Application of CtCYP81D2 Gene in Increasing Quercetin Content of Safflower Varieties

Abstract

The present invention discloses the application of the CtCYP81D2 gene to increase the quercetin content of safflower varieties. This invention belongs to the field of biotechnology. The Jihong No. 1 safflower variety was mutagenized using cobalt-60 mutagenesis technology to obtain 42 genetically stable safflower lines. The quercetin content of different safflower varieties was compared and analyzed. RNA was extracted from safflower petals with different quercetin contents, and reverse-transcribed into cDNA. The expression levels of key enzyme genes in the safflower flavonoid biosynthesis pathway were analyzed. The results showed that in the high-quercetin-content M9 line, expression of the CtCYP81D2 gene in the cytochrome P450 oxidase was significantly upregulated. Studies have shown that transient silencing of the CtCYP81D2 gene significantly decreased quercetin content, while overexpression of the CtCYP81D2 gene significantly increased quercetin content. The invention can be used for the breeding and cultivation of safflowers with high quercetin content, as well as for the development of pharmaceuticals, cosmetics, and health foods.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and particularly relates to application of the CtCYP81D2 gene in increasing the quercetin content of safflower varieties. Background Art

[0002] Quercetin, a natural flavonoid found in a wide variety of plants, has attracted widespread attention for its remarkable biological activities. Studies have shown that quercetin possesses numerous health benefits, including antioxidant, anti-inflammatory, anti-tumor, and cardiovascular protection. Consequently, it is widely used in pharmaceuticals, health foods, and functional foods. In recent years, with increasing interest in healthy diets and natural therapies, market demand for quercetin-rich plant materials has continued to grow.

[0003] Safflower (Carthamus tinctorius L.), an important economic crop, not only has a long history of use in traditional Chinese medicine, but its petals are also rich in a variety of active ingredients, including pigments, fatty acids, and polyphenols. Quercetin is a key component of safflower. Safflower is not only used as a dye and food but also as a traditional Chinese medicine, boasting benefits such as promoting blood circulation, removing blood stasis, and detoxifying and reducing swelling. Therefore, increasing the quercetin content in safflower is crucial for enhancing its economic and medicinal value.

[0004] However, current research on quercetin in safflower still has some shortcomings. First, although some studies have explored the extraction methods of quercetin from safflower, systematic comparisons of quercetin content in different safflower varieties are still lacking. Second, in the breeding process of safflower, a systematic and standardized method for assessing quercetin content has not yet been established, which makes the cultivation and screening of new germplasm difficult. Finally, the quercetin content of existing safflower varieties is generally low, which cannot meet the market demand for high-quercetin plant materials.

[0005] Therefore, developing a new safflower breeding method, particularly an efficient screening and extraction technology for quercetin content, is particularly important. This invention aims to select quercetin-rich safflower varieties by optimizing extraction methods and liquid chromatography conditions, thereby achieving efficient utilization and increasing the value of safflower. This not only provides theoretical support for the industrialization of safflower, but also offers new perspectives and methods for research in related fields.

[0006] In summary, in response to the current demand for increasing the quercetin content in safflower and the shortcomings of existing technologies, the present invention proposes a new safflower breeding method, in order to provide strong support for the development of related industries. Summary of the Invention

[0007] The purpose of the present invention is to solve the above problems and provide the application of CtCYP81D2 gene in increasing the quercetin content of safflower varieties.

[0008] CtCYP81D2 gene, the base sequence of which is shown in SEQ ID NO.1 in the sequence listing;

[0009] A plant expression vector pGreenIISK-CtCYP81D2 is obtained by inserting the CtCYP81D2 gene into pGreenIISK.

[0010] The CtCYP81D2 gene is used to increase the quercetin content of safflower varieties.

[0011] The present invention provides the application of the CtCYP81D2 gene to increase the quercetin content of safflower varieties. Using cobalt-60 mutagenesis, the Jihong No. 1 safflower variety was mutated to obtain 42 genetically stable safflower lines. The quercetin content of different safflower varieties was compared and analyzed. RNA was extracted from petals of safflowers with different quercetin contents, and reverse-transcribed into cDNA. The expression levels of key enzyme genes in the safflower flavonoid biosynthesis pathway were analyzed. The results showed that in the high-quercetin-content M9 line, expression of the CtCYP81D2 gene, a cytochrome P450 oxidase, was significantly upregulated. Studies have shown that transient silencing of the CtCYP81D2 gene significantly decreased quercetin content, while overexpression of the CtCYP81D2 gene significantly increased quercetin content. This method can be used for the breeding and cultivation of safflowers with high quercetin content, as well as for the development of pharmaceuticals, cosmetics, and health foods. BRIEF DESCRIPTION OF THE DRAWINGS

[0012] Figure 1 HPLC determination results of quercetin standard;

[0013] Figure 2 HPLC determination results of quercetin content in M9 safflower strain;

[0014] Figure 3 HPLC determination results of quercetin content in M28 safflower strain;

[0015] Figure 4 Figure 1. Electrophoresis results of RNA extraction from safflower petals;

[0016] Figure 5 PCR electrophoresis of CtCYP81D2 gene;

[0017] Figure 6 The expression level of CtCYP81D2 in the two strains;

[0018] Figure 7 PCR identification of bacterial solution of plant expression vector of CtCYP81D2 gene;

[0019] Figure 8 Transient silencing of the safflower CtCYP81D2 gene and determination of quercetin content;

[0020] Figure 9 Transient overexpression of the safflower CtCYP81D2 gene and determination of quercetin content. DETAILED DESCRIPTION

[0021] Example 1 HPLC determination of quercetin content in safflower varieties

[0022] 1. Extraction Method

[0023] 1.1 Material Preparation

[0024] The safflower variety Jihong No. 1 was induced with cobalt-60 mutagenesis to obtain 42 genetically stable safflower lines. The quercetin content of 30 safflower varieties was determined by HPLC. 0.1 gram of safflower petals from each line were weighed and processed using a high-speed mill. 0.1 gram of safflower petals from each variety were weighed and processed.

[0025] 1.2 Grinding

[0026] Grind the safflower petals thoroughly to improve the extraction efficiency. The grinding degree should be based on the principle of ensuring the petals are fine and delicate, and use a high-speed grinding machine for processing.

[0027] 1.3 Solvent extraction

[0028] 90% methanol was used as the extraction solvent. The specific steps were as follows:

[0029] Add the ground safflower petals to a container and dilute to 10 mL with 90% methanol;

[0030] Ultrasonic extraction was performed at 55°C for 60 min and the ultrasonic power was set at 200 W.

[0031] After the extraction is completed, soak overnight to fully dissolve the active ingredients;

[0032] Concentrate the extract by rotary evaporation to 2 mL;

[0033] The extract was filtered through a 0.45 μm membrane filter to obtain the upper layer for subsequent liquid chromatography analysis.

[0034] 2. Liquid Chromatography Conditions

[0035] 2.1 Column selection

[0036] An Agilent XDB-C18 column (250 mm × 4.6 mm, 5 μm) was selected as the separation column, which is suitable for the separation of flavonoids such as quercetin.

[0037] 2.2 Mobile phase configuration

[0038] The mobile phase was composed of 0.4% formic acid (A) and methanol (B) in a ratio of 5:5 to improve the separation efficiency of quercetin.

[0039] 2.3 Testing conditions

[0040] Detection wavelength: 255 nm;

[0041] Flow rate: 1 mL / min;

[0042] Column temperature: 25℃.

[0043] The above conditions have been optimized through multiple experiments to ensure the effective separation and detection of quercetin content.

[0044] 3. HPLC Analysis of Quercetin Content

[0045] The quercetin content of 30 safflower varieties was determined by HPLC. The results showed that the quercetin content of the M9 strain was the highest, ranging from 0.2994 to 0.4572 mg / g, and the quercetin content of the M28 strain was the lowest, ranging from 0.081 to 0.091 mg / g (see Figure 1 、 2 , 3).

[0046] Example 2 Cloning of the CtCYP81D2 gene coding region sequence

[0047] 1. RNA extraction from safflower petals

[0048] 1) Wrap the forceps, mortar, pestle, and medicine spoon in tin foil and dry-heat sterilize them in a 180°C oven for 4 hours.

[0049] 2) Treat 1.5 mL centrifuge tubes and pipette tips with 0.1% DEPC water overnight, then autoclave at 120°C for 20 min, and dry in a 60°C oven until ready for use.

[0050] 3) Take approximately 100 mg of safflower petals, add liquid nitrogen and quickly grind into a fine powder. Divide into two 1.5 mL EP tubes, add 1 mL of RNAiso Plus to each tube, mix well, and let stand at room temperature for 5 minutes.

[0051] 4) Centrifuge at 12,000 rpm for 5 min at 4°C and transfer the supernatant to a new 1.5 mL centrifuge tube.

[0052] 5) Add chloroform (1 / 5 the volume of RNAiso Plus), shake, mix, and let stand at room temperature for 5 minutes;

[0053] 6) Centrifuge at 12,000 rpm for 15 min at 4°C and transfer the supernatant to a new 1.5 mL centrifuge tube.

[0054] 7) Add an equal volume of isopropanol to the supernatant, let stand at room temperature for 10 minutes, and centrifuge at 12,000 rpm for 10 minutes at 4°C.

[0055] 8) Discard the supernatant and take the precipitate. Add 1 mL of 75% ethanol to the precipitate and centrifuge at 12,000 rpm for 5 minutes at 4°C. Repeat this step once.

[0056] 9) Discard the supernatant and keep the precipitate, then air dry at room temperature;

[0057] 10) Redissolve RNA in RNA-Free water and store the extracted RNA at -80°C until use.

[0058] 11) The concentration of safflower total RNA samples was measured using a NanoDrop2000 ultra-micro spectrophotometer (purchased from Thermo Fisher Scientific).

[0059] 12) RNA purity was tested by 2% agarose gel electrophoresis. After electrophoresis, the gel was stained with nucleic acid dye and photographed on a UV gel imaging system. Figure 4 ,Depend on Figure 4 Two clear bands, 28S and 18S, are visible, with the 28S band being approximately twice as bright as the 18S band. This indicates that the RNA extraction is complete and free of degradation, and can meet the needs of subsequent experiments.

[0060] 2. Synthesis of first-strand cDNA

[0061] RNA was stored at -80°C and the RNA concentration was measured using nanogrop. The extracted RNA concentration was approximately 1000 ng / μl. Reverse transcription of cDNA was performed according to the reverse transcription kit's instructions. The reverse transcription reaction system is shown in Tables 1 and 2. The reverse-transcribed cDNA was stored at -20°C until needed.

[0062] Table 1 First round reverse transcription reaction system

[0063]

[0064] Perform the following reaction on a PCR instrument: 65°C for 5 min, then quickly cool on ice.

[0065] Table 2 Second round reverse transcription reaction system

[0066]

[0067] Reverse transcription reaction conditions

[0068] 42℃ 55min

[0069] 70℃ 10min

[0070] The cDNA was cooled on ice and used for subsequent reactions and stored at -20°C for future use.

[0071] 3. Cloning of the CtCYP81D2 gene coding region sequence

[0072] Our research group previously sequenced the whole genome of safflower and annotated the safflower CtCYP81D gene. Using safflower petal cDNA as a template, we designed specific primers based on the coding region sequence annotated in the genome for RT-PCR amplification. The designed cloning primers are as follows:

[0073] CtCYP81D2f: ATGTCCCTTCGCTTTGGCTCT

[0074] CtCYP81D2r:TTATAGCTCCTTAAGAAGATGACT

[0075] The cDNA obtained by reverse transcription of RNA from the petals of Jihong No. 1 safflower at full bloom was used as a template for amplification. The amplified product was ligated with the pEASY-T1 cloning vector (Beijing Quanshijin Biotechnology Co., Ltd.) and transformed into DH5α competent Escherichia coli. The results were analyzed by bacterial liquid PCR ( Figure 5 After verification, the DNA was sequenced and the results were correct. A 1323-bp full-length coding region sequence was obtained, named CtCYP81D2. Its base sequence is shown in the sequence listing as SEQ ID NO. 1, and its amino acid sequence is shown in the sequence listing as SEQ ID NO. 2.

[0076] Example 3 Expression Analysis of CtCYP81D2 Gene in Two Strains (M9 and M28)

[0077] Total RNA was extracted from the petals of two safflower lines, M9 and M28, and reverse transcribed to synthesize first-strand cDNA templates. Primers for fluorescent quantitative PCR of the CtCYP81D2 gene were designed using the online primer design website (http: / / www.primer3plus.com / cgi-bin / dev / primer3plus.cgi). Fluorescent quantitative PCR reactions were performed using the TB Green® Premix Ex Taq™ (TaKaRa) kit. The reaction system is shown in Table 3. Fluorescent quantification was performed using an Agilent Mx3000P instrument. Relative expression was measured using the 2 -△△CtThe results showed that the expression level of CtCYP81D2 gene in M9 strain was significantly higher than that in M28 strain (see Figure 6 ).

[0078] Table 3 qRT-PCR reaction system

[0079] Tab.3 qRT-PCR reaction system

[0080] Reagents Usage TB Green Premix Ex Taq (2×) 10 μL PCR Forward Primer (10 μM) 0.4 μL PCR Reverse Primer (10 μM) 0.4 μL ROX Reference Dye II (50X) 0.4 μL cDNA 1 μL <![CDATA[RNase Free dH2O]]> Up to 20 μL

[0081] The reaction procedure adopts Normal 2 step, as shown below:

[0082] .

[0083] Example 4 Construction of Plant Expression Vector of Carthamus tinctorius CtCYP81D2 Gene

[0084] The CtCYP81D2 coding region fragment containing homology arms with Xho I and Hind III restriction sites was amplified using TransStart® FastPfu Fly DNA Polymerase (Beijing Quanshijin Biotechnology Co., Ltd.), and the pTRV2 and pGreenIISK vectors were digested with Flashcut™ Xho I and Flashcut™ Hind III (Mona (Wuhan) Biotechnology Co., Ltd.) and purified using a DNA purification kit (Tiangen Biochemical Technology (Beijing) Co., Ltd.). The target fragment was ligated to the linearized vector using a single fragment seamless cloning kit (Mona (Wuhan) Biotechnology Co., Ltd.), and the ligation product was transformed into Escherichia coli DH5α competent cells. Transformants were screened using resistance plates containing kanamycin (50 mg / L), and single clones were selected and shaken for bacterial culture identification by PCR ( Figure 7 ), both showed the target bands, indicating that the expression vectors were successfully constructed and named pTRV2-CtCYP81D2 and pGreenIISK-CtCYP81D2.

[0085] Example 5 Transformation of Agrobacterium competent cells

[0086] The target gene is transformed into Agrobacterium using the freeze-thaw method. The process is as follows:

[0087] 1) Add 1µl of pTRV2-CtCYP81D2 or pGreenIISK-CtCYP81D2 plasmid DNA to 100µl of competent Agrobacterium EHA105 and refrigerate in liquid nitrogen for 5 minutes;

[0088] 2) Immediately place the cells in a 37°C water bath for 5 minutes.

[0089] 3) Add 1 ml of fresh YEP culture medium to the centrifuge tube and shake on a shaker at 28°C for 2-4 hours;

[0090] 4) Spread 50-100 μl of the transformed bacterial solution onto a solid LB plate containing 50 μg / ml kan and 100 μg / ml Rif. Incubate the plate in a 28°C incubator for 2-3 days to screen for transformants.

[0091] 5) Pick a single clone of bacteria and inoculate it into Agrobacterium liquid culture medium. Cultivate at 28°C until OD600≈0.8. Take 1 μl of the bacterial solution for PCR detection using the same method as above.

[0092] 6) The remaining bacterial solution was thoroughly mixed with glycerol at a ratio of 4:1 (V:V), quickly frozen in liquid nitrogen, and then stored at -80°C until use.

[0093] Example 6 Silencing of the Carthamus tinctorius CtCYP81D2 gene and determination of quercetin content

[0094] TRV1 and TRV2 are formed by modifying two strands of the originally complementary double-stranded RNA. Among them, TRV1 can enhance the replication and propagation of TRV2, playing an auxiliary role. When TRV1 and TRV2 are mixed, the partially complementary strands can form double-stranded RNA, which is more stable. The mixed double-stranded RNA can better replicate and propagate in plant cells, thereby achieving gene interference. Therefore, in the experiment, we usually use pTRV1 + pTRV2 as the control group and pTRV1 + pTRV2-target gene as the experimental group.

[0095] Agrobacterium containing the pTRV1, pTRV2, and pTRV2-CtCYP81D2 plasmids was cultured to an OD600 of 0.8-1.0, harvested by centrifugation at 5000 rpm, and resuspended in a buffer solution (10 mM MgCl2, 10 mM MES, 200 μM AS; pH 5.6) to an OD600 of 0.8. The pTRV1, pTRV2, and pTRV2-CtCYP81D2 Agrobacterium suspensions were mixed at a 1:1 ratio, incubated in the dark at 28°C for 3 h, and injected into leaves near the flower buds using a syringe. Safflower plants were grown in the dark for 1 day and then moved to a climatic chamber for 10 days. 0.1 g of petals from the injection sites of the control and experimental groups were extracted three times with 10x ethanol. The combined supernatants were concentrated under reduced pressure, brought to volume with 1 ml of ethanol, and filtered through a 0.22 μm filter for quercetin content. It was found that after transient silencing, the quercetin content decreased significantly ( Figure 8 ).

[0096] Example 7 Overexpression of Carthamus tinctorius CtCYP81D2 Gene and Determination of Quercetin Content

[0097] Agrobacterium containing pGreenIISK and pGreenIISK-CtCYP81D2 plasmids was cultured to OD600 = 0.8-1.0, and the cells were collected by centrifugation at 5000 rpm. The cells were resuspended in buffer (10 mM MgCl2, 10 mM MES, 200 μM AS; pH 5.6) to OD600 = 0.8 and incubated in the dark at 28°C for 3 hours for activation. The pGreenIISK and pGreenIISK-CtGRF5 Agrobacterium suspensions were injected into safflower buds and nearby leaves using a syringe. The safflower plants were grown in the dark for 1 day and then moved to an artificial climate chamber for 8 days. Quercetin was extracted from the injection site. It was found that after transient overexpression, the quercetin content was significantly increased ( Figure 9 ).

Claims

1. CtCYP81D2 gene, the base sequence of which is shown in the sequence listing SEQ ID NO.

1.

2. A plant expression vector pGreenIISK-CtCYP81D2, which is obtained by inserting the CtCYP81D2 gene according to claim 1 into pGreenIISK.

3. Use of the CtCYP81D2 gene according to claim 1 in increasing the quercetin content in safflower varieties.

Images