Construction method of double-labeled cells based on firefly luciferase
By coupling fluorescent protein and luciferase in cells to construct dual-labeled cells, the problem of fluorescence signal attenuation of single-labeled cells is solved, and the combination of static and dynamic detection is achieved, which improves the qualitative and quantitative analysis capabilities of cell changes.
Patent Information
- Application Number
- CN202411759527.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-12-03
- Publication Date
- 2025-03-07
AI Technical Summary
In the prior art, the fluorescence signal of a single label reporter cell rapidly decays during cell division, making it difficult to accurately quantify the changes in cell counts, and there is a lack of detection methods in both static and dynamic dimensions.
Dual labeled cells based on firefly luciferase were constructed by designing the addition of Puromycin, P2A and T2A sequences between the DNA sequence of tdTomato fluorescent protein and the firefly luciferase, so that their expression ratio was 1:1, and cloned into a lentiviral vector by homologous recombination.
The detection combination of static and dynamic dimensions is achieved, which can not only efficiently and sensitively characterize changes in cell viability, but also dynamically monitor changes in cell count in real time, which is conducive to comprehensive qualitative and quantitative analysis.
Smart Images
Figure CN119570861A_ABST
Abstract
Description
Technical Field
[0001] The invention belongs to the technical field of biomedicine, and in particular relates to a method for constructing double-labeled cells based on firefly luciferase. Background Art
[0002] Luciferase is a general term for enzymes that catalyze luciferin to produce bioluminescence. The most common types of luciferases are from fireflies and sea renillas, named F-Luciferase and R-Luciferase respectively. Luciferase produces fluorescence by catalyzing specific substrates, and the emitted photons can be detected by light-sensitive elements such as fluorescence detectors or improved optical microscopes, which makes it possible to observe a variety of life activities. It can also be used in molecular biology research to detect the transcription of specific promoters in cells transfected with luciferase or to detect the level of ATP in cells. This technology is called reporter gene assay or luciferase assay, which can continuously monitor and quantitatively analyze the growth of living tissues.
[0003] Fluorescent protein is the most commonly used tool in molecular biology experiments, and is usually used to detect various biological processes in cells. The first fluorescent protein discovered was the green fluorescent protein GFP. Later, scientists discovered enhanced green fluorescent protein EGFP and many other fluorescent proteins, such as green fluorescent pHluorin, yellow fluorescent EYFP, blue fluorescent EBFP, cyan fluorescent ECFP and red fluorescent protein tdTomato. Fluorescent protein is a visual coding protein that does not require any substrate assistance, but can emit light at a specific wavelength. It is also easy to detect, so it is widely used in molecular biology research in animal and plant cells and fungi.
[0004] In the prior art, by constructing labeled reporter cells, the qualitative and quantitative detection of cells and behavioral monitoring are completed by detecting fluorescent signals. However, the existing single-labeled reporter cells are constructed with luciferase or fluorescent protein. Luciferase can characterize changes in cell viability very sensitively and efficiently. Although some fluorescent dyes are provided on the market to facilitate the labeling of cells, these signals will show rapid fluorescence signal attenuation during cell division, which is not conducive to accurate quantification of changes in cell number. On the contrary, fluorescent proteins provide homogeneous intracellular fluorescent signals to facilitate real-time dynamic monitoring of cell number changes, providing a method for panoramic understanding of cell number changes during the entire monitoring cycle. Based on the advantages of the two, coupling the two can better detect cell changes from both static and dynamic dimensions.
[0005] Therefore, there is an urgent need in the art for a method to construct dual-labeled cells based on firefly luciferase, which couples luciferase and fluorescent protein to use a detection method that combines static and dynamic dimensions, which can not only efficiently and sensitively characterize changes in cell viability, but also dynamically monitor changes in cell number in real time, allowing for more comprehensive qualitative and quantitative analysis. Summary of the invention
[0006] In order to solve the above technical problems, the present invention provides a method for constructing double-labeled cells based on firefly luciferase, characterized in that it comprises the following steps:
[0007] Step 1, sequence design: add Puromycin sequence, P2A sequence and T2A sequence between the DNA sequences of tdTomato fluorescent protein and firefly luciferase to make the expression ratio of firefly luciferase and tdTomato fluorescent protein 1:1, then perform codon optimization to construct tdTomato-P2A-Puro-T2A-fLuc sequence;
[0008] Step 2, designing PCR primers, cloning the tdTomato-P2A-Puro-T2A-fLuc sequence into a lentiviral vector by homologous recombination, wherein the nucleotide sequence of the upstream primer is as shown in SEQ ID NO: 1, and the nucleotide sequence of the downstream primer is as shown in SEQ ID NO: 2;
[0009] Step 3: Transform the recombinant lentiviral vector into host cells for culture, then pick colonies for expansion and sequencing;
[0010] Step 4: After the monoclonal strain with correct sequencing is expanded and cultured, plasmids are extracted to obtain the tdTomato-P2A-Puro-T2A-fLuc expression plasmid;
[0011] Step 5: Use a four-plasmid system to package lentivirus in HEK-293T cells;
[0012] Step 6: Infect cells with the lentivirus packaged in step 5, and screen with antibiotics after infection to obtain double-labeled cells based on firefly luciferase.
[0013] Specifically, in step 2, the lentiviral vector is pSF-Genome-SFFV-EGFP-KanR plasmid.
[0014] Specifically, in step 2, the homologous recombination method includes the following steps:
[0015] PCR amplification of the tdTomato-P2A-Puro-T2A-fLuc sequence was performed using PCR primers;
[0016] The lentiviral vector is double-digested with restriction endonucleases, and the DNA fragments after digestion are subjected to DNA gel electrophoresis, and the target fragments are cut and recovered according to the molecular weight;
[0017] The recovered vector fragment and the PCR amplification product are mixed and then the homologous recombinase is added for incubation.
[0018] Specifically, the restriction endonucleases are BstEII and SalI.
[0019] Specifically, the incubation condition is incubation at 37° C. for 1 hour.
[0020] Specifically, in step 3, the host cell is Stbl3 Escherichia coli.
[0021] Specifically, in step 5, the four-plasmid system also includes pALD-Rev-KanR plasmid, pALD-VSV-G-KanR plasmid and pALD-GagPol-KanR plasmid.
[0022] Specifically, in step 6, the cells refer to Raji cells.
[0023] Specifically, in step 6, the screening using antibiotics means that positive clones are screened using antibiotics 3 days after infection, and the screening time is 3 days.
[0024] Specifically, the amino acid sequence of the tdTomato fluorescent protein is as shown in SEQ ID NO:3 or has at least 70%, 80%, or 90% identity thereto, the amino acid sequence of the Puromycin sequence is as shown in SEQ ID NO:4 or has at least 70%, 80%, or 90% identity thereto, and the amino acid sequence of the firefly luciferase is as shown in SEQ ID NO:5 or has at least 70%, 80%, or 90% identity thereto.
[0025] Compared with the prior art, the present invention has the following beneficial effects:
[0026] Firefly luciferase can sensitively and efficiently characterize changes in cell viability, while fluorescent protein can provide a homogeneous intensity of intracellular fluorescence signals, thereby facilitating real-time dynamic monitoring of changes in cell number. The method provided by the present invention couples the red fluorescent protein tdTomato, the resistance gene and the firefly luciferase fLuc through P2A and T2A, respectively, thereby realizing the combination of static and dynamic detection. It can not only efficiently and sensitively characterize changes in cell viability, but also dynamically monitor changes in cell number in real time, facilitating comprehensive qualitative and quantitative analysis. BRIEF DESCRIPTION OF THE DRAWINGS
[0027] Figure 1 This is a schematic diagram of the structure of the tdTomato-P2A-Puro-T2A-fLuc expression plasmid provided by the present invention.
[0028] Figure 2 This is a graph showing the results of detecting the proportion of tdTomato-positive cells using the flow cytometer Attune NxT.
[0029] Figure 3 This is a graph showing the detection results of tdTomato fluorescence intensity using a fluorescence microscope.
[0030] Figure 4 This is a graph showing the results of detecting fLuc activity using the Envision microplate reader.
[0031] Figure 5 This figure shows the results of using IncuCyte to monitor cell growth in real time using the fluorescent protein tdTomato. DETAILED DESCRIPTION
[0032] The technical solution of the present invention will be described clearly and completely below. Obviously, the described embodiments are part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.
[0033] Unless otherwise specified, the experimental materials involved in the present invention are all commercial reagents and can be obtained from commercial channels.
[0034] Example 1
[0035] Please refer to Figure 1 According to the method for constructing double-labeled cells based on firefly luciferase provided by the present invention, this embodiment shows a specific implementation process:
[0036] 1. Design tdTomato-P2A-Puro-T2A-fLuc sequence:
[0037] a) Search for the DNA sequences of tdTomato, puromycin and fLuc from addgene, and add P2A sequence and T2A sequence between the two genes to make the expression ratio of the two 1:1, and then perform codon optimization in the online database (https: / / climsprod.genewiz.com.cn / Toolbox / CodonOptimization) to improve the richness of protein expression.
[0038] b) Send the designed sequence to Suzhou Genewise Biotechnology Co., Ltd. and entrust the processing and synthesis of the tdTomato-P2A-Puro-T2A-fLuc sequence.
[0039] 2. Use the pSF-Genome-SFFV-EGFP-KanR plasmid purchased from Oxgene to clone the synthesized tdTomato-P2A-Puro-T2A-fLuc sequence into the expression vector by homologous recombination:
[0040] a) Design PCR primers to perform PCR amplification on the synthesized tdTomato-P2A-Puro-T2A-fLuc sequence, and the PCR primers are as follows:
[0041] Forward primer (5'-3'): GGGCCAAGAACAGATGGTCACCGCAGTTTCGGCCCCGGCC (SEQ ID NO: 1)
[0042] Reverse primer (5'-3'): ATCCAGAGGTTGATTGTCGACTCAGTCAGTCAAGCTAGCAGAGGC (SEQ ID NO: 2).
[0043] b) The pSF-Genome-SFFV-EGFP-KanR plasmid was double-digested with restriction endonucleases BstEII and SalI, and the DNA fragments after digestion were subjected to DNA gel electrophoresis, and the target fragments were cut and recovered according to the molecular weight.
[0044] c) The vector fragment recovered from gel excision and the tdTomato-P2A-Puro-T2A-fLuc fragment amplified by PCR were mixed, and homologous recombinase was added, and incubated at 37° C. for 1 hour.
[0045] 3. Host cell transformation:
[0046] a) Take the Stbl3 competent cells out of the -80°C freezer and immediately place them on ice to allow them to thaw naturally.
[0047] b) Add the plasmid with successful homologous recombination to the thawed Stbl3 competent cells and incubate on ice for 30 minutes.
[0048] c) Place the incubated Stbl3 competent cells in a 42° C. water bath and incubate for 1 minute.
[0049] d) Place the Stbl3 competent cells on ice again for 5 minutes.
[0050] e) Add 1 mL of LB liquid medium and incubate at 37°C in a shaker for 1 hour.
[0051] f) Centrifuge at 4000 rpm for 5 minutes, remove the supernatant and resuspend the precipitate in 100 μL of liquid LB medium.
[0052] g) The resuspended Stbl3 competent cells were evenly spread on a kanamycin-resistant LB plate.
[0053] h) Place the plate in a 37°C incubator for overnight culture.
[0054] 4. Pick colonies for expansion and sequencing:
[0055] a) Single clones were picked into liquid LB medium containing kanamycin resistance.
[0056] b) Culture in a 37°C incubator overnight.
[0057] c) The bacterial culture was sent to Suzhou Genewise Biotechnology Co., Ltd. for Sanger sequencing.
[0058] 5. Expand the culture of the correctly sequenced monoclonal strain:
[0059] a) After obtaining the sequencing sequence, the original sequence was set as the reference sequence, and the sequenced ab.1 file was imported into the Snapgene software for sequence alignment.
[0060] b) Compare the peak pattern of sequencing and expand the culture of the monoclonal bacterial solution that completely matches the reference sequence again.
[0061] 6. Use the endotoxin-free plasmid extraction kit to extract the tdTomato-P2A-Puro-T2A-fLuc expression plasmid:
[0062] a) Centrifuge at 4500-6000 rpm, discard the supernatant and harvest the bacterial liquid.
[0063] b) Add 8 mL of RES buffer and pipette the bacterial solution evenly.
[0064] c) Add 8 mL of LYS buffer and gently invert to mix.
[0065] d) Add 8 mL of NEU buffer and mix by inversion until the liquid completely turns into a white precipitate.
[0066] e) Add the precipitate to the filter column which has been rinsed with 15 mL of EQU in advance.
[0067] f) Rinse the filter column with 5 mL of FIL buffer and discard the filter paper in the filter column after filtration.
[0068] g) Add 35 mL of ENDO buffer to wash the filter column again.
[0069] h) Add 15 mL of WASH buffer to wash the filter column.
[0070] i) Add 5 mL of ELU buffer and collect the filtrate in a 15 mL centrifuge tube.
[0071] j) 0.7 volumes of isopropanol were added, and the mixture was then filtered using an adsorption column.
[0072] k) The adsorption column was washed with 70% ethanol and then dried in a sterile biosafety cabinet.
[0073] l) Elute the plasmid into a 1.5 mL EP tube using sterile H2O.
[0074] 7. Lentiviral packaging using a four-plasmid system in HEK-293T cells:
[0075] a) Inoculate 6.0E+6 HEK-293T cells in a 100 mm culture dish and culture at 37°C overnight. The cell density will reach about 80% on the next day.
[0076] b) 3.75 μg of tdTomato-P2A-Puro-T2A-fLuc expression plasmid and 8.25 μg of helper plasmids (3 μg of pALD-VSV-G-KanR, 1.5 μg of pALD-Rev-KanR and 3.75 μg of pALD-GagPol-KanR) were diluted with 1.5 mL of OPTI-MEM.
[0077] c) Dilute 30 μL Lipofectamine 2000 with 1.5 mL OPTI-MEM.
[0078] d) After 5 minutes, mix the two together and let them stand at room temperature for 20 minutes.
[0079] e) Finally, the mixture was added dropwise to the cell supernatant and the cells were cultured in a 37°C incubator.
[0080] f) After overnight incubation, the culture medium was replaced with fresh medium.
[0081] 8. Concentrate the lentivirus. The concentrated lentivirus can be stored in a -80℃ ultra-low temperature refrigerator for future use, or can be directly used for the next step of screening:
[0082] a) Three days after transfection, the cell culture supernatant was collected into a centrifuge tube and centrifuged at 2000 rpm for 10 minutes.
[0083] b) The supernatant after centrifugation was further filtered using a 0.45 μm filter to remove cell debris.
[0084] c) Transfer the viral supernatant to an ultracentrifuge tube, seal it, and place it in an ultracentrifuge cooled to 4°C in advance, and centrifuge at 80,000 g for 2 hours.
[0085] d) After ultracentrifugation, white precipitate can be seen at the bottom of the ultracentrifuge tube. Discard the supernatant and add 200 μL of serum-free medium, then place in a 4°C refrigerator overnight.
[0086] e) The next day, the dissolved virus was divided into aliquots and stored in a -80℃ refrigerator.
[0087] 9. Infect cells with different volumes of lentivirus and screen positive clones for 3 days using the antibiotic Puromycin 3 days after infection:
[0088] a) Take the virus out of the -80℃ freezer and place it on ice to thaw slowly.
[0089] b) The lentivirus was gradually added dropwise to the culture medium of Raji cells according to different volumes, and the grouping was as follows: the highest volume was 100 μL, 2-fold gradient dilution, and a total of 8 volume gradients.
[0090] c) Transfer the cells to a 37°C incubator and continue culturing.
[0091] 10. Detect the fLuc activity and tdTomato fluorescence intensity of the screened polyclonal cells:
[0092] a) 2E+4 Raji cells were seeded into 96-well plates, and then fLuc substrate was added. After incubation at room temperature for 5 minutes, the plate was read on an Envision microplate reader.
[0093] b) Use flow cytometer Attune NxT to detect the proportion of tdTomato positive cells. The test results are as follows Figure 2 shown.
[0094] c) Use a fluorescence microscope to detect the fluorescence intensity of tdTomato. The detection results are as follows: Figure 3 shown.
[0095] d) Envision was used to detect fLuc activity. The results were as follows Figure 4 shown.
[0096] according to Figure 2-4 It can be seen that the increase in the proportion of fluorescent protein tdTomato-positive cells and the enhancement in intensity can both achieve the effect of sensitively and efficiently characterizing changes in cell viability. This method realizes the combination of static and dynamic detection.
[0097] 11. Dynamically monitor cell proliferation of the screened polyclonal cells
[0098] a) 2E+4 Raji cells were seeded into a 96-well plate and placed in the IncuCyte instrument.
[0099] b) Set the red fluorescence detection mode, take photos every 4 hours to detect the red fluorescence intensity, and detect for a total of 48 hours
[0100] c) After the test, the dynamic changes of red fluorescence were analyzed using the software provided by the IncuCyte instrument, and the fluorescence intensity captured at time 0 was standardized.
[0101] d) Dynamic detection results of cell proliferation such as Figure 5 shown.
[0102] 12. Expand the appropriately labeled polyclonal cells and freeze them in liquid nitrogen for storage:
[0103] a) Collect polyclonal cell lines by centrifugation at 1000 rpm.
[0104] b) Remove the supernatant and resuspend in fetal bovine serum.
[0105] c) Prepare cells with FBS:DMSO at a ratio of 9:1 and place in cryopreservation tubes.
[0106] d) Transfer the cryovials to a -80°C freezer.
[0107] e) The next day, transfer the cryovials to liquid nitrogen for long-term storage and remove them for thawing and use next time.
[0108] In summary, the above embodiments are only preferred embodiments of the present invention and are not intended to limit the protection scope of the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principles of the present invention should be included in the protection scope of the present invention.
Claims
1. A method for constructing double-labeled cells based on firefly luciferase, characterized in that: The steps include: Step 1, sequence design: add Puromycin sequence, P2A sequence and T2A sequence between the DNA sequences of tdTomato fluorescent protein and firefly luciferase to make the expression ratio of firefly luciferase and tdTomato fluorescent protein 1:1, then perform codon optimization to construct tdTomato-P2A-Puro-T2A-fLuc sequence; Step 2, designing PCR primers, cloning the tdTomato-P2A-Puro-T2A-fLuc sequence into a lentiviral vector by homologous recombination, wherein the nucleotide sequence of the upstream primer is as shown in SEQ ID NO: 1, and the nucleotide sequence of the downstream primer is as shown in SEQ ID NO: 2; Step 3: Transform the recombinant lentiviral vector into host cells for culture, then pick colonies for expansion and sequencing; Step 4: After the monoclonal strain with correct sequencing is expanded and cultured, plasmids are extracted to obtain the tdTomato-P2A-Puro-T2A-fLuc expression plasmid; Step 5: Use a four-plasmid system to package lentivirus in HEK-293T cells; Step 6: Infect cells with the lentivirus packaged in step 5, and screen with antibiotics after infection to obtain double-labeled cells based on firefly luciferase.
2. The method for constructing double-labeled cells based on firefly luciferase according to claim 1, characterized in that: In step 2, the lentiviral vector is pSF-Genome-SFFV-EGFP-KanR plasmid.
3. The method for constructing double-labeled cells based on firefly luciferase according to claim 1, characterized in that: In step 2, the homologous recombination method includes the following steps: PCR amplification of the tdTomato-P2A-Puro-T2A-fLuc sequence was performed using PCR primers; The lentiviral vector is double-digested with restriction endonucleases, and the DNA fragments after digestion are subjected to DNA gel electrophoresis, and the target fragments are cut and recovered according to the molecular weight; The recovered vector fragment and the PCR amplification product are mixed and then the homologous recombinase is added for incubation.
4. The method for constructing double-labeled cells based on firefly luciferase according to claim 3, characterized in that: The restriction endonucleases are BstEII and SalI.
5. The method for constructing double-labeled cells based on firefly luciferase according to claim 3, characterized in that: The incubation condition is 1 hour at 37°C.
6. The method for constructing double-labeled cells based on firefly luciferase according to claim 1, characterized in that: In step 3, the host cell is Stbl3 Escherichia coli.
7. The method for constructing double-labeled cells based on firefly luciferase according to claim 1, characterized in that: In step 5, the four-plasmid system also includes pALD-Rev-KanR plasmid, pALD-VSV-G-KanR plasmid and pALD-GagPol-KanR plasmid.
8. The method for constructing double-labeled cells based on firefly luciferase according to claim 1, characterized in that: In step 6, the cells are Raji cells.
9. The method for constructing double-labeled cells based on firefly luciferase according to claim 1, characterized in that: In step 6, the screening using antibiotics means that positive clones are screened using antibiotics 3 days after infection, and the screening time is 3 days.
10. The method for constructing double-labeled cells based on firefly luciferase according to claim 1, characterized in that: The amino acid sequence of the tdTomato fluorescent protein is as shown in SEQ ID NO:3 or has at least 70%, 80%, or 90% identity thereto, the amino acid sequence of the Puromycin sequence is as shown in SEQ ID NO:4 or has at least 70%, 80%, or 90% identity thereto, and the amino acid sequence of the firefly luciferase is as shown in SEQ ID NO:5 or has at least 70%, 80%, or 90% identity thereto.