Potato high-temperature inducible promoter pStHSP70 and application thereof

Abstract

The invention provides a potato high-temperature inducible promoter pStHSP70 and application thereof.The nucleotide sequence of the potato high-temperature inducible promoter pStHSP70 is shown as SEQ ID No.1, and the potato high-temperature inducible promoter pStHSP70 has high-temperature specific expressivity and can serve as a specific promoter to drive specific expression of a target gene under the high-temperature condition; the adverse effect caused by continuous expression of the target gene in other tissues of the plant can be avoided, and the method has wide application value in the fields of plant genetic engineering and germplasm resource improvement.

Description

Technical Field

[0001] The invention belongs to the technical field of plant gene engineering, and specifically relates to a potato high temperature inducible promoter pStHSP70 and an application thereof. Background Art

[0002] Potatoes prefer cool weather, tolerate light frost, and are not heat-resistant. High temperatures have a significant impact on potato plant morphology, photosynthesis, tuber formation, and yield quality. Therefore, it is of great significance to study the molecular mechanism of potato resistance to high temperature stress.

[0003] A promoter is a DNA sequence located in the 5' upstream region of a structural gene that can activate RNA polymerase, allowing it to accurately bind to the template DNA and have the specificity of transcription initiation. According to their mode of action and function, promoters are generally divided into three categories: constitutive promoters, tissue-specific promoters, and inducible promoters. Constitutive promoters are also called non-specific expression promoters. Their regulation is not affected by external conditions. In crop improvement, 35S promoters and maize ubiquitin promoters have been widely used. However, due to their poor spatiotemporal specificity, some negative effects have gradually emerged, such as increased plant energy consumption and reduced biomass. Therefore, people have gradually recognized the advantages of tissue-specific promoters and inducible promoters. In the study of the molecular mechanism of potato heat tolerance, high temperature inducible promoters are needed to upregulate the expression of target genes, and then analyze the function of target genes in potato response to high temperature stress, so as to minimize the adverse effects of target genes on other tissues and organs. At present, high temperature inducible promoters have shown great application potential in gene function research and molecular breeding. For example, CN116083427A soybean high temperature inducible promoter and its application discloses that the promoter of soybean inositol galactosidase synthase gene can initiate the efficient expression of heat-resistant related genes under high temperature conditions; CN112251439A Arabidopsis high temperature inducible promoter pHTG1 and its recombinant vector discloses an Arabidopsis promoter pHTG1 that can be used as a high temperature inducible promoter for crop genetic improvement; CN112251438A application of the promoter of plant high temperature inducible gene AT3G56970 in improving plant stress resistance discloses a high temperature inducible promoter, which is derived from the Columbia ecotype Arabidopsis and can be used as a high temperature specific promoter to drive functional genes to improve the high temperature resistance of plants and enhance the tolerance of plants to high temperature; CN111718938A a plant green tissue specific expression high temperature inducible promoter and its application discloses a promoter pRCA1 that has both high temperature inducible and plant green tissue specific expression characteristics, and pRCA1 can increase the expression of the target gene in leaves and other parts under high temperature adversity. Although high temperature-inducible promoters in plants are being continuously reported, there are still few high temperature-inducible promoters isolated and identified in potatoes. Therefore, more potato high temperature-inducible promoters are urgently needed to meet the needs of functional research on potato heat tolerance-related genes and potato breeding improvement.

[0004] Heat shock proteins, also known as heat shock proteins, are commonly found in prokaryotes and eukaryotes. Heat shock proteins can play a key role as molecular chaperones in the growth and development of plants and in the stress response process. According to the different molecular weights of the proteins, heat shock proteins can be divided into five categories, HSP110, HSP90, HSP70, HSP60 and small molecule heat shock proteins. Among them, HSP70, as one of the important members of the heat shock protein family, can significantly improve the tolerance of plants to various abiotic stresses. The inventors of the present invention screened a gene StHSP70 that was significantly induced by high temperature in the transcriptome data, and speculated that the gene may play an important role in potato response to high temperature stress. The promoter is an important component in gene expression regulation. Therefore, studying the promoter segment of StHSP70 and its expression response to high temperature stress is of great significance for analyzing the molecular mechanism of plant resistance to high temperature stress.

[0005] In summary, the development of a potato high-temperature-inducible promoter will not only help the functional analysis and identification of potato heat-resistance-related genes, but also provide an applicable promoter reference sequence for the study of plant resistance to high-temperature stress and provide a theoretical basis for the breeding of heat-resistant plants. Summary of the invention

[0006] In view of this, the purpose of the present invention is to provide a potato high-temperature inducible promoter pStHSP70 and its application. The potato high-temperature inducible promoter pStHSP70 has high-temperature specific expression, can be used as a specific promoter to drive the specific expression of the target gene under high temperature conditions, can avoid the adverse effects of the continuous expression of the target gene in other tissues of the plant, and has broad application value in the fields of plant genetic engineering and germplasm resource improvement.

[0007] In order to achieve the above object, the present invention provides the following technical solutions:

[0008] The invention provides a potato high temperature inducible promoter pStHSP70, the nucleotide sequence of which is shown as SEQ ID No.1.

[0009] The present invention also provides a method for cloning or isolating the potato high temperature inducible promoter pStHSP70, which comprises using the primer pair SEQ ID No. 2 and SEQ ID No. 3 to obtain the nucleotide sequence of the promoter pStHSP70 from potato DM total genomic DNA by PCR amplification.

[0010] The present invention also provides primers for extending the potato high temperature inducible promoter pStHSP70, including a forward primer with a nucleotide sequence as shown in SEQ ID No.2 and a reverse primer with a nucleotide sequence as shown in SEQ ID No.3.

[0011] The present invention also provides a gene expression cassette, a recombinant expression vector, a recombinant bacterium and a transgenic plant cell line containing the potato high temperature inducible promoter pStHSP70, specifically:

[0012] 1) The gene expression cassette is composed of a potato high temperature inducible promoter pStHSP70, an exogenous target gene and a transcription termination sequence connected in a specific direction. In one embodiment of the present invention, the exogenous target gene is specifically a β-glucuronidase gene (GUS).

[0013] 2) The recombinant expression vector is a plant recombinant expression vector comprising the gene expression cassette described in 1). In one embodiment of the present invention, the expression vector is specifically pRC18.

[0014] 3) The recombinant bacteria are recombinant bacteria comprising the gene expression cassette described in 1).

[0015] 4) The transgenic plant cell line is a transgenic plant cell line comprising the gene expression cassette described in 1).

[0016] The present invention also provides the use of the gene expression cassette, recombinant expression vector, recombinant bacteria, and transgenic plant cell line containing the potato high temperature inducible promoter pStHSP70 in preparing transgenic plants. The transgenic plants of the present invention can be obtained by any known transgenic technology capable of introducing foreign genes into plant cells or plant tissues; in one embodiment of the present invention, the transgenic technology is Agrobacterium-mediated transformation.

[0017] The plant of the present invention may be a dicotyledon or a monocotyledon. In one embodiment of the present invention, the plant is Arabidopsis thaliana.

[0018] The present invention also provides the use of the potato high temperature inducible promoter pStHSP70 to induce the expression of a target gene at high temperature. In one embodiment of the present invention, the pStHSP70::pRC18 vector was transferred into the Agrobacterium strain GV3101, and the transformed Agrobacterium strain was transferred into the model plant Arabidopsis thaliana, proving that the promoter pStHSP70 can drive the expression of the target gene at a high temperature of 38°C.

[0019] The present invention also provides the use of the potato high temperature inducible promoter pStHSP70, gene expression cassette, recombinant expression vector and recombinant bacteria in cultivating high temperature resistant plant varieties.

[0020] Beneficial effects of the present invention: The present invention provides a potato high temperature inducible promoter pStHSP70, whose nucleotide sequence is shown in SEQ ID No. 1. The potato high temperature inducible promoter pStHSP70 has high temperature specific expression, and can be used as a specific promoter to drive the specific expression of the target gene under high temperature conditions, which can avoid the adverse effects of the continuous expression of the target gene in other tissues of the plant, and has a wide range of application value in the fields of plant genetic engineering and germplasm resource improvement. In addition, the potato high temperature inducible promoter pStHSP70 provided by the present invention can also be used for functional analysis and identification of plant heat resistance related genes, which helps to understand the molecular mechanism of plant resistance to high temperature stress. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 Schematic diagram of the construction of the recombinant expression vector pStHSP70-GUS of the high temperature inducible promoter pStHSP70.

[0022] Figure 2 This is the electrophoresis diagram of the cloned promoter pStHSP70.

[0023] Figure 3 These are the results of GUS staining of pStHSP70-GUS transgenic Arabidopsis seedlings under normal growth conditions and high temperature stress.

[0024] Figure 4 This is the result graph of GUS gene expression level in pStHSP70-GUS transgenic Arabidopsis seedlings under normal growth conditions and high temperature stress treatment.

[0025] Figure 5 This is a quantitative detection diagram of GUS activity in pStHSP70-GUS transgenic Arabidopsis seedlings under normal growth conditions and high temperature stress. DETAILED DESCRIPTION

[0026] The present invention is further described below in conjunction with the accompanying drawings and examples. The following examples are only used to illustrate the present invention and should not be construed as limiting the present invention; the experimental methods in the following examples, unless otherwise specified, are all conventional methods; the materials, reagents and instruments used in the following examples, unless otherwise specified, are all commercially available products; in the following examples, unless otherwise specified, the first position of each nucleotide sequence in the sequence table is the 5' terminal nucleotide of the corresponding DNA, and the last position is the 3' terminal nucleotide of the corresponding DNA. Without departing from the spirit and essence of the present invention, modifications or substitutions made by those skilled in the art to the methods, steps or conditions of the present invention are all within the scope of the present invention.

[0027] The main strain used in the present invention is Escherichia coli Trelief TM5α, Agrobacterium strain GV3101, the expression vector used was pRC18 (kanamycin resistance), the vector came from the Chongqing Key Laboratory of Tuber Biology and Genetic Breeding. Primer synthesis and sequencing were completed by Sangon Biotech Co., Ltd.

[0028] Example 1: Obtaining potato high temperature inducible promoter pStHSP70

[0029] 1) Extraction of total genomic DNA from potato DM

[0030] Take about 0.1g of young potato leaves and place them in a 2mL sterile centrifuge tube with two steel balls; freeze them in liquid nitrogen for about 5 minutes and grind them in a 40Hz grinder. The sample was quickly ground into powder for 20 seconds; 600 μL of 2×CTAB extract preheated at 65°C (the extract and the reducing agent were mixed in a volume ratio of 500:1) was added; the centrifuge tube was placed in a 65°C water bath for 0.5 h, and the centrifuge tube was gently shaken every 10 minutes or so; the sample was taken out and cooled at room temperature for use, 500 μL of chloroform-isoamyl alcohol mixture (24:1) was added, the mixture was vigorously shaken and mixed, centrifuged at 12000 rpm for 10 minutes, and the supernatant was transferred to a new centrifuge tube; an equal volume of isopropanol was added to the supernatant, the mixture was mixed by inversion, and the mixture was placed at -20°C for precipitation for more than 30 minutes, centrifuged at 12000 rpm for 10 minutes, and the supernatant was discarded; the precipitate was washed once with 75% ethanol, centrifuged at 12000 rpm for 5 minutes, and the supernatant was discarded; the precipitate was naturally dried and dissolved in 50 μL of deionized water; it was stored at -20°C.

[0031] 2) Cloning of potato high temperature inducible promoter pStHSP70 and construction of expression vector

[0032] The promoter reference sequence 2 Kb upstream of the transcription start site of StHSP70 was obtained from http: / / spuddb.uga.edu / index.shtml, and the primers required for cloning pStHSP70 were further designed using snap gene software (the forward primer and reverse primer sequences were GCCAGTGCCAAGCTTGATCACATCTTAGCCATTAG (SEQ ID No. 2) and CCGGTACCTCTAGATTTTTAACTGAAAAATAGGTTTGG (SEQ ID No. 3), respectively, wherein in the forward primer, the sequence GCCAGTGCC is the upstream sequence of the fusion site of the vector pRC18, and the sequence AAGCTT is the HindIII restriction site; in the reverse primer, the sequence CCGGTACC is the downstream sequence of the fusion site of the vector pRC18, and the sequence TCTAGA is the XbaI restriction site). The potato DM genomic DNA obtained above was used as a template and PCR amplification was performed using the high-fidelity polymerase 2×KeyPo Master Mix (Dye Plus) of Nanjing Novozymes Biotech Co., Ltd.

[0033] a) PCR reaction system (50 μL):

[0034]

[0035] b) PCR reaction procedure:

[0036]

[0037] After amplification, 1% agarose gel electrophoresis was used to detect the target band ( Figure 2 ). The target fragment with a sequence length of about 2000 bp was purified and recovered using the TIANGEN Universal DNA Purification and Recovery Kit.

[0038] The pRC18 vector was double-digested with HindIII and XbaI, and the linear vector was obtained by gel recovery.

[0039] c) Enzyme digestion reaction system:

[0040]

[0041] The purified PCR target fragment and the restriction-cut linear vector were recombined using the ClonExpress MultiS One Step Cloning Kit of Nanjing Novozymes Biotechnology Co., Ltd.

[0042] d) Homologous recombination reaction system:

[0043]

[0044] Next, we used Trelief TM 5α Escherichia coli competent cells were used for Escherichia coli transformation experiments, and single clones were picked for colony PCR positive clone detection. The screened positive clones were sequenced for verification, and the correctly sequenced vector was named pStHSP70-GUS. The plasmid was further extracted using the Plasmid Miniprep Kit (ZP101) of Beijing Zhuangmeng International Biogene Technology Co., Ltd.

[0045] Example 2: Transformation of Arabidopsis thaliana with the recombinant expression vector pStHSP70-GUS

[0046] 1) Transform the recombinant expression vector pStHSP70-GUS into Agrobacterium

[0047] Agrobacterium competent cells GV3101 from Beijing Qingke Biotechnology Co., Ltd. were used for Agrobacterium transformation experiments. The specific steps are as follows: GV3101 competent cells were quickly inserted into ice, and after melting, 1 μg of plasmid was added; ice bath for 5 minutes, liquid nitrogen cold shock for 5 minutes, 37°C metal bath heat shock for 5 minutes, and ice bath for 5 minutes; 700 μL of YEB medium without antibiotics was added to a centrifuge tube in a clean bench, and after pipetting and mixing, it was revived at 28°C and 200 rpm for 2-3 hours; 200 μL of bacterial solution was aspirated and applied to YEB solid medium containing rifampicin (25 μg / mL) and kanamycin (50 μg / mL), and after inverted culture in a constant temperature incubator at 28°C for 2 days, positive clones were screened.

[0048] 2) Agrobacterium-mediated genetic transformation of Arabidopsis

[0049] Wild-type Arabidopsis thaliana was transformed by the inflorescence infiltration method, specifically: Agrobacterium containing the pStHSP70-GUS plasmid was activated in YEB liquid medium, cultured overnight at 28°C, 200-220rpm; the above bacterial solution was added to 50mL YEB liquid medium containing the corresponding antibiotics until the OD 600 =0.1, 28°C, 200-220rpm, culture until OD 600 = about 0.7; 5000rpm, 6min centrifugation to collect bacteria, discard the supernatant and resuspend Agrobacterium in the infection solution (containing 5g / 100mL sucrose and 50μL / 100mL SilwetL-77) according to the proportion; the pruned wild-type Arabidopsis inflorescence is completely immersed in the above Agrobacterium suspension for 10-20s, and after the infection is completed, it is cultured in the dark for 2d, and then transferred to normal light for continued cultivation until harvest.

[0050] Example 3: Screening and identification of pStHSP70-GUS transgenic Arabidopsis

[0051] Take the transgenic seeds obtained in Example 2 and stored by low temperature drying. Under a sterile environment, place an appropriate amount of seeds in a sterile 1.5mL centrifuge tube, add an appropriate volume of 75% alcohol for disinfection for 8min, pour out the alcohol, and wash with sterile water for 3 times. The sterilized seeds are evenly sown on a 1 / 2MS medium containing hygromycin (25μg / mL), and placed in 4℃ dark vernalization for 2d, and then cultured for 10-15d under the conditions of temperature 22℃, humidity 60%, light and dark alternation (lighting time 16h, dark time 8h). At this time, dark green, hypocotyl elongation, and normal true leaf growth of resistant seedlings can be seen, while yellow or white seedlings are non-resistant wild-type seedlings. The selected resistant seedlings are transplanted into a nutrient matrix (vermiculite: nutrient soil = 1:2, V / V) for continued cultivation. Young tissues of the screened T1 generation positive transgenic plants were taken, and genomic DNA was extracted for PCR detection. The forward primer sequence and reverse primer used for detection were TTCATAGGAGTTACGTCTCATGTC, SEQ ID No.4 and CGCGATCCAGACTGAATG, SEQ ID No.5, respectively. The results showed that all positive transgenic plants contained the target bands. After repeated screening, T2 generation plants and seeds were obtained, and the T2 generation seeds were further screened to finally obtain T3 generation homozygous plants for subsequent experiments.

[0052] Example 4: Identification of high temperature inducible activity of pStHSP70

[0053] 1) High temperature stress treatment

[0054] The sterilized T3 homozygous transgenic Arabidopsis and wild-type Arabidopsis seeds were sown on 1 / 2MS medium using the Arabidopsis sterilization method in Example 3, vernalized for 2 days in the dark at 4°C, and then cultured normally for 10 days. The treated group was then treated at 38°C for 3 hours, and the control group was kept in a 22°C incubator for growth.

[0055] 2) GUS histochemical staining analysis

[0056] The Arabidopsis seedlings of the treatment group and the control group were immersed in the substrate X-Gluc staining reaction solution, vacuumed for 5 minutes, and incubated in the dark at 37°C for 12 hours. The staining solution was removed, and then decolorized with 75% ethanol 2-3 times, and observed and photographed under a stereoscope. The results are shown in the figure. Under normal and high temperature induction conditions, the wild-type Arabidopsis could not be stained (no GUS gene expression). Under normal conditions, the pStHSP70-GUS transgenic Arabidopsis was not stained. After being treated at 38°C for 3 hours, the pStHSP70-GUS transgenic Arabidopsis showed dark blue, indicating that the promoter pStHSP70 was significantly induced by high temperature ( Figure 3 ).

[0057] 3) Analysis of GUS gene expression level

[0058] The RNA of Arabidopsis seedlings in the above-mentioned treatment group and control group was extracted using the FastPureUniversal Plant Total RNA Isolation Kit RC411-01 from Nanjing Novazon Biotech Co., Ltd., and then the reverse transcription kit of Yisheng Biotech (Shanghai) Co., Ltd. was used. Ⅲ1St Strand cDNA Synthesis SuperMix for qPCR (gDNA digester plus) was used for reverse transcription. The cDNA synthesized by reverse transcription was used as a template for specific PCR amplification of the GUS gene. The forward primer sequence and the reverse primer sequence were CGGTCAGTGGCAGTGAAGGG (SEQ ID No. 6) and CGAGGTACGGTACGGTAGGAGTTGG (SEQ ID No. 7), respectively. Three replicates were set for each sample, and the Ct values ​​of the samples were calculated using 2 -ΔΔCT The formula was used to calculate the data and analyze the relative expression of the target gene. The results showed that under high temperature stress, the expression level of the GUS gene regulated by the promoter pStHSP70 was significantly upregulated, indicating that the promoter pStHSP70 was significantly induced by high temperature ( Figure 4 ).

[0059] a) PCR reaction procedure:

[0060]

[0061] 4) Quantitative analysis of GUS enzyme activity

[0062] The sample to be tested was ground into powder in a pre-cooled mortar with liquid nitrogen, and its weight was accurately weighed; 1 mL of extract solution was added to every 100 mg of powder, and vortexed to mix it thoroughly; centrifuged at 12,000×g, 4°C for 10 min, aspirated the supernatant into a new centrifuge tube, and placed on ice for use; the protein concentration of each supernatant was determined according to the Bradford protein assay; 150 μL of supernatant was taken, 150 μL of preheated 4-MUG substrate solution was added, mixed, and incubated at 37°C for reaction; 100 μL of reaction solution was taken and added to 900 μL of reaction stop solution at 10 min and 20 min respectively; the fluorescence intensity was measured using a fluorescence microplate reader under the conditions of excitation wavelength 365 nm and emission wavelength 456 nm, and the concentration of 4-MU produced by each sample reaction was obtained through the 4-MU standard curve, and the GUS enzyme activity was calculated; each sample was repeated 3 times. The results showed that after 38℃ high temperature treatment for 3h, GUS activity increased significantly, indicating that the activity of pStHSP70 was significantly induced by high temperature stress treatment ( Figure 5 ).

[0063] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. All modifications, equivalent substitutions, improvements, etc. within the spirit and principles of the present invention should be included in the protection scope of the present invention.

Claims

1. A potato high temperature inducible promoter pStHSP70, the nucleotide sequence of which is shown in SEQ ID No.

1.

2. A method for cloning or isolating the potato high temperature inducible promoter pStHSP70 according to claim 1, characterized in that: The method comprises the following steps: using the primer pair of SEQ ID No. 2 and SEQ ID No. 3 to obtain the nucleotide sequence of the promoter pStHSP70 from the total genomic DNA of potato DM by PCR amplification.

3. Primers for extending the potato high temperature inducible promoter pStHSP70 according to claim 1, characterized in that: It comprises a forward primer with a nucleotide sequence as shown in SEQ ID No.2 and a reverse primer with a nucleotide sequence as shown in SEQ ID No.

3.

4. A gene expression cassette, a recombinant expression vector, a recombinant bacterium and a transgenic plant cell line containing the potato high temperature inducible promoter pStHSP70 according to claim 1, specifically: 1) The gene expression cassette is composed of a potato high temperature inducible promoter pStHSP70, an exogenous target gene and a transcription termination sequence connected in a specific direction; 2) the recombinant expression vector is a plant recombinant expression vector comprising the gene expression cassette described in 1); 3) The recombinant bacteria is a recombinant bacteria comprising the gene expression cassette described in 1); 4) The transgenic plant cell line is a transgenic plant cell line comprising the gene expression cassette described in 1).

5. The recombinant expression vector according to claim 4, characterized in that The expression vector of the recombinant expression vector is pRC18.

6. Use of the gene expression cassette, recombinant expression vector, recombinant bacteria, transgenic plant cell line according to claim 4, and the recombinant expression vector according to claim 5 in preparing transgenic plants.

7. Use of the potato high temperature inducible promoter pStHSP70 according to claim 1 to induce the expression of a target gene under high temperature.

8. Use of the potato high temperature inducible promoter pStHSP70 according to claim 1, the gene expression cassette according to claim 4, the recombinant expression vector according to claim 4, the recombinant bacteria according to claim 4, and the recombinant expression vector according to claim 5 in cultivating high temperature resistant plant varieties.

Images