A coconut strong promoter, plant expression vector and application

Abstract

The present invention discloses a coconut strong promoter, a plant expression vector and an application thereof, wherein the nucleotide sequence of the promoter is shown in SEQ ID NO. 1. Compared with known promoters, the promoter provided by the present invention can drive the efficient expression of related genes and is a strong promoter. The present invention also relates to a plant expression vector containing the strong promoter and an application thereof in initiating the expression of a target gene.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and particularly relates to a coconut strong promoter, a plant expression vector and applications. Background Art

[0002] coconut( Cocos nucifera L.) belongs to the palm family monocotyledonous plant and is an important economic forest in tropical areas. Coconut has a long life cycle. At present, some researchers have gradually improved the technology of tissue culture using embryos, anthers, ovaries and other tissues as explants, and the coconut transgenic technology system is also being constructed. Transgenic technology has achieved crop improvement by introducing specific genes or reducing the expression of endogenous genes. The main challenge of transgenic technology is to accurately regulate the expression of exogenous genes or endogenous genes. Suitable promoters are crucial to achieve the target expression pattern, but the number and types of promoters suitable for plant genetic transformation are still limited. The cauliflower mosaic virus 35S promoter is one of the most commonly used universal promoters. It can efficiently drive gene expression in many monocotyledonous and dicotyledonous plants, but its expression efficiency varies in different plants. There are some differences in the promoters of monocotyledonous and dicotyledonous plants in gene expression regulation. To effectively promote the construction of coconut transgenic system, it is very necessary to clone, identify and utilize coconut's own strong promoters.

[0003] Promoter sequences of monocots usually contain regions with high GC content, while promoters of dicots tend to have high AT content. The types and distribution of these elements may vary in different plants. Although there is some overlap in the common cis-acting elements in monocots and dicots, their specific functions and binding characteristics are different. Cloning the plant's own constitutive promoters, such as promoters of housekeeping genes such as actin and ubiquitin, to replace the cauliflower mosaic virus 35S promoter can more effectively drive the transcription of foreign genes in monocots. In coconut, screening and identifying stably expressed genes can lay the foundation for cloning and utilizing promoters with stable transcriptional activity. Summary of the invention

[0004] In view of the deficiencies in the prior art, the present invention provides a coconut strong promoter, a plant expression vector and applications.

[0005] The technical solution of the present invention mainly includes the following contents:

[0006] The invention provides a coconut strong promoter, and the nucleotide sequence of the promoter is shown as SEQ ID NO.1.

[0007] The invention further relates to a plant expression vector containing the strong promoter, which contains the coconut strong promoter.

[0008] Furthermore, the method for constructing the plant expression vector comprises the following steps:

[0009] (1) amplifying the coconut strong promoter fragment;

[0010] (2) Connecting the coconut strong promoter fragment to the linearized vector by homologous recombination to obtain the plant expression vector.

[0011] Furthermore, the linearized vector is obtained by digesting the pGreen II LUC vector with KpnI and HindIII, or by digesting the pCAMBIA1300-eGFP vector with HindIII and SalI.

[0012] The method for constructing the plant expression vector further comprises the following steps:

[0013] (1) using the primer sequences shown in SEQ ID NO.2 and SEQ ID NO.3, or using the primer sequences shown in SEQ ID NO.4 and SEQ ID NO.5 to amplify the coconut strong promoter fragment described in claim 1;

[0014] (2) connecting the coconut strong promoter fragment described in claim 1 with the linearized vector by homologous recombination to obtain the plant expression vector;

[0015] The linearized vector is obtained by digesting the pGreen II 0800 LUC vector with KpnI and HindIII, or by digesting the pCAMBIA1300-eGFP vector with HindIII and SalI.

[0016] On the other hand, the present invention also relates to the application of the coconut strong promoter, which is used to drive the expression of target genes.

[0017] Furthermore, the gene includes a LUC reporter gene or a GFP reporter gene.

[0018] Beneficial effects of the present invention:

[0019] The present invention discloses a coconut strong promoter, the nucleotide sequence of which is shown in SEQ ID NO. 1. Compared with the promoters known in the prior art, the coconut promoter provided by the present invention can strongly drive the efficient expression of related genes and has the characteristics of a strong promoter.

[0020] The present invention also relates to the application of the promoter, for example, it can be used to start the expression of the reporter gene, so as to facilitate researchers to visually track and quantitatively analyze the spatiotemporal specificity of gene expression. By connecting the reporter gene (such as the green fluorescent protein gene GFP, etc.) with the coconut strong promoter to construct it into a plant expression vector, after transforming the plant cells, with the help of the efficient driving ability of the strong promoter, researchers can use equipment such as fluorescence microscopes to intuitively observe the expression position and intensity of the reporter gene in plant tissues, providing a strong basis for understanding the gene expression regulation mechanism.

[0021] In the process of cultivating transgenic plants with excellent traits, the target gene can be accurately and efficiently introduced into plant cells through the plant expression vector provided by the present invention, and the coconut strong promoter can be used to drive the expression of the target gene, so that the plant can obtain desired excellent traits such as disease and pest resistance, enhanced stress resistance, and improved quality, providing a powerful tool for agricultural production and plant science research. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 :Detection electrophoresis of CnMAC promoter connected to pCAMBIA1300-eGFP (A) and pGreen II 0800-LUC (B) vectors. pC1300-proF / R and pGreen II 0800-LUC-F / R represent the electrophoresis results after the promoter was connected to the vector, and MACpro-F / R represents the electrophoresis result of the promoter.

[0023] Figure 2 : Schematic diagram of pCnMAC and control plasmids and LUC signal diagram of transiently transformed tobacco. A) Schematic diagram of pCnMAC, pmiR156-7, pmiR156-5 and 35S driving LUC reporter gene; B) ~D) LUC signal detection results of pCnMAC::LUC and control plasmids.

[0024] Figure 3 : Schematic diagram of pCnMAC and control plasmids and GFP signal diagram of transiently transformed tobacco. A) Schematic diagram of pCnMAC and 35S driving eGFP reporter gene; B) GFP signal of pCnMAC::eGFP transiently transformed tobacco; C) GFP signal detection results of pCnMAC::eGFP and 35S::eGFP. DETAILED DESCRIPTION

[0025] In order to better understand the technical content of the present invention, the present invention is further described below in conjunction with specific embodiments and drawings.

[0026] 1. Determination of strong promoters in coconut

[0027] By analyzing the coconut genome sequence information, the following CnMAC promoter sequence (SEQ ID NO.1) was obtained:

[0028]

[0029] 2. Cloning of coconut CnMAC promoter and construction of plant expression vector

[0030] (1) Construction of recombinant vector pCnMAC-LUC

[0031] Primers pLUC-MAC-F and pLUC-MAC-R (with homologous sequences at the ends of the vector introduced at the 5' end) were designed to amplify the CnMAC promoter fragment (with homologous sequences corresponding to the ends of the vector added at both ends). The pGreenII 0800 LUC vector (commercially available vector) was digested with KpnI and HindIII, and the CnMAC promoter fragment was connected to the digested vector by homologous recombination to obtain the recombinant vector pCnMAC-LUC.

[0032] pLUC-MAC-F:

[0033] TCACTATAGGGCGAATTGGGTACCAACGGAACGCTATGGTGAA (SEQ ID NO.2)

[0034] pLUC-MAC-R:

[0035] CTGCAGGAATTCGATATCAAGCTTTCCTGACGACGGAAGAATG (SEQ ID NO.3)

[0036] (2) Construction of the recombinant vector pc1300-CnMACpro-eGFP

[0037] Primers pGFP-MAC-F and pGFP-MAC-R (with homologous sequences at the ends of the vector introduced at the 5' end) were designed to amplify the CnMAC promoter fragment (with homologous sequences corresponding to the ends of the vector added at both ends). The pCAMBIA1300-eGFP vector (commercially available vector) was digested with HindIII and SalI enzymes, and the promoter fragment was connected to the digested vector by homologous recombination to obtain the recombinant vector pc1300-CnMACpro-eGFP, which can be used for the subsequent construction of coconut transgenic expression vectors.

[0038] pGFP-MAC-F (SEQ ID NO.4):

[0039] GTAAAACGACGGCCAGTGCCAAGCTTAACGGAACGCTATGGTGAA

[0040] pGFP-MAC-R (SEQ ID NO.5):

[0041] The GGTACCAGATCTACTAGTGTCGACTCCTGACGACGGAAGAATG promoter sequence was amplified using the Novozymes high-fidelity enzyme C112, and the vector was constructed using the Uniclone One Step Seamless Cloning Kit from Jinsha Biotechnology.

[0042] (3) Construction of control plasmid

[0043] The corresponding pmiR156-5-LUC-F / R, pmiR156-7-LUC-F / R, and pLUC-35S-F / R (the 5' end introduced the homologous sequence at the end of the vector) were used to amplify the promoter fragment (the homologous sequence corresponding to the end of the vector was added at both ends). The pGreen II 0800 LUC vector was digested with KpnI and HindIII, and the promoter fragment was connected to the digested vector by homologous recombination to obtain the recombinant vectors pmiR156-5-LUC, pmiR156-7-LUC, and 35S-LUC. The promoter fragment (the homologous sequence corresponding to the end of the vector was added at both ends) was amplified using the pc1300-35S-eGFP-F / R primer (the 5' end introduced the homologous sequence at the end of the vector). The pCAMBIA1300-eGFP vector was digested with KpnI and HindIII, and the promoter fragment was connected to the digested vector by homologous recombination to obtain the recombinant vector pc1300-35S-eGFP.

[0044] 1) The amplification primers and promoter sequences of pmiR156-5 are as follows:

[0045] pmiR156-5-LUC-F (SEQ ID NO.6): TCACTATAGGGCGAATTGGGTACCAGGGAAAAACCGAACAAAAGG

[0046] pmiR156-5-LUC-R (SEQ ID NO.7): CTGCAGGAATTCGATATCAAGCTTTTGGCCCCAACGGAATAC

[0047] pmiR156-5 promoter sequence (SEQ ID NO.8):

[0048]

[0049] 2) The amplification primers and promoter sequences of pmiR156-7 are as follows:

[0050] pmiR156-7-LUC-F (SEQ ID NO.9): TCACTATAGGGCGAATTGGGTACCACATCTGATGCAGCCGCTAT

[0051] pmiR156-7-LUC-R (SEQ ID NO.10): CTGCAGGAATTCGATATCAAGCTTAAAGCCTCTTGATGCTTGTGTA

[0052] pmiR156-7 promoter sequence (SEQ ID NO.11):

[0053]

[0054] 2) The amplification primers and promoter sequences of 35S are as follows:

[0055] pLUC-35S-F (SEQ ID NO.12): TCACTATAGGGCGAATTGGGTACCACCCCCCTACTCCAAAAATG

[0056] pLUC-35S-R (SEQ ID NO.13): CTGCAGGAATTCGATATCAAGCTTAGCTGGGCTGTCCTCTCC

[0057] pc1300-35S-eGFP-F (SEQ ID NO.14):

[0058] AAAACGACGGCCAGTGCCAAGCTTACCCCCCTACTCCAAAAATG

[0059] pc1300-35S-eGFP-R (SEQ ID NO.15): CTTGCTCACCATGGATCCGGTACCAGCTTGGGCTGTCCTCTCC

[0060] 35S promoter sequence (SEQ ID NO.16):

[0061] ACCCCTACTCCAAAAATGTCAAAGATACAGTCTCAGAAGACCAAAGGGCTATTGAGACTTTTCAACAAAGGGTAATTTCGGGAAACCTCCTCGGATTCCATTGCCCAGCTACTGTCACTTCATCGAAAGGACAGTAGAAAAGGAAGGTGGCTCCTACAAATGCCATCATTGCGATAAAGGAAAGGCTATCATTCAAGATG CCTCTGCCGACAGTGGTCCCAAAGATGGACCCCCACCCACGAGGAGCATCGTGGAAAAAGAAGACGTTCCAACCACGTCTTCAAAGCAAGTGGATTGATGTGACATCTCCACTGACGTAAGGGATGACGCACAATCCCACTATCCTTCGCAAGACCCTTCCTCTATAAGGAAGTTCATTTCATTTGGAGAGGACAGCCCA

[0062] 3. Detection of transcriptional activity of coconut CnMAC promoter

[0063] The constructed pCnMAC-LUC / pc1300-CnMACpro-eGFP and control plasmids pmiR156-5-LUC, pmiR156-7-LUC, and 35S-LUC / pc1300-35S-eGFP were heat-shock transformed into GV3101 (pSoup-p19) Agrobacterium competent cells. After selecting a single colony, continue to culture at 28°C shaking for 1-2 days, perform PCR verification with promoter primers, and select positive clones for expansion culture. The positive bacteria after overnight shaking were adjusted with infection solution (10mM MgCl2, 10mM MES, 150µM acetosyringone) to adjust the OD value, and adjust the OD 600 =1.0. Then place it in a shaker at room temperature and shake slowly for 3 h to activate the bacteria. Select tobacco leaves that have grown for 3 to 4 weeks, inject the activated bacterial solution into the leaves with a 1 ml needle-free syringe, culture them in the dark for 24 h, and culture them in the light for 24 h, and detect the reporter gene LUC and fluorescent protein GFP signals.

[0064] LUC signal detection process: Cut the tobacco leaves injected with bacterial solution, evenly apply D-luciferin substrate to the back of the leaves, react in the dark for 3-5 minutes, observe the fluorescence signal and take pictures using the plant living imaging system. The GFP signal is detected using a handheld UV lamp 3260RB for observation and photography.

[0065] Note: MES is 2-morpholineethanesulfonic acid

[0066] Experimental Results

[0067] (1) Construction of LUC and GFP expression vector driven by CnMAC promoter

[0068] The target sequence was amplified using the promoter amplification primers of CnMAC. After the pGreen II 0800 LUC vector and pCAMBIA1300-eGFP vector were linearized using the corresponding enzymes, 5ul of homologous recombination reaction system was used for the ligation reaction of the target sequence. The positive clones were detected using the flanking primers at the vector insertion position and the promoter amplification primers ( Figure 1 ). The correct clones were saved after verification by sequencing.

[0069] (2) Detection of MAC promoter transcriptional activity

[0070] The correct clones were transformed into GV3101 and transiently expressed by injecting tobacco. The transcriptional activity of the CnMAC promoter was higher than that of the 35S promoter and much higher than that of other control promoters ( Figure 2 ).

[0071] The correct clones were transformed into GV3101 and transiently expressed by injecting tobacco. The GFP signal was used to detect that the CnMAC promoter had very high transcriptional activity, which was higher than that of the 35S promoter and was a strong promoter ( Figure 3 ).

[0072] (3) Plant expression vector driven by CnMAC promoter

[0073] The plant binary expression plasmid pc1300-CnMACpro-eGFP was successfully constructed, with pCAMBIA1300 as the backbone plasmid and eGFP as the reporter gene.

[0074] The above descriptions are only some embodiments of the present invention and are not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principles of the present invention shall fall within the protection scope of the present invention.

Claims

1. A coconut strong promoter, characterized in that, The nucleotide sequence of the promoter is shown in SEQ ID NO.

1.

2. A plant expression vector, characterized in that: Contains the coconut strong promoter according to claim 1.

3. The method for constructing a plant expression vector according to claim 2, characterized in that: The following steps are involved: (1) amplifying the coconut strong promoter fragment described in claim 1; (2) Connecting the coconut strong promoter fragment described in step (1) to the linearized vector to obtain the plant expression vector.

4. The method for constructing a plant expression vector according to claim 3, characterized in that: The linearized vector is obtained by digesting the pGreen II 0800 LUC vector with KpnI and HindIII, or by digesting the pCAMBIA1300-eGFP vector with HindIII and SalI.

5. The method for constructing a plant expression vector according to claim 3, characterized in that: The following steps are involved: (1) using the primer sequences shown in SEQ ID NO.2 and SEQ ID NO.3, or using the primer sequences shown in SEQ ID NO.4 and SEQ ID NO.5 to amplify the coconut strong promoter fragment described in claim 1; (2) connecting the coconut strong promoter fragment described in step (1) with the linearized vector by homologous recombination to obtain the plant expression vector; The linearized vector is obtained by digesting the pGreen II 0800 LUC vector with KpnI and HindIII, or by digesting the pCAMBIA1300-eGFP vector with HindIII and SalI.

6. The application of the coconut strong promoter according to claim 1, characterized in that: The application is to drive the expression of target gene.

7. The use according to claim 6, characterized in that: The gene includes a LUC reporter gene or a GFP reporter gene.

Images