to obtain the third-generation bacterial solution, ensuring that the number of viable bacteria of pks was about 1×10 8 CFU / mL was used as seed solution, and the third generation bacterial solution was used in subsequent experiments. The pks bacterial solution was inoculated into YPD liquid culture medium at an inoculation rate of 1% (volume percentage), and placed in a constant temperature shaker at 28°C for 24 hours to obtain a pks suspension.
[0085] (3) Determination of the inhibition zone of HSDF-1bn-2023 supernatant on pks: The pks suspension was diluted to 10 5 CFU / mL, and obtain pks dilution; take 3mL of pks dilution and mix it with 150mL of 50℃ PDA medium to obtain a mixture; then take 20mL of the mixture and pour it into the PDA plate, use tweezers to place the sterilized Oxford cup (inner diameter 6mm) on four symmetrical points in the plate; use a pipette to add 50μL of HSDF-1bn-2023 supernatant (i.e. HSDF-1bn-2023 cell-free supernatant without bacteria) to the Oxford cup. MRS broth (added in an amount of 50μL) was used as the control group to exclude the influence of microorganisms in the raw materials on the experimental results. Each group was placed in a 28℃ constant temperature incubator for 24h, and the diameter of the opaque circle around the hole was measured with a vernier caliper. The experiment was repeated three times, and the size of the inhibition zone was used to reflect the effect of HSDF-1bn-2023 on inhibiting pks.
[0086] The detection results of the inhibition zone showed that HSDF-1bn-2023 had a significant antibacterial effect on the spoilage bacteria pks, which was +++ (i.e., the diameter of the inhibition zone was >15mm).
[0087] Example 4
[0088] The method of co-fermenting lactic acid bacteria with spoilage bacteria to inhibit spoilage bacteria comprises the following steps:
[0089] Northeastern sauerkraut that was not contaminated by spoilage bacteria was squeezed and centrifuged to obtain the supernatant, which was then filtered through a membrane to obtain sauerkraut juice for subsequent experiments.
[0090] HSDF-lbn-2023 bacterial liquid: The frozen HSDF-lbn-2023 strain was activated in MRS broth and cultured at 37°C for 24 h to obtain the second-generation bacterial liquid. The second-generation bacterial liquid was then inoculated into MRS broth at a 1% (volume percentage) inoculum and cultured under the same conditions to obtain the third-generation bacterial liquid, ensuring that the number of viable cells of HSDF-lbn-2023 was approximately 1×10 8 CFU / mL was used as seed solution, and the third generation bacterial solution was used in subsequent experiments. HSDF-lbn-2023 bacterial solution was inoculated into MRS broth medium at a volume percentage of 1%, and cultured at 37°C for 24 hours to obtain HSDF-lbn-2023 bacterial solution.
[0091] A control group and an experimental group were set up. The control group: the pks suspension (prepared by the method of Example 2) was inoculated into sauerkraut juice at an inoculation amount of 2% (volume percentage); the experimental group (lbn-pks): the HSDF-lbn-2023 bacterial liquid and the pks suspension (prepared by the method of Example 2) were inoculated into sauerkraut juice together, the inoculation amount of the HSDF-lbn-2023 bacterial liquid was 2% (volume percentage), and the inoculation amount of the pks suspension was 2% (volume percentage).
[0092] The fermentation was carried out in a sealed container at 12°C for 7 days. After the fermentation, the pH, pks viable bacterial count, biofilm formation, organic acid content and biogenic amine content in the sauerkraut fermentation liquid were measured.
[0093] (1) Determination of the number of live spoilage bacteria: The number of colonies of pks grown on PDA medium was counted using the plate counting method according to the following literature method. Literature: Zhang, Feng, et al. Microbial composition of spoiled industrial-scale Sichuan paocai and characteristics of the microorganisms responsible for paocai spoilage. International journal of food microbiology, 2018, 275: 32-38.
[0094] The change of viable bacterial count of HSDF-1bn-2023 on pks is as follows Figure 3 As shown. Figure 3 It can be seen that the number of live bacteria in the experimental group was significantly reduced compared with the control group, which is consistent with the test results of the Oxford cup inhibition zone method, indicating that HSDF-1bn-2023 has a significant inhibitory effect on the number of live bacteria in pks. The number of live bacteria of spoilage bacteria in lbn-pks is 5.00×10 6CFU / mL, it is speculated that this may be due to the fact that strain HSDF-1bn-2023 produces metabolites with antibacterial activity such as cyclopeptides, bacteriocins and organic acids that inhibit the growth of spoilage bacteria. Therefore, strain HSDF-1bn-2023 can be used to extend the shelf life of food.
[0095] (2) Determination of the amount of biofilm formed by spoilage bacteria: The method of the following literature was used to observe whether there was biofilm formation on the surface of the sauerkraut fermentation liquid, and the biofilm dry weight method was used to determine it. Literature: Yang Lu, Qin Shuman, Li Zhihong, et al. Inhibitory effect of eugenol on biofilm at the air-liquid interface of Bacillus amyloliquefaciens [J]. Journal of Food Science and Technology, 2023, 41(01): 88-98.
[0096] The formation of film is the most typical feature of spoilage of Northeastern pickled cabbage products. Film formation significantly reduces the sensory quality of Northeastern pickled cabbage by softening its texture and producing odor. pks forms biofilm in the Northeastern pickled cabbage environment, with high film formation, which is very harmful to the production of Northeastern pickled cabbage. Figure 4 As shown, the changes in the amount of biofilm formed by HSDF-1bn-2023 on pks are as follows Figure 5 As shown. Figure 5 It can be seen that the amount of biofilm formation in the experimental group was reduced compared with the control group pks, indicating that HSDF-1bn-2023 has an inhibitory effect on the amount of biofilm formation in pks, and the amount of biofilm formation in lbn-pks is 0.021g. HSDF-1bn-2023 can reduce the formation of biofilm by inhibiting the growth of spoilage bacteria.
[0097] (3) Determination of pH: The pH of the fermented cabbage liquid was directly measured using a FiveEasy Plus pH meter. The change in pH is one of the important indicators for measuring the fermentation of sauerkraut and can affect the progress of sauerkraut fermentation. Figure 6 As shown. Figure 6 It can be seen that the pH of the experimental group decreased compared with the control group pks, and the lowest pH of lbn-pks was 3.34.
[0098] (4) Determination of organic acids: The content of organic acids in the fermented broth was determined by high performance liquid chromatography (HPLC). The determination was carried out using the method of the following literature: Luo, Y., Liu, Y., Ren, T., Wang, B., Peng, Y., Zeng, S., & Su, Y. Sichuan paocai fermented by mixed-starter culture of lactic acid bacteria. Food Science & Nutrition, 2020, 8(10): 5402-5409.
[0099] Acid production is considered to be the most important mechanism by which lactic acid bacteria inhibit spoilage bacteria. The inhibitory effect of lactic acid bacteria on spoilage bacteria is mainly due to the production of organic acids. The inhibitory effect of organic acids is caused by undissociated molecules, which dominate in low pH environments. Figure 7 As shown. Figure 7 It can be seen that compared with the control group pks, the organic acid content of the experimental group increased, and the organic acid content of lbn-pks was the highest at 62.10 mg / mL, indicating that HSDF-1bn-2023 inhibited the growth of pks under acid stress.
[0100] (5) Determination of biogenic amines: The content of biogenic amines in sauerkraut fermentation broth was determined by high performance liquid chromatography (HPLC). The determination was carried out using the method of the following literature: **YH, Lee J, Pawluk AM, et al. Inhibitory effects of nicotinic acid, glycine, and other food additives on biogenic amineformation in Baechu kimchi fermentation[J]. Lwt, 2022, 155: 112921.
[0101] Spoilage bacteria can decarboxylate amino acids into biogenic amines (BAs), such as histamine, cadaverine, putrescine, or tyramine. Ingestion of foods high in BAs can have health effects, such as migraines, increased blood pressure, and increased heart rate. Figure 8 As shown. Figure 8It can be seen that compared with the control group pks, the content of biogenic amines in the experimental group lbn-pks was significantly reduced, with tyramine of 31.17 mg / L, histamine of 5.39 mg / L, cadaverine of 6.66 mg / L and putrescine of 7.56 mg / L in the experimental group. The strain HSDF-1bn-2023 provided by the present invention can improve food safety.
[0102] Example 5
[0103] The strain HSDF-1bn-2023 of the present invention was compared with other Lactobacillus breve in inhibiting the spoilage bacteria pks. The experimental method was as described in Example 3. The experimental results are shown in Table 5, from which it can be seen that the strain HSDF-1bn-2023 provided by the present invention has a significantly higher antibacterial effect on pks than other strains.
[0104] Table 5
[0105]
[0106] Note: In Table 5, the unit of inhibition zone is mm, the diameter of inhibition zone is 6-10mm: +; 10-15mm: ++; >15mm: +++; no inhibition zone: -.
[0107] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principle of the present invention should be included in the protection scope of the present invention.
Claims
1. A strain of Lactobacillus breve, characterized in that: The strain name is Levilactobacillus brevis HSDF-1bn-2023, and the preservation number is CGMCC No.30582.
2. A bacterial agent, characterized in that The method comprises the supernatant of Lactobacillus breve and / or Lactobacillus levorotatory as described in claim 1.
3. The fermentation method of Lactobacillus breve according to claim 1, characterized in that: The following steps are involved: The Lactobacillus breve described in claim 1 is inoculated into a culture medium for fermentation culture.
4. Use of the Lactobacillus breve according to claim 1 in preparing sauerkraut.
5. Use of the Lactobacillus breve described in claim 1 in inhibiting sauerkraut spoilage bacteria.
6. Use of the bacterial agent according to claim 2 in preparing sauerkraut.
7. Use of the bacterial agent according to claim 2 in inhibiting sauerkraut spoilage bacteria.
8. A method for inhibiting sauerkraut spoilage bacteria, characterized in that: The following steps are involved: In the process of preparing sauerkraut, the Lactobacillus breve described in claim 1 and / or the bacterial agent described in claim 2 are added.
9. A sauerkraut spoilage indicator bacterium, characterized in that: The strain name is Pichia kudriavzevii HSDF-pks-2023, and the preservation number is CGMCC No.30584.
10. Use of the sauerkraut spoilage indicator bacteria according to claim 9 in screening or verifying strains that inhibit spoilage bacteria.