Method for obtaining expansible pluripotent stem cells from peripheral blood mononuclear cells through reprogramming

Abstract

The invention discloses a method for obtaining expansible pluripotent stem cells from peripheral blood mononuclear cells through reprogramming, and relates to the technical field of biology. The method for obtaining the expansible pluripotent stem cells from the peripheral blood mononuclear cells through reprogramming comprises the following steps that the peripheral blood mononuclear cells (PBMC) are subjected to three stages of reprogramming to obtain the expansible pluripotent stem cells (EPSC); the reprogramming of the three stages comprises the following specific steps: S1, a peripheral blood mononuclear cell amplification stage; s2, a plasmid electroporation stage; s3, an induction stage of an LCDM-containing four-factor culture medium; according to the method, the PBMC cells are directly subjected to reprogramming operation in a plasmid electrotransfection manner, so that EPSC cloning is obtained, the reprogramming period is shortened, and the efficiency is improved; according to the reprogramming method, the time for obtaining the expansible pluripotent stem cells is obviously shortened, the induction efficiency is higher, the operation is simple, no viral vector is introduced, and the reprogramming method has a good application prospect.

Description

Technical Field

[0001] The present invention relates to biological field technology, in particular to a method for obtaining expandable pluripotent stem cells by reprogramming peripheral blood mononuclear cells. Background Art

[0002] How to establish high-quality pluripotent stem cells has always been a core issue in stem cell research. In 2017, Deng Hongkui's research group discovered a culture medium called LCDM, which can culture traditional embryonic stem cells (ESCs) of mice and humans, and induce pluripotent stem cells (PSCs) to a different pluripotency state, named "extended pluripotency" (Yang et al., 2017b). Expanded pluripotent stem cells (EPSCs) show outstanding developmental potential and bidirectional chimerism, which contribute to the development of embryonic and extraembryonic tissues, including yolk sac and placenta. The research group used EPS cells to establish a technology for rapid preparation of gene-modified animal models (Li et al., 2019a), and used human EPS cells to efficiently prepare functional hepatocytes (EPS-Heps) (Wang et al., 2020). Compared with hepatocytes prepared from traditional human pluripotent stem cells, EPS-Heps are closer to human primary hepatocytes in transcriptional profile. The results of this study reveal the application potential of preparing functional cells from EPS cells, which can provide a better source for preparing functional cells in vitro.

[0003] Other international research groups have also made a series of important progress in the research and application of EPS cells, using EPS cells to construct functional early embryonic structures in vitro (Li et al., 2019b; Sozen et al., 2019); human EPS cells were injected into early blastocysts of crab-eating macaques to prepare human-monkey chimera embryos, and the embryo survival time was successfully maintained for 20 days, which is the maximum duration that monkey embryos can be cultured in vitro (Tan et al., 2021). These studies have shown that EPS cells have broad application prospects and advantages. Compared with iPSC, EPSC has the advantages of differentiated functional cells closer to somatic cells (Chen, 2020), higher efficiency of gene editing in vitro (Xiang, 2019), and more stable genome during passage (Liu, 2021) (Zheng, 2021). EPSC has been successfully differentiated into many cell types, including somatic cells and trophoblast cells, which has greatly contributed to the research of regenerative medicine such as disease modeling, therapy screening, toxicity testing, genetic disease research and reproductive biology research. EPSC has become an important cell source for the development of pluripotent stem cells.

[0004] At present, the common method for obtaining expandable pluripotent stem cells is to first obtain induced pluripotent stem cells by reprogramming or directly use embryonic stem cells to induce expandable pluripotent stem cells under the action of LCDM small molecules. This method has a long induction cycle, low efficiency and high cost. Therefore, in view of this situation, it is urgent to develop a method for obtaining expandable pluripotent stem cells by reprogramming peripheral blood mononuclear cells to meet actual needs. Summary of the invention

[0005] In view of this, the present invention aims at the deficiencies in the prior art, and its main purpose is to provide a method for obtaining expandable pluripotent stem cells by reprogramming peripheral blood mononuclear cells, which directly reprograms PBMC cells by plasmid electroporation to obtain EPSC clones, shortens the reprogramming cycle, and improves efficiency; compared with the existing method of first establishing induced pluripotent stem cells and then obtaining expandable pluripotent stem cells under the induction of LCDM four factors, the reprogramming method significantly shortens the time for obtaining expandable pluripotent stem cells, has higher induction efficiency, is simple to operate, and does not require the introduction of viral vectors, and has good application prospects.

[0006] To achieve the above purpose, the present invention adopts the following technical solutions:

[0007] A method for obtaining expandable pluripotent stem cells by reprogramming peripheral blood mononuclear cells, comprising the following steps:

[0008] Peripheral blood mononuclear cells (PBMC) undergo three stages of reprogramming to obtain expandable pluripotent stem cells (EPSCs); the specific steps of the three stages of reprogramming include:

[0009] S1, peripheral blood mononuclear cell expansion stage;

[0010] S2, plasmid electroporation stage;

[0011] S3, induction stage containing LCDM four-factor culture medium.

[0012] As a preferred solution, the induction phase of the LCDM four-factor medium in step S3 is as follows: on the first day after electroporation, replace medium I; on the third day after electroporation, replace medium II; on the fifth day after electroporation, replace medium III, and change the medium every day until EPS clones appear.

[0013] As a preferred embodiment: the culture medium I includes StemSpan TM SFEMⅡ and StemSpan TMCD34+Expansion Supplement (10X); the culture medium II includes StemSpanTM SFEMⅡ; the culture medium III includes Knock-out DMEM / F-12, Neurobasal, NEAA, Knock-out serum replacement, B-27, N-2, (S)-(+)-Dimethindene maleate, Recombinant Human LIF, 2-Mercaptoethanol, Minocyclinehydrochloride, IWR-1-endo, CHIR99021, Y-27632, GlutaMAX Supplement, and GSK126.

[0014] As a preferred embodiment: the culture medium III includes 45% by volume of Knock-out DMEM / F-12, 45% by volume of Neurobasal, 1% by volume of NEAA, 5% by volume of Knock-out serum replacement, 1% by volume of B-27, 0.5% by volume of N-2, 2 μM (S)-(+)-Dimethindene maleate, 10 ng / mL of Recombinant Human LIF, 0.1 mM 2-Mercaptoethanol, 2 μM Minocycline hydrochloride, 1 μM IWR-1-endo, 1 μM CHIR99021, 2 μM Y-27632, 1% GlutaMAX Supplement, and 1 μM GSK126.

[0015] As a preferred embodiment: the reprogramming comprises one or more vectors, and the one or more vectors are plasmids; the plasmid electroporation stage in step S2 is to introduce the plasmid into PBMC cells by electroporation, and culture the PBMC cells after the plasmid is introduced by electroporation until EPS clones appear; the plasmids include any three or more combinations of pCXLE-hSK, pCXLE-hUL, pCXLE-hOCT3 / 4, and pCXWB-EBNA1.

[0016] As a preferred solution, the dosage of the plasmids pCXLE-hSK, pCXLE-hUL, pCXLE-hOCT3 / 4, and pCXWB-EBNA1 are all set at 5 μg / 2.0×10 6 cell.

[0017] As a preferred embodiment, the method for obtaining peripheral blood mononuclear cells (PBMCs) in step S1 is as follows: culturing the PBMCs, counting them, centrifuging them, washing them with DPBS, discarding the supernatant, and amplifying and culturing the PBMCs using culture medium I.

[0018] As a preferred embodiment: the initial cell amount of the peripheral blood mononuclear cells (PBMC) is 5×10 4 -2×10 6 cells.

[0019] As a preferred solution: after the PBMCs are amplified, the plasmid is introduced into the PBMCs in the form of DNA or mRNA by electroporation.

[0020] As a preferred embodiment, the forms of introducing the plasmid into PBMC include Sendai virus transfection system, mRNA transfection system and episomal plasmid transfection system.

[0021] Compared with the prior art, the present invention has obvious advantages and beneficial effects. Specifically, it can be seen from the above technical solution that:

[0022] First, PBMC cells were directly reprogrammed by plasmid electroporation to obtain EPSC clones, which shortened the reprogramming cycle and improved efficiency.

[0023] Second, a higher EPSC cell line can be obtained by using a smaller amount of PBMC cells, that is, drawing a small amount of blood, thus reducing the acquisition cost.

[0024] Third, compared with the existing method of first establishing induced pluripotent stem cells and then obtaining expandable pluripotent stem cells under the induction of LCDM four factors, this reprogramming method significantly shortens the time to obtain expandable pluripotent stem cells, has higher induction efficiency, is simple to operate, and does not require the introduction of viral vectors, and has good application prospects.

[0025] Fourth, under the action of four small molecules: Recombinant Human LIF, CHIR99021, (S)-(+)-Dimethindene maleate and Min-C (Minocycline, Hydrochloride) (LCDM), the reprogramming efficiency can be significantly improved, and the efficient preparation of expandable pluripotent stem cells can be achieved.

[0026] Fifth, the present invention improves the way of reprogramming somatic cells into expandable pluripotent stem cells by providing a new and more convenient way to reprogram somatic cells into expandable pluripotent stem cells, improves the reprogramming efficiency and the purity of expandable pluripotent stem cells, and solves the problems of low induction efficiency and potential safety risks introduced by the use of viral vectors in the prior art.

[0027] In order to more clearly illustrate the structural features and effects of the present invention, it is described in detail below in conjunction with the accompanying drawings and specific embodiments. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] Figure 1 This is a schematic diagram of the morphology of expandable pluripotent stem cells obtained by staged peripheral blood mononuclear cell reprogramming in Example 1 of the present invention;

[0029] Figure 2 This is a schematic diagram of the results of fluorescence quantitative PCR analysis of the relative expression of mRNA of pluripotency in Example 1 of the present invention;

[0030] Figure 3 This is a schematic diagram of the results of flow cytometry detection of the differentiation of the three germ layers of expandable pluripotent stem cells obtained by reprogramming into endoderm cells in Example 1 of the present invention;

[0031] Figure 4 This is a schematic diagram of the results of flow cytometry detection of the differentiation of the three germ layers of expandable pluripotent stem cells obtained by reprogramming into mesoderm cells in Example 1 of the present invention;

[0032] Figure 5 This is a schematic diagram of the results of flow cytometry detection of the differentiation of three germ layers of expandable pluripotent stem cells obtained by reprogramming into ectodermal cells in Example 1 of the present invention;

[0033] Figure 6 This is a schematic diagram of the morphology of expandable pluripotent stem cells obtained by staged peripheral blood mononuclear cell reprogramming in Example 2 of the present invention;

[0034] Figure 7 This is a schematic diagram of the results of the fluorescence quantitative PCR analysis of the relative expression of pluripotency mRNA in Example 2 of the present invention;

[0035] Figure 8 This is a schematic diagram of the results of flow cytometry detection of the differentiation of the three germ layers of expandable pluripotent stem cells obtained by reprogramming into endoderm cells in Example 2 of the present invention;

[0036] Fig. 9 This is a schematic diagram of the results of flow cytometry detection of the differentiation of the three germ layers of expandable pluripotent stem cells obtained by reprogramming into mesoderm cells in Example 2 of the present invention;

[0037] Fig.10 This is a schematic diagram of the results of flow cytometry detection of the differentiation of three germ layers of expandable pluripotent stem cells obtained by reprogramming into ectoderm cells in Example 2 of the present invention. DETAILED DESCRIPTION

[0038] The present invention Figures 1 to 10As shown, a method for obtaining expandable pluripotent stem cells by reprogramming peripheral blood mononuclear cells comprises the following steps:

[0039] Peripheral blood mononuclear cells (PBMC) undergo three stages of reprogramming to obtain expandable pluripotent stem cells (EPSCs); the specific steps of the three stages of reprogramming include:

[0040] S1, peripheral blood mononuclear cell expansion stage;

[0041] S2, plasmid electroporation stage;

[0042] S3, the induction stage of the culture medium containing LCDM four factors; the LCDM four factors are four small molecules: Recombinant Human LIF, CHIR99021, (S)-(+)-Dimethindene maleate and Min-C (Minocycline, Hydrochloride).

[0043] The induction phase of the LCDM four-factor medium in step S3 is as follows: on the first day after electroporation, medium I is replaced; on the third day after electroporation, medium II is replaced; on the fifth day after electroporation, medium III is replaced, and the medium is replaced every day until EPS clones appear.

[0044] This medium I includes StemSpan TM SFEMⅡ and StemSpan TM CD34+ Expansion Supplement (10X); the culture medium II includes StemSpanTM SFEMⅡ; the culture medium III includes Knock-out DMEM / F-12, Neurobasal, NEAA, Knock-out serum replacement, B-27, N-2, (S)-(+)-Dimethindene maleate, Recombinant Human LIF, 2-Mercaptoethanol, Minocycline hydrochloride, IWR-1-endo, CHIR99021, Y-27632, GlutaMAX Supplement, and GSK126.

[0045] The culture medium III includes 45% by volume of Knock-out DMEM / F-12, 45% by volume of Neurobasal, 1% by volume of NEAA, 5% by volume of Knock-out serum replacement, 1% by volume of B-27, 0.5% by volume of N-2, 2 μM (S)-(+)-Dimethindenemaleate, 10 ng / mL of Recombinant Human LIF, 0.1 mM 2-Mercaptoethanol, 2 μM Minocycline hydrochloride, 1 μM IWR-1-endo, 1 μM CHIR99021, 2 μM Y-27632, 1% GlutaMAX Supplement, and 1 μM GSK126.

[0046] The reprogramming comprises one or more vectors, which are plasmids; the plasmid electroporation stage in step S2 is to introduce the plasmid into PBMC cells by electroporation, and culture the PBMC cells after the plasmid is introduced by electroporation until EPS clones appear; the plasmids include any three or more combinations of pCXLE-hSK, pCXLE-hUL, pCXLE-hOCT3 / 4, and pCXWB-EBNA1.

[0047] The dosage of the plasmids pCXLE-hSK, pCXLE-hUL, pCXLE-hOCT3 / 4, and pCXWB-EBNA1 was set at 5 μg / 2.0×10 6 cell.

[0048] The method for obtaining peripheral blood mononuclear cells (PBMCs) in step S1 is as follows: culturing the PBMCs, counting them, centrifuging them, washing them with DPBS, discarding the supernatant, and amplifying and culturing the PBMCs using culture medium I.

[0049] The initial cell number of peripheral blood mononuclear cells (PBMC) was 5×10 4 -2×10 6 cells.

[0050] After the PBMCs are amplified, the plasmid is introduced into the PBMCs in the form of DNA or mRNA by electroporation.

[0051] The forms of introducing the plasmid into PBMC include Sendai virus transfection system, mRNA transfection system and episomal plasmid transfection system.

[0052] Example 1

[0053] Isolation and culture of peripheral blood mononuclear cells (PBMC) from volunteer 1

[0054] Adult cells or terminally differentiated cells, such as fibroblasts, hematopoietic cells, muscle cells, neurons, epidermal cells, monocytes, etc.; the cells reprogrammed in this protocol are adult cells, including but not limited to hepatocytes, cardiomyocytes, kidney cells, epithelial cells, osteoblasts, etc. This protocol uses PBMC for reprogramming, and the PBMC used for reprogramming is obtained by extraction of lymph separation fluid.

[0055] Preparation of induction reagents:

[0056] Culture medium I comprises a basal culture medium and an additive; the culture medium I comprises StemSpan TM SFEM Ⅱ and StemSpan TM CD34+ Expansion Supplement(10X).

[0057] Medium II, the basal medium of which includes StemSpan TM SFEMⅡ.

[0058] Culture medium III, the basic culture medium of this culture medium III includes 45% Knock-out DMEM / F-12, 45% Neurobasal, 1% NEAA, 5% Knock-out serum replacement, 1% B-27, 0.5% N-2, 2μM (S)-(+)-Dimethindene maleate, 10ng / mL Recombinant Human LIF, 0.1mM 2-Mercaptoethanol, 2μM Minocycline hydrochloride, 1μM IWR-1-endo, 1μM CHIR99021, 2μM Y-27632, 1% GlutaMAX Supplement, and 1μM GSK126.

[0059] Take out the cell culture medium, DPBS buffer and PBMC cells cultured for 5-7 days respectively, count them, and according to the counting results, take 5×10 4 -2×10 6 Cells, centrifuge, wash once with DPBS, and discard the supernatant. Take out a clean EP tube from the biosafety cabinet and pipette 100 μL of the pre-prepared electroporation buffer into the EP tube. Add the reprogramming plasmid to the electroporation buffer. After mixing with a pipette, pipette out all the liquid and add it to the cell pellet, transfer it to the electroporation cup, fasten the lid of the electroporation cup, and perform electroporation.

[0060] PBMC cells are directly reprogrammed by plasmid electroporation to obtain EPSC clones. The entire reprogramming cycle is about 20 days, which shortens the reprogramming cycle and improves efficiency.

[0061] Take out the 12-well plate and place it in the biosafety cabinet, add 1 mL of culture medium I to the well, open the lid of the electroporation cup, use a clean pipette to draw about 1 mL of culture medium I into the electroporation cup, and aspirate all the liquid, then transfer it to the well, mix the cells by cross-cross method, place it in the cell culture incubator, cross-cross mix again, and culture it statically. On the first day after electroporation, replace it with culture medium I, on the third day, replace it with culture medium II, and after the fifth day, replace it with culture medium III. After about 20 days of culture, many EPS clones grow out. The morphology of the expanded pluripotent stem cells (EPSC) obtained by reprogramming is shown in the figure below. Figure 1 The constructed cell was named EPS-1.

[0062] (1) Real-time fluorescence quantitative PCR identification of pluripotency of reprogrammed EPS

[0063] 1) Extraction of total RNA from cells

[0064] Collect the cells cultured in the 6-well plate, wash twice with 0.5mL DPBS, lyse the cells with 350μL RLT solution in the RNA extraction kit (Qiagen, Cat. No. 74104), repeatedly blow until the cells are completely lysed, and transfer the cell lysate to an RNase-free centrifuge tube. Add 350μL 70% ethanol to the lysate in the centrifuge tube and mix thoroughly. Add 700μL of the sample to the centrifuge column with the collection tube in the kit. Centrifuge at 10000g for 15s and discard the effluent. Add 700μL of RW1 solution to the centrifuge column, centrifuge at 10000g for 15s, and discard the effluent. Add 500μL RPE solution to the centrifuge column, centrifuge at 10000g for 15s, and discard the effluent. Add 500μL RPE solution to the centrifuge column, centrifuge at 10000g for 2min, and discard the effluent. Place the centrifuge column in a new collection tube, add 30 μL of RNase-free water to the center of the centrifuge column membrane, and centrifuge at 10,000 g for 1 min. Collect the effluent as the extracted RNA, and store the RNA in a -80°C ultra-low temperature refrigerator.

[0065] 2) Preparation of cDNA

[0066] a. The concentration and purity of the total cellular RNA extracted above were measured (A260 / A280 absorbance ratio>1.8), and cDNA was obtained using the reverse transcription kit of Takara manufacturer; the total RNA was taken out and placed on ice, and the volume required for reverse transcription of 1μgRNA was calculated according to the concentration, and then 4μL of 5×gDNA Eraser buffer and 2μL of gDNA Eraser were added, and the rest was supplemented with RNase-free water to obtain a total volume of 20μL of the mixed solution after genomic DNA removal; gently mixed, and the mixed liquid was centrifuged to the bottom of the PCR tube using a handheld centrifuge, and the reaction was carried out using Labnet MULTIGENE OPTIMAX, and the reaction conditions were: 42℃, 2min.

[0067] b. Place the reaction solution obtained in step a above on ice, and add 2 μL of PrimerScript RT, 2 μL of RT Primer Mix, 28 μL of 5× PrimerScript Buffer, and 4 μL of RNase-free water in the kit to obtain a mixed solution with a total volume of 40 μL for reverse transcription; mix gently, centrifuge the mixed liquid to the bottom of the PCR tube using a handheld centrifuge, and use Labnet MULTIGENE OPTIMAX for reaction. The reaction conditions are: 37°C, 15 min, 85°C, 5 s, and then store at -20°C.

[0068] 3) SYBR Green real-time fluorescence quantitative PCR was used to detect the relative expression of mRNA.

[0069] Take 1 μL of the cDNA obtained by reverse transcription and add Green Realtime PCR MasterMix 7.5μL, upstream primer 0.5μL, downstream primer 0.5μL, and the rest was supplemented with RNase-free water to a total volume of 15μL; amplification was performed using a Roche LightCycler 480Ⅱ quantitative PCR instrument, and the reaction conditions were: 95℃, 5min; 95℃, 15s; 60℃, 30s; repeated 39 cycles. The experimental results were analyzed using the △△CT method to compare the housekeeping gene GAPDH. Primers used in this study: GAPDH forward primer GTCTCCTCTGACTTCAACAGCG, reverse primer ACCACCCTGTTGCTGTAGCCAA; SOX2 forward primer GCTACAGCATGATGCAGGACCA, reverse primer TCTGCGAGCTGGTCATGGAGTT; NANOG forward primer CTCCAACATCCTGAACCTCAGC, reverse primer CGTCACACCATTGCTATTCTTCG; OCT4 forward primer CCTGAAGCAGAAGAGGATCACC, reverse primer AAAGCGGCAGAT GGTCGTTTGG; KLF4 forward primer ACCCACACAGGTGAGAAACC, reverse primer ATGCTCGGTCGCATTTTTGG; DNMT3L forward primer CGCCCCATGTAAGGACAAGT, reverse primer ATCGGGTGCAATCAGGGTTT, ZIC2 forward primer GCACGTCCACACCTCCGATAA, reverse primer TGGACCTTCATGTGCTTCCGCAG; DUSP6 forward primer TGGAACGAGAATACGGGCG, reverse primer CTTACTGAAGCCACCTTCCA.

[0070] The relative expression of pluripotency mRNA detected by real-time fluorescence quantitative PCR is shown in the attached figure. Figure 2 As shown; compared with induced pluripotent stem cells obtained by PBMC reprogramming, DNMT3L and KLF4 mRNA were significantly increased, DUSP6 and ZIC2 mRNA were significantly decreased; compared with induced pluripotent stem cells, the mRNA of pluripotency genes SXO2, OCT4, and NANOG was significantly decreased;

[0071] (2) Flow cytometry to detect the expression of markers related to the differentiation potential of the three germ layers in vitro

[0072] The cells were washed three times with PBS (i.e. DPBS) without calcium and magnesium ions, and the residual liquid was removed. Then, the cells were covered with Accutase, placed in a 37°C incubator, digested for 8-10 minutes, and then digested with DMEM / F-12. The cell mass was gently blown to mix the single cells, transferred to a flow tube, centrifuged at 400g for 3 minutes, and the supernatant was removed, leaving the cell pellet; the cell pellet was resuspended with DPBS, centrifuged at 400g for 3 minutes, and the supernatant was removed, leaving the cell pellet; 0.5mL of fixation and permeation solution (prepared and used immediately, pay attention to avoid light) was added and gently blown, the cell pellet was resuspended, and placed in a 4°C refrigerator for 1 hour away from light; the fixation and permeation were terminated with 0.5mL of freshly prepared washing solution, centrifuged at 500g for 3 minutes, and the supernatant was removed, leaving the cell pellet. 1mL of washing solution was added to the cell pellet, the cells were resuspended, and the supernatant was discarded after centrifugation at 500g for 3 minutes. The primary antibody was added, and the cell pellet was placed in a 4°C refrigerator away from light and incubated for 40 minutes. After incubation, stop incubation with 0.5 mL of washing solution, centrifuge at 500 g for 3 min, and remove the supernatant; add 1 mL of washing solution to the cell pellet, resuspend the cell pellet, centrifuge at 500 g for 3 min, and discard the supernatant. Add fluorescent secondary antibody and incubate at 4°C for 1 h. Add 1 mL of washing solution to the cell pellet, resuspend the cell pellet, centrifuge at 500 g for 3 min, and discard the supernatant. Finally, resuspend the cell pellet with 0.5 mL of DPBS and put it on the machine; use BD FACSAriaIIu flow cytometer for sample analysis.

[0073] The fluorescent primary antibodies used in this application are as follows: PE Mouse anti-Human FoxA2 (561589, BD), Alexa 647Mouse Anti-Human Sox17 (562594, BD); Alexa 647Mouse Anti-Nestin (560393, BD), Alexa 488Mouse anti-Human Pax-6 (560393, BD); recombinant Anti-Brachyury / Bry antibody (ab209665, Abcam, 1:400), Anti-alpha smooth muscle Actin antibody (ab7817, Abcam, 1:800).

[0074] The fluorescent secondary antibodies were as follows: Goat anti-Rabbit IgG (H+L) fluorescent secondary antibody, 488 nm, Donkey anti-mouse IgG (H+L) fluorescent secondary antibody, 647 nm.

[0075] Flow cytometry was used to detect the expression of three germ layer differentiation markers. The negative control group showed the negative control of the added primary antibody isotype control; the results are shown in Figures 3 to 5 shown.

[0076] Example 2

[0077] Isolation and culture of peripheral blood mononuclear cells (PBMC) from volunteer 2

[0078] Adult cells or terminally differentiated cells, such as fibroblasts, hematopoietic cells, myocytes, neurons, epidermal cells, monocytes, etc. The cells reprogrammed in this protocol are adult cells, including but not limited to hepatocytes, cardiomyocytes, kidney cells, epithelial cells, osteoblasts, etc. This protocol uses PBMC for reprogramming, and the PBMC used for reprogramming is obtained by extracting lymphocyte separation fluid.

[0079] Preparation of induction reagents:

[0080] Culture medium I comprises a basal culture medium and an additive; the culture medium I comprises StemSpan TM SFEMⅡ and StemSpan TM CD34+Expansion Supplement(10X).

[0081] Medium II, the basal medium includes StemSpan TM SFEMⅡ.

[0082] Culture medium III, the basic culture medium includes 45% Knock-out DMEM / F-12, 45% Neurobasal, 1% NEAA, 5% Knock-out serum replacement, 1% B-27, 0.5% N-2, 2μM (S)-(+)-Dimethindene maleate, 10ng / mL Recombinant Human LIF, 0.1mM 2-Mercaptoethanol, 2μM Minocyclinehydrochloride, 1μM IWR-1-endo, 1μM CHIR99021, 2μM Y-27632, 1% GlutaMAXSupplement, and 1μM GSK126.

[0083] Take out the cell culture medium, DPBS buffer and PBMC cells cultured for 5-7 days respectively, count them, and according to the counting results, take 5×10 4 -2×10 6Cells, centrifuge, wash once with DPBS, and discard the supernatant. Take out a clean EP tube from the biosafety cabinet and pipette 100 μL of the pre-prepared electroporation buffer into the EP tube. Add the reprogramming plasmid to the electroporation buffer. After mixing with a pipette, pipette out all the liquid and add it to the cell pellet, transfer it to the electroporation cup, fasten the lid of the electroporation cup, and perform electroporation.

[0084] Take out the 12-well plate and place it in the biosafety cabinet, add 1 mL of culture medium I to the well, open the lid of the electroporation cup, use a clean pipette to draw about 1 mL of culture medium I into the electroporation cup, and aspirate all the liquid, then transfer it to the well, mix the cells by cross-cross method, place it in the cell culture incubator, cross-cross mix again, and culture it statically. On the first day after electroporation, replace it with culture medium I, on the third day, replace it with culture medium II, and after the fifth day, replace it with culture medium III. After about 20 days of culture, many EPS clones grow out. The morphology of the expanded pluripotent stem cells (EPSC) obtained by reprogramming is shown in the figure below. Figure 6 The constructed cells were named EPS-2.

[0085] (1) Real-time fluorescence quantitative PCR identification of pluripotency of reprogrammed EPS

[0086] 1) Extraction of total RNA from cells

[0087] Collect the cells cultured in the 6-well plate, wash twice with 0.5mL DPBS, lyse the cells with 350μL RLT solution in the RNA extraction kit (Qiagen, Cat. No. 74104), repeatedly blow until the cells are completely lysed, and transfer the cell lysate to an RNase-free centrifuge tube. Add 350μL 70% ethanol to the lysate in the centrifuge tube and mix thoroughly. Add 700μL of the sample to the centrifuge column with the collection tube in the kit. Centrifuge at 10000g for 15s and discard the effluent. Add 700μL of RW1 solution to the centrifuge column, centrifuge at 10000g for 15s, and discard the effluent. Add 500μL RPE solution to the centrifuge column, centrifuge at 10000g for 15s, and discard the effluent. Add 500μL RPE solution to the centrifuge column, centrifuge at 10000g for 2min, and discard the effluent. Place the centrifuge column in a new collection tube, add 30 μL of RNase-free water to the center of the centrifuge column membrane, and centrifuge at 10,000 g for 1 min. Collect the effluent as the extracted RNA, and store the RNA in a -80°C ultra-low temperature refrigerator.

[0088] 2) Preparation of cDNA

[0089] a. The concentration and purity of the total cellular RNA extracted above were measured (A260 / A280 absorbance ratio>1.8), and cDNA was obtained using the reverse transcription kit of Takara manufacturer; the total RNA was taken out and placed on ice, and the volume required for reverse transcription of 1μgRNA was calculated according to the concentration, and then 4μL of 5×gDNA Eraser buffer and 2μL of gDNA Eraser were added, and the rest was supplemented with RNase-free water to obtain a total volume of 20μL of the mixed solution after genomic DNA removal; gently mixed, and the mixed liquid was centrifuged to the bottom of the PCR tube using a handheld centrifuge, and the reaction was carried out using Labnet MULTIGENE OPTIMAX, and the reaction conditions were: 42℃, 2min.

[0090] b. Place the reaction solution obtained in step a above on ice, and add 2 μL of PrimerScript RT, 2 μL of RT Primer Mix, 28 μL of 5× PrimerScript Buffer, and 4 μL of RNase-free water in the kit to obtain a mixed solution with a total volume of 40 μL for reverse transcription; mix gently, centrifuge the mixed liquid to the bottom of the PCR tube using a handheld centrifuge, and use Labnet MULTIGENE OPTIMAX for reaction. The reaction conditions are: 37°C, 15 min, 85°C, 5 s, and then store at -20°C.

[0091] 3) SYBR Green real-time fluorescence quantitative PCR was used to detect the relative expression of mRNA.

[0092] Take 1 μL of the cDNA obtained by reverse transcription and add Green Realtime PCR Master Mix 7.5μL, upstream primer 0.5μL, downstream primer 0.5μL, and the rest was supplemented with RNase-free water to a total volume of 15μL; amplification was performed using a Roche LightCycler 480Ⅱ quantitative PCR instrument, and the reaction conditions were: 95℃, 5min; 95℃, 15s; 60℃, 30s; repeated 39 cycles. The experimental results were analyzed using the △△CT method to compare the housekeeping gene GAPDH. Primers used in this study: GAPDH forward primer GTCTCCTCTGACTTCAACAGCG, reverse primer ACCACCCTGTTGCTGTAGCCAA; SOX2 forward primer GCTACAGCATGATGCAGGACCA, reverse primer TCTGCGAGCTGGTCATGGAGTT; NANOG forward primer CTCCAACATCCTGAACCTCAGC, reverse primer CGTCACACCATTGCTATTCTTCG; OCT4 forward primer CCTGAAGCAGAAGAGGATCACC, reverse primer AAAGCGGCAGAT GGTCGTTTGG; KLF4 forward primer ACCCACACAGGTGAGAAACC, reverse primer ATGCTCGGTCGCATTTTTGG; DNMT3L forward primer CGCCCCATGTAAGGACAAGT, reverse primer ATCGGGTGCAATCAGGGTTT, ZIC2 forward primer GCACGTCCACACCTCCGATAA, reverse primer TGGACCTTCATGTGCTTCCGCAG; DUSP6 forward primer TGGAACGAGAATACGGGCG, reverse primer CTTACTGAAGCCACCTTCCA.

[0093] The relative expression of pluripotency mRNA detected by real-time fluorescence quantitative PCR is shown in the attached figure. Figure 7 As shown; compared with induced pluripotent stem cells obtained by PBMC reprogramming, DNMT3L and KLF4 mRNA were significantly increased, DUSP6 and ZIC2 mRNA were significantly decreased; compared with induced pluripotent stem cells, the mRNA of pluripotency genes SXO2, OCT4, and NANOG was significantly decreased;

[0094] (2) Flow cytometry to detect the expression of markers related to the differentiation potential of the three germ layers in vitro

[0095] The cells were washed three times with PBS (i.e. DPBS) without calcium and magnesium ions, and the residual liquid was removed. Then, the cells were covered with Accutase, placed in a 37°C incubator, digested for 8-10 minutes, and then digested with DMEM / F-12. The cell mass was gently blown to mix the single cells, transferred to a flow tube, centrifuged at 400g for 3 minutes, and the supernatant was removed, leaving the cell pellet; the cell pellet was resuspended with DPBS, centrifuged at 400g for 3 minutes, and the supernatant was removed, leaving the cell pellet; 0.5mL of fixation and permeation solution (prepared and used immediately, pay attention to avoid light) was added and gently blown, the cell pellet was resuspended, and placed in a 4°C refrigerator for 1 hour away from light; the fixation and permeation were terminated with 0.5mL of freshly prepared washing solution, centrifuged at 500g for 3 minutes, and the supernatant was removed, leaving the cell pellet. 1mL of washing solution was added to the cell pellet, the cells were resuspended, and the supernatant was discarded after centrifugation at 500g for 3 minutes. The primary antibody was added, and the cell pellet was placed in a 4°C refrigerator away from light and incubated for 40 minutes. After incubation, stop incubation with 0.5 mL of washing solution, centrifuge at 500 g for 3 min, and remove the supernatant; add 1 mL of washing solution to the cell pellet, resuspend the cell pellet, centrifuge at 500 g for 3 min, and discard the supernatant. Add fluorescent secondary antibody and incubate at 4°C for 1 h. Add 1 mL of washing solution to the cell pellet, resuspend the cell pellet, centrifuge at 500 g for 3 min, and discard the supernatant. Finally, resuspend the cell pellet with 0.5 mL of DPBS and put it on the machine; use BD FACSAriaIIu flow cytometer for sample analysis.

[0096] The fluorescent primary antibodies used in this study are as follows: PE Mouse anti-Human FoxA2 (561589, BD), Alexa 647 Mouse Anti-Human Sox17 (562594, BD); Alexa 647Mouse Anti-Nestin (560393, BD), Alexa 488 Mouse anti-Human Pax-6 (560393, BD); recombinant Anti-Brachyury / Bry antibody (ab209665, Abcam, 1:400), Anti-alpha smooth muscle Actin antibody (ab7817, Abcam, 1:800).

[0097] The fluorescent secondary antibodies were as follows: Goat anti-Rabbit IgG (H+L) fluorescent secondary antibody, 488 nm, Donkey anti-mouse IgG (H+L) fluorescent secondary antibody, 647 nm.

[0098] Flow cytometry was used to detect the expression of three germ layer differentiation markers. The negative control group showed the negative control of the added primary antibody isotype control; the results are shown in Figures 8 to 10 shown.

[0099] The results show that the introduction of the induction culture method provided by the present invention can successfully reprogram PBMCs into expandable pluripotent stem cells.

[0100] The design emphasis of the present invention is:

[0101] First, PBMC cells were directly reprogrammed by plasmid electroporation to obtain EPSC clones, which shortened the reprogramming cycle and improved efficiency.

[0102] Second, a higher EPSC cell line can be obtained by using a smaller amount of PBMC cells, that is, drawing a small amount of blood, thus reducing the acquisition cost.

[0103] Third, compared with the existing method of first establishing induced pluripotent stem cells and then obtaining expandable pluripotent stem cells under the induction of LCDM four factors, this reprogramming method significantly shortens the time to obtain expandable pluripotent stem cells, has higher induction efficiency, is simple to operate, and does not require the introduction of viral vectors, and has good application prospects.

[0104] Fourth, under the action of four small molecules: Recombinant Human LIF, CHIR99021, (S)-(+)-Dimethindene maleate and Min-C (Minocycline, Hydrochloride) (LCDM), the reprogramming efficiency can be significantly improved, and the efficient preparation of expandable pluripotent stem cells can be achieved.

[0105] Fifth, the present invention improves the way of reprogramming somatic cells into expandable pluripotent stem cells by providing a new and more convenient way to reprogram somatic cells into expandable pluripotent stem cells, improves the reprogramming efficiency and the purity of expandable pluripotent stem cells, and solves the problems of low induction efficiency and potential safety risks introduced by the use of viral vectors in the prior art.

[0106] The above description is only a preferred embodiment of the present invention and does not limit the technical scope of the present invention. Therefore, any slight modifications, equivalent changes and modifications made to the above embodiments based on the technical essence of the present invention are still within the scope of the technical solution of the present invention.

Claims

1. A method for obtaining expandable pluripotent stem cells by reprogramming peripheral blood mononuclear cells, characterized in that: The steps include: Peripheral blood mononuclear cells (PBMC) undergo three stages of reprogramming to obtain expandable pluripotent stem cells (EPSCs); the specific steps of the three stages of reprogramming include: S1, peripheral blood mononuclear cell expansion stage; S2, plasmid electroporation stage; S3, induction stage containing LCDM four-factor culture medium.

2. A method for obtaining expandable pluripotent stem cells by reprogramming peripheral blood mononuclear cells according to claim 1, characterized in that: The induction stage of the LCDM four-factor medium in step S3 is specifically as follows: on the first day after electroporation, medium I is replaced; on the third day after electroporation, medium II is replaced; on the fifth day after electroporation, medium III is replaced, and the medium is replaced every day until EPS clones appear.

3. The method for obtaining expandable pluripotent stem cells by reprogramming peripheral blood mononuclear cells according to claim 2, characterized in that: The medium I includes StemSpan TM SFEMⅡ and StemSpan TM CD34+ExpansionSupplement (10X); the culture medium II includes StemSpanTM SFEMⅡ; the culture medium III includes Knock-out DMEM / F-12, Neurobasal, NEAA, Knock-out serum replacement, B-27, N-2, (S)-(+)-Dimethindenemaleate, Recombinant Human LIF, 2-Mercaptoethanol, Minocycline hydrochloride, IWR-1-endo, CHIR99021, Y-27632, GlutaMAX Supplement, and GSK126.

4. The method for obtaining expandable pluripotent stem cells by reprogramming peripheral blood mononuclear cells according to claim 3, characterized in that: The culture medium III includes 45% by volume of Knock-out DMEM / F-12, 45% by volume of Neurobasal, 1% by volume of NEAA, 5% by volume of Knock-out serum replacement, 1% by volume of B-27, 0.5% by volume of N-2, 2 μM (S)-(+)-Dimethindene maleate, 10 ng / mL of Recombinant Human LIF, 0.1 mM 2-Mercaptoethanol, 2 μM Minocycline hydrochloride, 1 μM IWR-1-endo, 1 μM CHIR99021, 2 μM Y-27632, 1% GlutaMAX Supplement, and 1 μM GSK126.

5. The method for obtaining expandable pluripotent stem cells by reprogramming peripheral blood mononuclear cells according to claim 1, characterized in that: The reprogramming comprises one or more vectors, and the one or more vectors are plasmids; the plasmid electroporation stage in step S2 is to introduce the plasmid into PBMC cells by electroporation, and culture the PBMC cells after the plasmid is introduced by electroporation until EPS clones appear; the plasmids include any three or more combinations of pCXLE-hSK, pCXLE-hUL, pCXLE-hOCT3 / 4, and pCXWB-EBNA1.

6. The method for obtaining expandable pluripotent stem cells by reprogramming peripheral blood mononuclear cells according to claim 5, characterized in that: The dosage of the plasmids pCXLE-hSK, pCXLE-hUL, pCXLE-hOCT3 / 4, and pCXWB-EBNA1 were all set at 5 μg / 2.0×10 6 cell.

7. The method for obtaining expandable pluripotent stem cells by reprogramming peripheral blood mononuclear cells according to claim 1, characterized in that: The method for obtaining peripheral blood mononuclear cells (PBMCs) in step S1 is as follows: culturing the PBMCs, counting them, centrifuging them, washing them with DPBS, discarding the supernatant, and amplifying and culturing the PBMCs using culture medium I.

8. The method for obtaining expandable pluripotent stem cells by reprogramming peripheral blood mononuclear cells according to claim 1, characterized in that: The initial cell number of peripheral blood mononuclear cells (PBMC) was 5×10 4 -2×10 6 cells.

9. The method for obtaining expandable pluripotent stem cells by reprogramming peripheral blood mononuclear cells according to claim 5, characterized in that: After the PBMCs are amplified, the plasmid is introduced into the PBMCs in the form of DNA or mRNA by electroporation.

10. The method for obtaining expandable pluripotent stem cells by reprogramming peripheral blood mononuclear cells according to claim 9, characterized in that: The forms of introducing the plasmid into PBMC include Sendai virus transfection system, mRNA transfection system and episomal plasmid transfection system.

Images