Escherichia coli for producing glutamic acid amino acids as well as construction method and application of escherichia coli

Abstract

The invention belongs to the technical field of microbial engineering and genetic engineering, and discloses escherichia coli for producing glutamic acid amino acids and a construction method and application thereof. The escherichia coli contains a growth dependent promoter PprpB of a methyl isocitrate lyase gene prpB and / or a stable phase dependent promoter PydgI of an ornithine reverse transport protein / lysine permease gene ydgI. According to the Escherichia coli for producing glutamic acid family amino acids, the expression of alpha-ketoglutarate dehydrogenase subunits is regulated by using a growth dependent promoter, and the expression of glutamate synthetase is regulated by using a stable phase dependent promoter, so that the cell growth and energy supply of thalli in a logarithmic phase can be realized; the stable phase glutamic acid group amino acid biosynthesis is required, so that the equilibrium distribution of metabolic flux between the growth of microbial cell factories and the synthesis of target products is effectively balanced.

Description

Technical Field

[0001] The present invention relates to the technical field of microbial engineering and genetic engineering, and in particular to an Escherichia coli for producing glutamate amino acids and a construction method and application thereof. Background Art

[0002] Glutamic acid amino acids are widely used in medicine, industry, food, cosmetics, animal husbandry and other fields, and have important economic and social value.

[0003] At present, there are three main methods for producing glutamic acid amino acids: microbial fermentation, chemical synthesis, and enzyme catalysis. Among them, microbial fermentation has the advantages of a wide range of raw materials, relatively simple production process, relatively small impact on the environment, and high product purity. It has now become the mainstream method for the production of glutamic acid amino acids.

[0004] Improving the production performance of glutamate amino acids in chassis microorganisms is a continuous goal of rational metabolic engineering breeding. In the process of systematic reconstruction of the chassis microbial metabolic network, the enhancement or weakening of the expression intensity of the target gene is a common strategy to improve the production performance of L-amino acids. For example, increasing the expression of key enzymes in the target product synthesis pathway, increasing the expression of target product efflux membrane proteins, and increasing the expression of key enzymes in the target product precursor synthesis pathway have significant beneficial effects on improving the production of L-amino acids in chassis microorganisms; in addition, dynamic regulation of key metabolic targets in the target L-amino acid synthesis pathway can further balance cell growth and bacterial production, and promote the efficient synthesis of L-amino acids in microbial cell factories.

[0005] In order to obtain the optimal synthesis rate of the target product, a large number of trial and error experiments are often required to obtain the appropriate target gene expression dosage. On the basis of controlling the appropriate gene dosage, regulating the expression intensity of the target gene in the genome is an effective strategy to further optimize the metabolic flux intensity of the synthetic pathway. Gene expression regulation is a complex process involving the coordinated cooperation of multiple expression regulatory elements, and promoter engineering can accurately control the transcription of target genes to meet the challenges of coordinated expression regulation of multiple genes in the target product synthesis metabolic network. Therefore, it is promising to use promoter engineering to modify the genes of microorganisms. Summary of the invention

[0006] The purpose of the present invention is to solve the problems in the prior art of obtaining the optimal target product synthesis rate by regulating gene expression, such as complex process, high trial and error cost and great operation difficulty, thereby providing an Escherichia coli producing glutamate amino acids and a construction method and application thereof. The Escherichia coli producing glutamate amino acids uses a growth-dependent promoter to regulate the expression of α-ketoglutarate dehydrogenase subunits and uses a stationary phase-dependent promoter to regulate the expression of glutamate synthetase, which can achieve cell growth and energy supply in the logarithmic growth phase of the bacteria, which is required for the biosynthesis of glutamate amino acids in the stationary phase, thereby effectively balancing the metabolic flux distribution between cell growth in the microbial cell factory and synthesis of the target product.

[0007] In order to achieve the above object, in the first aspect, the present invention provides an Escherichia coli for producing glutamate amino acids, characterized in that the growth-dependent promoter P containing the methyl isocitrate lyase gene prpB of the Escherichia coli prpB and / or the stationary phase dependent promoter P of the ornithine antiporter / lysine permease gene ydgI ydgI ;in,

[0008] The growth-dependent promoter P of the methyl isocitrate lyase gene prpB prpB The base sequence is shown in SEQ.ID.NO:1;

[0009] The stationary phase dependent promoter P of the ornithine antiporter / lysine permease gene ydgI ydgI The base sequence is shown in SEQ.ID.NO:2.

[0010] In a second aspect, the present invention provides a use of the Escherichia coli as described in the first aspect in producing glutamate amino acids.

[0011] In a third aspect, the present invention provides a method for producing glutamic acid amino acids, characterized in that the method comprises: culturing the strain on a slant, culturing the seed, inoculating the strain on a glucose fermentation medium, oscillating the culture, and adding glucose containing betaine after the base sugar is exhausted; wherein,

[0012] The bacterial species is the Escherichia coli described in the first aspect.

[0013] In the above technical solution, the inventors found two kinds of dynamic regulation promoters triggered by betaine during the research process: based on the growth-dependent promoter P prpB (Growth phase-dependent promoter, GPP), stable phase-dependent promoter P ydgIThe present invention adopts two control methods to dynamically control the promoter of α-ketoglutarate dehydrogenase subunit (encoded by sucA gene, NCBI-GeneID: 945303, EC: 1.2.4.2) and glutamate dehydrogenase (encoded by gdhA gene, NCBI-GeneID: 946802, EC: 1.4.1.4) in the α-ketoglutarate node of tricarboxylic acid cycle (TCA) to refine the redirected carbon flux distribution.

[0014] Further, the specific operation is to replace the native promoter of the sucA gene in Escherichia coli with the growth-dependent promoter P prpB To achieve normal transcriptional expression of sucA gene and low transcriptional expression of gdhA gene in the logarithmic growth phase of cells, to ensure sufficient metabolic flux in the TCA cycle pathway for the synthesis of energy ATP and various primary metabolites and to maintain normal cell growth; the native promoter of gdhA gene was replaced with the stationary phase-dependent promoter P ydgI , in order to achieve when the microbial cells are in the stable growth stage, P ydgI Regulates gdhA gene expression to automatically switch to high transcription expression and P prpB The sucA gene is automatically regulated to a low expression mode to redirect more metabolic flux to the synthesis of glutamate amino acids. By adding betaine fermentation, sufficient metabolic flux in the tricarboxylic acid cycle pathway during the logarithmic growth period is achieved to meet the energy required for strain growth and the synthesis of various primary metabolites. When the strain reaches the stable period, more metabolic flux is directed to the synthesis of L-glutamate amino acids, thereby improving the synthesis efficiency of the target amino acid.

[0015] The Escherichia coli for producing glutamate amino acids provided by the present invention can dynamically regulate the carbon flux orientation of the α-ketoglutarate metabolic node according to the requirements of different stages of fermentation, thereby improving the synthesis efficiency of glutamate amino acids.

[0016] Other features and advantages of the present invention will be described in detail in the following detailed description. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] The accompanying drawings are used to provide a further understanding of the present invention and constitute a part of the specification. Together with the following specific embodiments, they are used to explain the present invention but do not constitute a limitation of the present invention. In the accompanying drawings:

[0018] Figure 1 A schematic diagram of the distribution of metabolic flux of the α-ketoglutarate metabolic node of the Escherichia coli for producing glutamate amino acids of the present invention;

[0019] Figure 2 is the pGRB plasmid map;

[0020] Figure 3 This is the pREDCas9 plasmid map. DETAILED DESCRIPTION

[0021] The specific embodiments of the present invention are described in detail below. It should be understood that the specific embodiments described herein are only used to illustrate and explain the present invention, and are not used to limit the present invention.

[0022] The endpoints and any values ​​of the ranges disclosed in this article are not limited to the precise ranges or values, and these ranges or values ​​should be understood to include values ​​close to these ranges or values. For numerical ranges, the endpoint values ​​of each range, the endpoint values ​​of each range and the individual point values, and the individual point values ​​can be combined with each other to obtain one or more new numerical ranges, which should be considered as specifically disclosed in this article.

[0023] In the present invention, the glutamate family amino acid may be L-theanine, L-arginine, L-ornithine or L-citrulline.

[0024] In a first aspect, the present invention provides an Escherichia coli for producing glutamate amino acids, characterized in that the Escherichia coli contains a growth-dependent promoter P containing a methyl isocitrate lyase gene prpB. prpB and / or the stationary phase dependent promoter P of the ornithine antiporter / lysine permease gene ydgI ydgI ;in,

[0025] The growth-dependent promoter P of the methyl isocitrate lyase gene prpB prpB The base sequence is shown in SEQ.ID.NO:1;

[0026] The stationary phase dependent promoter P of the ornithine antiporter / lysine permease gene ydgI ydgI The base sequence is shown in SEQ.ID.NO:2.

[0027] SEQ.ID.NO:1

[0028] TGAAATTAAACATTTAATTTTATTAAGGCAATTGTGGCACAACCCCTT GCTTTGTCTTTATCAACGCAAATAACAAGTTGATAGGAAACAGACC

[0029] SEQ.ID.NO:2

[0030] CTCCTATCAGGTTGCGAAACGTGCCGCGAAGAAAGGTGCTAAGTATTACCACATCACCCGCCAGTGGCAGGAACGTGGTAATAACCTGACCGTCAGCGCAGATCTGTATAAATAACTATTCAGTTACTCCTATAAGGCGGCTTGATGCCG CCTTTCGCATTTTTAGTCACAAATTTCCCCGCGACCATTGCATGCAGACACATCTCTTCGTAAAATCCCGCGCTTCAGTGGCAAACTCCATTTTTATGCGTTTTGCCCTAATATTTATTCTTCTTATCACGTTTTAATCACTGGATATCG

[0031] In a preferred embodiment of the present invention, the original promoter P of the α-ketoglutarate dehydrogenase subunit gene sucA of Escherichia coli sucA Replaced with the growth-dependent promoter P of the methylisocitrate lyase gene prpB prpB ;in,

[0032] The growth-dependent promoter P of the methyl isocitrate lyase gene prpB prpB The base sequence is shown in SEQ.ID.NO:1.

[0033] In a preferred embodiment of the present invention, the original promoter P of the glutamate synthetase gene gdhA of Escherichia coli gdhA Replaced with the stationary phase-dependent promoter P of the ornithine antiporter / lysine permease gene ydgI ydgI ;in,

[0034] The stationary phase dependent promoter P of the ornithine antiporter / lysine permease gene ydgI ydgI The base sequence is shown in SEQ.ID.NO:2.

[0035] In a preferred embodiment of the present invention, the original promoter P of the α-ketoglutarate dehydrogenase subunit gene sucA of Escherichia coli sucA Replaced with the growth-dependent promoter P of the methylisocitrate lyase gene prpB prpB At the same time, the original promoter of glutamate synthetase gene gdhA was gdhA Replaced with the stationary phase-dependent promoter P of the ornithine antiporter / lysine permease gene ydgI ydgI ;in,

[0036] The growth-dependent promoter P of the methyl isocitrate lyase gene prpB prpB The base sequence is shown in SEQ.ID.NO:1;

[0037] The stationary phase dependent promoter P of the ornithine antiporter / lysine permease gene ydgI ydgI The base sequence is shown in SEQ.ID.NO:2.

[0038] In a second aspect, the present invention provides a use of the Escherichia coli as described in the first aspect in producing glutamate amino acids.

[0039] In a third aspect, the present invention provides a method for producing glutamic acid amino acids, characterized in that the method comprises: culturing the strain on a slant, culturing the seed, inoculating the strain on a glucose fermentation medium, oscillating the culture, and adding glucose containing betaine after the base sugar is exhausted; wherein,

[0040] The bacterial species is the Escherichia coli described in the first aspect.

[0041] In a preferred embodiment of the present invention, the slant culture step comprises: taking a strain preserved at -80°C, streaking and inoculating it onto an activated slant, culturing it at 37°C for 12 hours, and subculturing it once to obtain slant seeds.

[0042] In a preferred embodiment of the present invention, the seed culture step comprises: scraping a ring of the slant seeds with an inoculating loop and inoculating it into a 500mL conical flask containing 30mL of seed culture medium, sealing it with nine layers of gauze, and culturing it at 37°C and 200rpm for 7-10h to obtain a seed culture solution.

[0043] In a preferred embodiment of the present invention, the shaking culture conditions include: inoculating into a 500mL conical flask containing fermentation medium at an inoculation rate of 10% of the volume of the seed culture solution, sealing with nine layers of gauze, 37°C, 200r / min, pH 7.0-7.2, fermentation cycle of 26-30h, and dissolved oxygen of 30%-40%.

[0044] In a preferred embodiment of the present invention, the final volume of the fermentation medium after inoculation is 30 mL.

[0045] In a preferred embodiment of the present invention, the mass concentration of betaine in the betaine-containing glucose is 1 g / L, and the mass fraction of the glucose is 60%.

[0046] In a preferred embodiment of the present invention, the mass concentration of glucose in the shaking culture is <5 g / L.

[0047] The present invention will be described in detail below through examples.

[0048] (1) Methods and equipment used in the examples

[0049] The experimental methods and equipment described in the following examples are conventional methods and equipment unless otherwise specified.

[0050] (2) Culture medium, bacteria and enzymes used in the examples

[0051] Slant culture medium: glucose 1-5g / L, peptone 5-10g / L, beef extract 5-10g / L, yeast powder 1-5g / L, NaCl 1-2.5g / L, agar 15-20g / L, the rest is water, pH 7.0-7.2.

[0052] Seed culture medium: glucose 20-40g / L, yeast extract 2-5g / L, peptone 2-4g / L, K2HPO4 1-3g / L, MgSO4·7H2O 1-2g / L, FeSO4·7H2O 15-20mg / L, MnSO4·3H2O15-20mg / L, V B1 、V B3 、V B5 、V B12 、V H 1-3 mg / L each, the rest is water, pH 7.0-7.2.

[0053] Fermentation medium: glucose 20-40g / L, yeast extract 1-3g / L, peptone 2-3g / L, K2HPO4 3-6g / L, MgSO4·7H2O 1-2g / L, FeSO4·7H2O 15-20mg / L, MnSO4·3H2O15-20mg / L, V B1 、V B3 、V B5 、V B12 、V H 1-3 mg / L each, the rest is water, pH 7.0-7.2.

[0054] The recombinant enzymes used were IIOne Step Cloning Kit series of enzymes.

[0055] HS enzyme was purchased from PrimeSTAR Biotechnology.

[0056] (3) Sequence

[0057] The primer sequences used are shown in Table 1:

[0058]

[0059]

[0060] (4) Reaction system and reaction conditions

[0061] Annealing system and reaction conditions are shown in Table 2:

[0062] Table 2

[0063]

[0064] The recombinant system and reaction conditions are shown in Table 3:

[0065] Table 3

[0066]

[0067]

[0068] ·The PCR amplification system is shown in Table 4:

[0069] Table 4

[0070] Reaction system Volume (50 μL) DNA template 1μL Upstream primer (10 μmol / L) 2μL Downstream primer (10 μmol / L) 2μL dNTP mixture (10mmol / L) 4μL 5×Buffer 10μL HS enzyme (5U / μL) 0.5μL <![CDATA[ddH2O]]> 30.5μL

[0071] The overlapping PCR amplification system is shown in Table 5:

[0072] Table 5

[0073]

[0074]

[0075] Note: The template consists of equimolar amounts of the amplified fragments of the upstream and downstream homology arms and the target gene, and the total amount does not exceed 10 ng.

[0076] The reaction conditions of the PCR amplification system and the overlapping PCR amplification system are shown in Table 6:

[0077] Table 6

[0078]

[0079] Note: Tm value is the melting temperature of DNA, and in the present invention, it refers to the melting temperature value of the primer and product.

[0080] (5) Methods of gene editing

[0081] The gene editing method used in the present invention is carried out with reference to the literature (Li Y, Lin Z, Huang C, et al. Metabolic engineering of Escherichia coli using CRISPR-Cas9 meditated genome editing. Metabolic engineering, 2015, 31: 13-21.), and the two plasmid maps used in this method are shown in Figure 2-3 Among them, pREDCas9 carries the elimination system of the gRNA expression plasmid pGRB, the Red recombination system of λ phage and the Cas9 protein expression system, spectinomycin resistance (working concentration: 100 mg / L), and is cultured at 32°C; pGRB uses pUC18 as the backbone, including the promoter J23100, the gRNA-Cas9 binding region sequence and the terminator sequence, ampicillin resistance (working concentration: 100 mg / L), and is cultured at 37°C.

[0082] Example 1

[0083] This example is used to illustrate the construction of the Escherichia coli producing glutamate amino acids of the present invention, specifically the construction of genetically engineered bacteria HCBTHE4, HCBARG1, HCBORN5, and HCBCIT4:

[0084] Using the Escherichia coli genome as a template, upstream homology arm primers (sucA-UP-S, prpB-sucA-DN-S) and downstream homology arm primers (prpB-sucA-DN-S, DN-sucA-A) were designed according to the upstream and downstream sequences of its sucA gene (NCBI GeneID: 945303), wherein the upstream and downstream homology arms contained the prpB promoter sequence, and PCR amplified the upstream and downstream homology arm fragments. The above fragments were fused by overlapping PCR to obtain P sucA ::P prpB Promoter replacement fragment (upstream homology arm-downstream homology arm). Construction of pGRB-sucA: The DNA fragment containing the target sequence was prepared by annealing primers gRNA-sucA-S and gRNA-sucA-A. Upstream homology arm primers (gdhA-UP-S, ydgI-gdhA-DN-S) and downstream homology arm primers (ydgI-gdhA-DN-S, DN-gdhA-A) were designed according to the upstream and downstream sequences of its gdhA gene (NCBI GeneID: 946802), wherein the ydgI promoter sequence was contained between the upstream and downstream homology arms, and the upstream and downstream homology arm fragments were PCR amplified. The above fragments were fused by overlapping PCR to obtain P gdhA ::P ydgIPromoter replacement fragment (upstream homology arm-downstream homology arm). Construction of pGRB-gdhA: The DNA fragment containing the target sequence was prepared by annealing primers gRNA-gdhA-S and gRNA-gdhA-A.

[0085] Prepare competent cells of the engineering strains HCBTHE3, HCBARG0, HCBORN4, and HCBCIT3, respectively, and operate according to the methods shown in steps (3) and (4) below to iteratively construct P sucA ::P prpB and P gdhA ::P ydgI Engineered strains with regulated gene expression: HCBTHE4, HCBARG1, HCBORN5, HCBCIT4.

[0086] (1) Construction of pGRB plasmid: The purpose of constructing the plasmid pGRB is to transcribe the corresponding gRNA, thereby forming a complex with the Cas9 protein, and recognize the target gene target site through base pairing and PAM to achieve the target DNA double-strand break. The pGRB plasmid is constructed by recombination of a DNA fragment containing the target sequence with a linearized vector fragment. The specific steps are described in steps a to f below.

[0087] a. Target sequence design: Use CRISPR RGEN Tools to design the target sequence (PAM: 5'-NGG-3');

[0088] b. Preparation of DNA fragments containing target sequences: Design primers: 5'-linearized vector terminal sequence (15 bp)-restriction site-target sequence (excluding PAM sequence)-linearized vector terminal sequence (15 bp)-3' and its reverse complementary primer, and prepare DNA fragments containing target sequences by annealing single-stranded DNA;

[0089] c. Preparation of linear vector: The linearization of the vector is carried out by inverse PCR amplification;

[0090] d. Recombination reaction;

[0091] e. Transformation of plasmid: Take 10μL of reaction solution, add it to 100mL DH5α competent cells, mix gently, place on ice for 20min, heat shock at 42℃ for 45-90s, place on ice for 2-3min, add 900μL SOC, and resuscitate at 37℃ for 1h. Centrifuge at 8000rpm for 2min, discard part of the supernatant, keep about 200μL to resuspend the bacteria, and then spread it on a plate containing 100mg / L ampicillin, turn the plate upside down, and culture at 37℃ overnight. After a single colony grows on the plate, identify it through colony PCR and select positive recombinants;

[0092] f. Clone identification: Inoculate PCR-positive colonies into LB medium containing 100 mg / L ampicillin and culture overnight to incubate the bacteria. Extract the plasmid and identify it by enzyme digestion.

[0093] (2) Preparation of recombinant DNA fragments: The recombinant fragments used for promoter replacement consist of the upstream and downstream homology arms of the sucA and gdhA genes (upstream homology arm-downstream homology arm). Using the primer design software primer5, the upstream and downstream sequences of the sucA and gdhA genes were used as templates to design upstream and downstream homology arm primers (amplification length of about 400-500bp). After amplifying the upstream and downstream homology arms and the target gene fragments by PCR, the recombinant fragments were prepared by overlapping PCR. The PCR system and method are as follows:

[0094] (3) Transformation of plasmids and recombinant DNA fragments

[0095] a. Transformation of pREDCas9: Use electroporation to electroporate the pREDCas9 plasmid into the electroporation competent state of the starting strain, and then spread the cells on LB plates containing spectinomycin after resuscitation and culture, and culture at 32°C overnight. Single colonies growing on the resistant plates are subjected to colony PCR using identification primers to screen for positive recombinants;

[0096] b. Preparation of electroporation competent cells of target strain containing pREDCas9: Culture at 32°C until OD 600 =0.1-0.2, add 0.1M IPTG (to make the final concentration 0.1mM), and continue to culture until OD 600 =0.6-0.7 for competent cell preparation. The purpose of adding IPTG is to induce the expression of the recombinase on the pREDCas9 plasmid. The culture medium and preparation process required for competent cell preparation refer to conventional standard operations;

[0097] c. Transformation of pGRB and recombinant DNA fragments: pGRB and donor DNA fragments were electroporated into electroporation competent cells containing pREDCas9 at the same time. The revived bacteria after electroporation were spread on LB plates containing ampicillin and spectinomycin and cultured at 32°C overnight. Colony PCR verification was performed using specially designed identification primers to screen positive recombinants and preserve the bacteria;

[0098] (4) Elimination of plasmids

[0099] a. Elimination of pGRB: Place the positive recombinant in LB medium containing 0.2% arabinose and culture overnight, dilute appropriately and spread on LB plates containing spectinomycin resistance, and culture overnight at 32°C. Spot LB plates containing ampicillin and spectinomycin resistance, and select single colonies that do not grow on ampicillin plates but grow on spectinomycin resistance plates.

[0100] b. Elimination of pREDCas9 plasmid: transfer the positive recombinant to LB liquid medium without resistance, culture at 42℃ overnight, dilute appropriately and spread on LB plate without resistance, culture at 37℃ overnight. Spot LB plates containing spectinomycin resistance and LB plates without resistance, select single colonies that do not grow on spectinomycin resistance plates and grow on plates without resistance.

[0101] Example 2

[0102] This embodiment is used to illustrate the use of P sucA ::P prpB and P gdhA ::P ydgI Method for producing L-amino acids by fermentation of Escherichia coli with regulated gene expression

[0103] (1) Slant culture: Take the -80°C stored strain and inoculate it on the activated slant, culture it at 37°C for 12 h, and subculture it once;

[0104] (2) Shake flask seed culture: Use an inoculation loop to scrape a ring of slant seeds and inoculate it into a 500 mL Erlenmeyer flask containing 30 mL of seed culture medium, seal it with nine layers of gauze, and culture it at 37°C and 200 rpm for 7-10 h.

[0105] (3) Shake flask fermentation: inoculate 10% of the volume of the seed culture solution into a 500 mL Erlenmeyer flask (final volume 30 mL) filled with fermentation medium, seal with nine layers of gauze, and culture at 37°C, 200 r / min with shaking. During the fermentation process, the pH is maintained at 7.0-7.2 by adding ammonia water; 60% (m / v) glucose solution is added to maintain the fermentation process; the fermentation cycle is 26-30 h; during the fermentation process, the pH is adjusted to 6.8-7.2 with ammonia water, and the DO is controlled at 30%-40%. When the bottom sugar is exhausted, 60% glucose containing 1 g / L of betaine is added, and the glucose concentration is controlled below 5 g / L during the entire fermentation process.

[0106] Example 3

[0107] Promoter modification sucA ::P prpB and P gdhA ::P ydgI The difference in L-theanine production performance between the engineered strain HCBTHE4 and the starting strain HCBTHE3.

[0108] HCBTHE4 and the starting strain HCBTHE3 were cultured in shake flasks using the culture method in Example 2. The concentration of L-theanine in the fermentation supernatant was measured, and the results are shown in Table 7.

[0109] Table 7

[0110] strain <![CDATA[OD 600 ]]> L-Theanine(g / L) HCBTHE3 18.60±1.52 2.96±0.06 HCBTHE4 17.93±1.17 3.38±0.27

[0111] From the data in Table 7, we can see that the promoter modification P sucA ::P prpB and P gdhA ::P ydgI It did not significantly affect the growth of the engineered strain; at the same time, it increased the L-theanine concentration in HCBTHE4 from 2.96g / L to 3.38g / L, and the L-theanine yield increased by 14.2%. The results showed that dynamic regulation of the betaine response of the sucA and gdhA promoters in Escherichia coli can significantly improve the L-theanine production performance of the engineered strain.

[0112] Example 4

[0113] Promoter modification sucA ::P prpB and P gdhA ::P ydgI The L-arginine production performance of the engineered strain HCBARG1 was different from that of the original strain HCBARG0.

[0114] The engineered strain HCBARG1 and the starting strain HCBARG0 were cultured in shake flasks using the culture method in Example 2. The concentration of L-arginine in the fermentation supernatant was measured, and the results are shown in Table 8.

[0115] Table 8

[0116] strain <![CDATA[OD 600 ]]> L-Arginine(g / L) HCBARG0 38.48±1.28 6.58±0.96 HCBARG1 36.88±2.44 7.24±0.11

[0117] From the data in Table 8, we can see that the promoter modification P sucA ::P prpB and P gdhA ::P ydgI It did not significantly affect the growth of the engineered strain; at the same time, it increased the L-arginine concentration in HCBARG1 from 6.58g / L to 7.24g / L, and the L-arginine yield increased by 10.1%. The results showed that dynamic regulation of the sucA and gdhA promoters in Escherichia coli in response to betaine can significantly improve the L-arginine production performance of the engineered strain.

[0118] Example 5

[0119] Promoter modification sucA ::P prpB and P gdhA ::P ydgI The difference in L-ornithine production performance between the engineered strain HCBORN5 and the starting strain HCBORN4.

[0120] The process strain HCBORN5 and the starting strain HCBORN4 were cultured in shake flasks using the culture method in Example 2. The concentration of L-ornithine in the fermentation supernatant was measured, and the results are shown in Table 9.

[0121] Table 9

[0122] strain <![CDATA[OD 600 ]]> L-Ornithine(g / L) HCBORN4 24.95±1.04 4.72±1.26 HCBORN5 25.25±1.25 5.47±0.85

[0123] From the data in Table 9, we can see that the promoter modification P sucA ::P prpB and P gdhA ::P ydgI It did not significantly affect the growth of the engineered strain; at the same time, it increased the L-ornithine concentration in HCBORN5 from 4.72 g / L to 5.47 g / L, and the L-ornithine yield increased by 15.8%. The results showed that dynamic regulation of the sucA and gdhA promoters in Escherichia coli in response to betaine can improve the L-ornithine production performance of the engineered strain.

[0124] Example 6

[0125] Promoter modification sucA ::P prpB and P gdhA ::P ydgI The L-citrulline production performance of the engineered strain HCBCIT4 was different from that of the original strain HCBCIT3.

[0126] The engineered strain HCBCIT4 and the starting strain HCBCIT3 were cultured in shake flasks using the culture method in Example 2. The concentration of L-citrulline in the fermentation supernatant was measured, and the results are shown in Table 9.

[0127] Table 10

[0128] strain <![CDATA[OD 600 ]]> L-Citrulline(g / L) HCBCIT3 42.70±1.91 9.54±0.23 HCBCIT4 43.52±1.20 10.44±0.48

[0129] From the data in Table 9, we can see that the promoter modification P sucA ::P prpB and P gdhA ::P ydgI It did not significantly affect the growth of the engineered strain; at the same time, it increased the L-citrulline concentration in the engineered strain HCBCIT4 from 9.54 g / L to 10.44 g / L, and the L-citrulline yield increased by 9.5%. The results showed that dynamic regulation of the betaine response of the sucA and gdhA promoters in Escherichia coli can significantly improve the L-citrulline production performance of the engineered strain.

[0130] From the above, it can be seen that, using a strain HCBTHE3 with the ability to synthesize L-theanine as the starting strain, the expression of sucA and gdhA genes was regulated by two different types of promoters to increase the L-theanine accumulation concentration in the strain from 2.96 g / L to 3.38 g / L, and the L-theanine production was increased by 14.2%; using a strain HCBARG0 with the ability to synthesize L-arginine as the starting strain, the expression of sucA and gdhA genes was regulated by two different types of promoters to increase the L-arginine accumulation concentration in the strain from 6.58 g / L to 7.24 g / L, and the L-arginine production was increased by 10.1 %; using an engineered strain HCBORN4 with the ability to synthesize L-ornithine as the starting strain, the expression of sucA and gdhA genes was regulated by two different types of promoters to increase the L-ornithine accumulation concentration in the strain from 4.72 g / L to 5.47 g / L, and the L-ornithine production was increased by 15.8%; using an engineered strain HCBCIT3 with the ability to synthesize L-citrulline as the starting strain, the expression of sucA and gdhA genes was regulated by two different types of promoters to increase the L-citrulline accumulation concentration in the strain from 9.54 g / L to 10.44 g / L, and the L-citrulline production was increased by 9.5%.

[0131] The preferred embodiments of the present invention are described in detail above. However, the present invention is not limited to the specific details in the above embodiments. Within the technical concept of the present invention, a variety of simple modifications can be made to the technical solution of the present invention, and these simple modifications all belong to the protection scope of the present invention.

[0132] It should also be noted that the various specific technical features described in the above specific embodiments can be combined in any suitable manner without contradiction. In order to avoid unnecessary repetition, the present invention will not further describe various possible combinations.

[0133] In addition, various embodiments of the present invention may be arbitrarily combined, and as long as they do not violate the concept of the present invention, they should also be regarded as the contents disclosed by the present invention.

Claims

1. An Escherichia coli for producing glutamic acid family amino acids, characterized in that: The growth-dependent promoter P containing the methyl isocitrate lyase gene prpB of Escherichia coli prpB and / or the stationary phase dependent promoter P of the ornithine antiporter / lysine permease gene ydgI ydgI ;in, The growth-dependent promoter P of the methyl isocitrate lyase gene prpB prpB The base sequence is shown in SEQ.ID.NO:1; The stationary phase dependent promoter P of the ornithine antiporter / lysine permease gene ydgI ydgI The base sequence is shown in SEQ.ID.NO:

2.

2. The Escherichia coli according to claim 1, characterized in that The original promoter P of the Escherichia coli α-ketoglutarate dehydrogenase subunit gene sucA sucA Replaced with the growth-dependent promoter P of the methylisocitrate lyase gene prpB prpB and / or, The original promoter of glutamate synthase gene gdhA was gdhA Replaced with the stationary phase-dependent promoter P of the ornithine antiporter / lysine permease gene ydgI ydgI ;in, The growth-dependent promoter P of the methyl isocitrate lyase gene prpB prpB The base sequence is shown in SEQ.ID.NO:1; The stationary phase dependent promoter P of the ornithine antiporter / lysine permease gene ydgI ydgI The base sequence is shown in SEQ.ID.NO:

2.

3. Use of the Escherichia coli as claimed in claim 1 or 2 in producing glutamic acid family amino acids.

4. A method for producing glutamic acid family amino acids, characterized in that: The method comprises: culturing the strain on a slant, culturing the seed, inoculating the strain on a glucose fermentation medium, culturing the strain by shaking, and adding glucose containing betaine after the base sugar is exhausted; wherein, The bacterial species is the Escherichia coli according to claim 1 or 2.

5. The method according to claim 4, characterized in that The slant culture step comprises: taking a strain preserved at -80°C and inoculating it on an activated slant, culturing it at 37°C for 12 hours, and subculturing it once to obtain slant seeds.

6. The method according to claim 5, characterized in that The seed culture step comprises: scraping a ring of the slant seeds with an inoculation loop and inoculating it into a 500mL conical flask filled with 30mL of seed culture medium, sealing it with nine layers of gauze, and culturing it at 37°C and 200rpm for 7-10h to obtain a seed culture solution.

7. The method according to claim 6, characterized in that The shaking culture conditions include: inoculating 10% of the volume of the seed culture solution into a 500mL triangular flask filled with fermentation medium, sealing with nine layers of gauze, 37°C, 200r / min, pH 7.0-7.2, fermentation cycle 26-30h, dissolved oxygen 30%-40%.

8. The method according to claim 7, characterized in that The final volume of the fermentation medium after inoculation was 30 mL.

9. The method according to any one of claims 4 to 8, characterized in that: The mass concentration of betaine in the betaine-containing glucose is 1 g / L, and the mass fraction of the glucose is 60%.

10. The method according to any one of claims 4 to 9, characterized in that: The mass concentration of glucose in the shaking culture is less than 5 g / L.

Images