An engineered bacterium with high yield of the direct precursor of oritavancin and its application

Abstract

The present invention provides an engineered bacterium with a high yield of a direct precursor of oritavancin and its application. The high-yield engineered bacterium is Amycolatopsis orientalis, which knocks out the potential competitive biosynthesis pathway of the direct precursor of oritavancin (Chloroeremomycin) and highly expresses the rate-limiting enzyme gene of the direct precursor of oritavancin, thereby obtaining a high-yield bacterium of the direct precursor of oritavancin, and optimizes its fermentation process to increase the yield of the direct precursor of oritavancin to 3.1 times that of the starting bacterium, reaching 428 mg / L. The present invention combines the application of knocking out potential competitive metabolic pathways, enhancing the expression of rate-limiting enzymes and optimizing the fermentation process, successfully superimposing multiple high-yield strategies, greatly reducing the production cost of the direct precursor of oritavancin, and improving the biosynthesis efficiency of the direct precursor of oritavancin. This new strain has important application value in the industrial production of oritavancin.

Description

Technical Field

[0001] The present invention belongs to the field of pharmaceutical biotechnology and relates to an engineered bacterium with high yield of a direct precursor of oritavancin and application thereof. Background Art

[0002] In 2014, the U.S. FDA approved Oritavancin, developed by Medicines, for marketing under the trade name Orbactiv. It is a new generation of glycopeptide antibiotics after vancomycin.

[0003] Oritavancin is the first and only single-dose antibiotic for the treatment of acute bacterial skin and skin structure infections (ABSSSIs). It exerts its bactericidal effect by blocking transglycosylation during peptidoglycan biosynthesis, thereby inhibiting bacterial cell wall formation and leading to bacterial cell death. Furthermore, oritavancin exhibits strong antibacterial activity against vancomycin-resistant Staphylococci and Enterococci, thus effectively reducing the development of drug resistance.

[0004] Amycolatopsis orientalis, a strain producing chlororemomycin (also known as A82846B), the direct precursor of oritavancin, currently has a low fermentation unit. Therefore, using synthetic biology to rationally restructure its biosynthesis pathway to improve chlororemomycin fermentation has important application value for the industrialization of oritavancin. Summary of the Invention

[0005] The purpose of the present invention is to provide an engineered bacterium with a high yield of a direct precursor of oritavancin. The strain has been deposited in the General Microbiology Center of the China Culture Collection Administration Committee of Microorganisms, and is classified and named: Amycolatopsis orientalis AO-B, with a deposit number of CGMCC NO.29179 and a deposit date of 2023.11.30.

[0006] The engineered bacteria of the present invention are constructed by the following method:

[0007] Step (1): Purchase specific primers and use the genome of Amycolatopsis orientalis (CGMCC No. 21140, classification name: Amycolatopsis orientalis) as a template to amplify the upstream and downstream homologous arms SEQ ID NO. 1 and SEQ ID NO. 2 of the core gene orf5 (SEQ ID NO. 13) of the chlororemomycin anabolism potential competitive pathway gene cluster 4, and recover:

[0008] SEQ ID NO.1 Upstream primer SEQ ID NO.3 ctagagtcgacctgcagccccgtgagctggccgaaaccga

[0009] SEQ ID NO.1 Downstream primer SEQ ID NO.4cgatggcgaccgtggccgcaggacgaagtcgccgagcg

[0010] SEQ ID NO.2 Upstream primer SEQ ID NO.5 gcggccacggtcgccatcggggt

[0011] SEQ ID NO.2 Downstream primer SEQ ID NO.6ctcttccacctgctgaaagcttcggcgtctccgccttcttcgt

[0012] Step (2): The fragments of SEQ ID NO.1 and SEQ ID NO.2 recovered in step (1) were inserted into the HindIII restriction site of pSET153-aadA-neo (SEQ ID NO.7) by seamless cloning to obtain plasmid pSET153-aadA-neo-ECO-0501, and then verified;

[0013] Step (3): The plasmid obtained in step (2) is introduced into E. coli ET12567 / pUZ8002 by transfection;

[0014] Step (4): The plasmid in step (2) was transferred into Amycolatopsis orientalis CGMCC NO. 21140 by conjugation, single-crossover and double-crossover strains were screened, and the orf5 gene was knocked out by homologous exchange to obtain Amycolatopsis orientalis AO-A;

[0015] Step (5): Amplify the Chloroeremomycin glycosyltransferase gene evaE fragment (SEQ ID NO. 8) using the Amycolatopsis orientalis CGMCC NO. 21140 genome as a template and recover:

[0016] SEQ ID NO.8 Upstream primer SEQ ID NO.9 gggatacgcggtaccatgaagctgatcaccgtgctc

[0017] SEQ ID NO.8 Downstream primer SEQ ID NO.10catcttgttcaatcatcatatgtcatgcgcgagcctttcc

[0018] Step (6): The fragment recovered in step (5) and the promoter were inserted into the expression vector pIJ8660-aadA-neo (SEQ ID NO.11) to obtain the plasmid pIJ8660-aadA-neo-evaE. The promoter is a synthetic fragment and is a high-efficiency promoter P from Eggrethella lenta DSM2243. gapdh (SEQ ID NO.12), and verified;

[0019] Step (7): The plasmid obtained in step (6) was introduced into E. coli ET12567 / pUZ8002 by transfection to obtain E. coli ET12567 / pUZ8002 / pIJ8660-aadA-neo-evaE;

[0020] Step (8): The plasmid in step (6) was transferred into Amycolatopsis orientalis AO-A by conjugation via E. coli ET12567 / pUZ8002 / pIJ8660-aadA-neo-evaE to obtain Amycolatopsis orientalis AO-B;

[0021] Step (9): Fermentation and high performance liquid chromatography analysis revealed that the chlororemomycin fermentation yield of Amycolatopsis orientalis AO-B strain was 2.3 times that of CGMCC NO. 21140, reaching 322 mg / L.

[0022] Step (10): Optimization of culture medium components (Plackett-Burman design was used to screen the significant factors affecting the production of A82846B among the seven components of glucose, peptone, maltodextrin, NaCl, KCl, MgSO4 and KH2PO4; a three-factor three-level Box-Behnken design was used to further optimize the fermentation conditions; the effects of fermentation temperature, initial pH, seed age, inoculation size, culture medium volume and other conditions on the yield of A82846B were investigated through single-factor experiments. The ideal conditions were obtained: temperature 30°C, initial pH 6.5, seed age 72h, inoculation size 2%, culture medium volume 25mL), and the chloroemomycin fermentation yield of the strain Amycolatopsis orientalis AO-B (deposit number: CGMCC NO.29179, deposit date: 2023.11.30) reached 3.1 times that of CGMCC NO.21140, reaching 428mg / L.

[0023] Another object of the present invention is to provide the application of the engineered bacteria in the fermentation preparation of the direct precursor of oritavancin (Chloroeremomycin). The engineered bacteria of the present invention is Amycolatopsis orientalis, with a deposit number of CGMCC NO.21140. The core gene 4-guanidine synthetase gene orf5 of the potential competitive pathway, ECO-0501, is deleted, and the oritavancin direct precursor Chloroeremomycin glycosyltransferase evaE is highly expressed. After fermentation optimization, the high-yielding bacteria Amycolatopsis orientalis AO-B (deposit number: CGMCC NO.29179, deposit date: 2023.11.30) of Chloroeremomycin is obtained. This strain is cultured at 30 ° C in seed culture medium for 72 hours, then inoculated into GPM culture medium, and sampled for 168 hours after culture at 30 ° C. The chloroeremomycin in the fermentation broth can reach 3.1 times that of the starting strain, reaching 428 mg / L.

[0024] The advantages of the present invention are: (1) based on metabolic engineering means, the present invention eliminates the high expression of the rate-limiting synthase gene (evaE) through potential competitive pathways (knocks out orf5) and optimizes the fermentation process (using Plackett-Burman design to screen the significant factors affecting the generation of A82846B among the seven components of glucose, peptone, maltodextrin, NaCl, KCl, MgSO4 and KH2PO4; using three-factor three-level Box-Behnken design to further optimize the fermentation conditions; and investigating the effects of fermentation temperature, initial pH, seed age, inoculation amount, culture medium volume and other conditions on the yield of A82846B through single factor experiments. The ideal conditions were obtained: temperature 30°C, initial pH 6.5, seed age 72h, inoculation amount 2%, culture medium volume 25mL) combined superposition; with clear goals, the present invention positively combines and superimposes multiple high-yield strategies, and the incompatibility problem of each high-yield method does not occur. The superposition effect is significant, which provides a useful demonstration for the high-yield transformation of other glycopeptide antibiotics.

[0025] (2) The high-yield Chloroeremomycin direct precursor genetically engineered bacteria constructed in the present invention has a yield of 3.1 times that of the starting strain under the fermentation conditions of the present invention, reaching 428 mg / L, which greatly reduces the production cost of Chloroeremomycin, the direct precursor of oritavancin, and has important application value in the industrial production of Chloroeremomycin, the direct precursor of oritavancin. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] Figure 1 This is a map of the knockout plasmid pSET153-aadA-neo-ECO-0501.

[0027] Figure 2 This is a map of the expression plasmid pIJ8660-aadA-neo-evaE.

[0028] Figure 3 A histogram showing the chlororemomycin fermentation yield of the final engineered bacterium Amycolatopsis orientalis AO-B before and after fermentation process optimization and the starting strain Amycolatopsis orientalis (Accession No.: CGMCC NO.21140). DETAILED DESCRIPTION

[0029] The present invention is further described with reference to the accompanying drawings and examples. The experimental methods in the following examples are conventional methods unless otherwise specified. The materials and reagents used in the following examples are all commercially available unless otherwise specified.

[0030] The culture medium used in the examples is:

[0031] YMG solid medium: yeast extract 4.0 g, malt extract 10.0 g, glucose 4.0 g, agar 20.0 g, distilled water 1000 mL, pH 7.3.

[0032] LB liquid medium: peptone 10.0 g, yeast extract 5.0 g, NaCl 10 g, agar 20.0 g, distilled water 1000 mL, pH 7.3.

[0033] 2×YT liquid medium: 16.0 g peptone, 10.0 g yeast extract, 5 g NaCl, 20.0 g agar, 1000 mL distilled water, pH 7.3.

[0034] MS solid medium: mannitol 20 g, soybean powder 20 g, agarose 20 g, distilled water 1000 mL, pH 7.3.

[0035] Seed culture medium: peptone 20 g, NaCl 5 g, glucose 2.5 g, K2HPO4 2.5 g, distilled water 1000 mL, pH 7.3.

[0036] Fermentation medium: peptone 5 g, glucose 20 g, NaCl 1 g, KCl 0.5 g, MgSO4 0.8 g, KH2PO4 0.1 g, distilled water 1000 mL, pH 7.3.

[0037] GPM medium (glucose-peptone-maltodextrin medium); glucose 22 g, peptone 6 g, maltodextrin 12 g, NaCl 1 g, KCl 0.5 g, MgSO4 0.8 g, KH2PO4 0.1 g, distilled water 1000 mL, pH 7.3.

[0038] Example 1: Construction method of chlororemomycin high-producing bacteria

[0039] Step (1), construction of knockout vector pSET153-aadA-neo-ECO-0501

[0040] The knockout vector for orf5, the core gene of the potential competitive pathway gene cluster constructed in this example, is named pSET153-aadA-neo-ECO-0501. The vector contains the upstream and downstream homology arms of orf5, the core gene of the ECO-0501 gene cluster, such as Figure 1 As shown in the sequences SEQ ID NO.1, SEQ ID NO.2 and SEQ ID NO.7.

[0041] The construction method of pSET153-aadA-neo-ECO-0501 is as follows:

[0042] Specific primers were designed to amplify SEQ ID NO.1 and SEQ ID NO.2 using the genome of Amycolatopsis orientalis CGMCC NO.21140 as a template, and the sequences were recovered:

[0043] SEQ ID NO.1 Upstream primer SEQ ID NO.3 ctagagtcgacctgcagccccgtgagctggccgaaaccga

[0044] SEQ ID NO.1 Downstream primer SEQ ID NO.4cgatggcgaccgtggccgcaggacgaagtcgccgagcg

[0045] SEQ ID NO.2 Upstream primer SEQ ID NO.5 gcggccacggtcgccatcggggt

[0046] SEQ ID NO.2 Downstream primer SEQ ID NO.6ctcttccacctgctgaaagcttcggcgtctccgccttcttcgt

[0047] The fragments of SEQ ID NO.1 and SEQ ID NO.2 recovered in step (1) were ligated with the shuttle plasmid vector pSET153-aadA-neo digested with HindIII to obtain the recombinant expression vector pSET153-aadA-neo-ECO-0501. The plasmid map is as follows: Figure 1 .

[0048] Step (2) is to introduce the pSET153-aadA-neo-ECO-0501 expression vector into the starting bacterium Amycolatopsis orientalis CGMCC No. 21140 to obtain the genetically engineered bacterium Amycolatopsis orientalis AO-A. The specific method is as follows.

[0049] The pSET153-aadA-neo-ECO-0501 vector was transformed into demethylated E. coli ET1256 / pUZ8002 by heat shock at 42°C for 90 seconds.

[0050] The target plasmid pSET153-aadA-neo-ECO-0501 was transformed into E. coli ET12567 / pUZ8002 on LB plates containing the corresponding antibiotics (spectinomycin, kanamycin, chloramphenicol). Single colonies were picked and transferred to 5 mL of LB and cultured overnight at 37°C, 220 rpm. Then, the colonies were transferred to 15 mL of LB containing the corresponding antibiotics at a 2% ratio (expansion culture) and cultured until the OD 600 The cell density is approximately 0.4. Collect the cells by centrifugation at 6000 rpm for 5 minutes, wash them three times with 2 mL of LB, and resuspend them in 500 μL of LB medium to serve as the donor bacteria for conjugation transfer. Actinomycete hyphae serve as recipient bacteria and are cultured in TSB at 220 rpm at 28-30°C for approximately 48-60 hours. Collect 250 μL of mycelium by centrifugation at 6000 rpm for 5 minutes, wash them three times with 2×YT medium, and resuspend them in 500 μL of 2×YT medium to serve as the recipient bacteria. Mix the recipient and donor bacteria: Take 500 μL of the donor bacteria and 500 μL of the recipient bacteria, mix thoroughly (centrifuge at 6000 rpm, and use the remaining 500 μL of liquid to resuspend the cells). Spread the mixture onto MS medium (without antibiotics) containing 10 mM magnesium ions. After drying under a laminar flow hood, incubate in a 30°C incubator. After 16-20 hours of incubation, plates were coated with apramycin (final concentration of 200 μg / mL), kanamycin (final concentration of 50 μg / mL), and nalidixic acid (final concentration of 25 μg / mL). Culture was continued at 30°C for 4-5 days. Transformants were selected and subcultured on resistant YMG plates (final concentrations of 200 μg / mL apramycin and 50 μg / mL kanamycin). Culture was continued at 37°C for 7 days. Single colonies were selected for genome extraction and identification of single-crossover strains. The selected single-crossover strains were cultured for three generations. A kanamycin-sensitive strain was selected for genomic verification to identify the knockout strain, designated Amycolatopsis orientalis AO-A.

[0051] Example 2: Construction of Amycolatopsis orientalis AO-B

[0052] Step (1), construction of expression vector pIJ8660-aadA-neo-evaE

[0053] The expression vector for the glycosyltransferase, the rate-limiting enzyme in the biosynthesis of chlororemomycin, constructed in this example is named pIJ8660-aadA-neo-evaE. The vector contains the chlororemomycin biosynthesis glycosyltransferase gene evaE, the sequence of which is shown in SEQ ID NO.8.

[0054] The construction method of pIJ8660-aadA-neo-evaE is as follows:

[0055] Specific primers were designed to amplify the SEQ ID NO.8 sequence using the Amycolatopsis orientalis CGMCC NO.21140 genome as a template and recovered:

[0056] SEQ ID NO.8 Upstream primer SEQ ID NO.9 gggatacgcggtaccatgaagctgatcaccgtgctc

[0057] SEQ ID NO.8 Downstream primer SEQ ID NO.10catcttgttcaatcatcatatgtcatgcgcgagcctttcc

[0058] The SEQ ID NO.8 fragment recovered in step (2) and the artificially synthesized high-efficiency promoter P from Eggrethella lenta DSM2243 were gapdh The fragment (SEQ ID NO.12) was seamlessly cloned and ligated with the expression vector pIJ8660-aadA-neo (SEQ ID NO.11) that had been double-digested with NdeI and BglII to obtain the recombinant expression vector pIJ8660-aadA-neo-evaE. The plasmid map is as follows: Figure 2 .

[0059] Step (3) The pIJ8660-aadA-neo-evaE expression vector is introduced into Amycolatopsis-orientalis AO-A to obtain the genetically engineered bacteria Amycolatopsis-orientalis AO-B. The specific method is as follows.

[0060] The pIJ8660-aadA-neo-evaE vector was transformed into demethylated E. coli ET1256 / pUZ8002 by heat shock at 42°C for 90 seconds.

[0061] The target plasmid pIJ8660-aadA-neo-evaE was transformed into E. coli ET12567 / pUZ8002 on LB plates containing the corresponding antibiotics (spectinomycin, kanamycin, chloramphenicol). Single colonies were picked and transferred to 5 mL LB plates and cultured overnight at 37°C, 220 rpm. Then, the colonies were transferred to 15 mL LB plates containing the corresponding antibiotics at a 2% ratio (expansion culture) and cultured until the OD 600The cell density is approximately 0.4. Collect the mycelia by centrifugation at 6000 rpm for 5 minutes, wash them three times with 2 mL of LB, and resuspend them in 500 μL of LB medium (add 500 μL of Streptomyces to each tube of Streptomyces) to serve as the donor bacteria for conjugation. The mycelia serve as the recipient bacteria and are cultured in TSB at 220 rpm at 28-30°C for approximately 48-60 hours. Collect 250 μL of mycelia by centrifugation at 6000 rpm for 5 minutes, wash them three times with LB medium, and resuspend them in 500 μL of 2×YT medium to serve as the recipient bacteria. To mix the donor and recipient bacteria, take 500 μL of the donor and 500 μL of the recipient bacteria, mix them thoroughly (centrifuge at 6000 rpm, and use the remaining 500 μL of the suspension to resuspend the cells). Spread the mixture onto MS medium (without antibiotics) containing 10 mM magnesium ions. After drying under a laminar flow hood, incubate in a 30°C incubator. After 16-20 h of culture, cover the plates with kanamycin (final concentration of 50 μg / mL) and nalidixic acid (final concentration of 25 μg / mL) and continue to culture at 30°C for 4-5 days. Pick out the grown transformants and subculture them on resistant YMG plates (final concentration of kanamycin of 50 μg / mL). Pick out single clones for genome extraction and identification.

[0062] Example 3: Chloroeremomycin Fermentation Verification of Starting Bacteria Amycolatopsis orientalis CGMCC No. 21140 and Genetically Engineered Bacteria Amycolatopsis orientalis AO-B

[0063] The chloroeremomycin-producing starter and genetically engineered bacteria were cultured on YMG solid medium for 5 days. A 1 cm x 1 cm bacterial mass was scraped and inoculated into a seed medium. The culture was then incubated at 30°C for 48 hours at 220 rpm. Mycelium from the seed medium was inoculated into a fermentation medium at an inoculum rate of 8% and incubated at 30°C for 168 hours. Samples were collected at 24, 48, 72, 96, 120, 144, and 168 hours for determination of chloroeremomycin production.

[0064] Example 4: Optimization of the Fermentation Process of Genetically Engineered Bacteria Amycolatopsis sorientalis AO-B

[0065] A Plackett-Burman design was used to screen for significant factors affecting A82846B production among seven components: glucose, peptone, maltodextrin, NaCl, KCl, MgSO₄, and KH₂PO₄. Response surface methodology (RSM) is a practical tool for optimizing fermentation factors. To determine the optimal fermentation concentrations of these three key culture medium components, a three-factor, three-level Box-Behnken design was used to further optimize fermentation conditions. Fermentation experiments confirmed that under the optimal conditions predicted by the mathematical model (GPM culture medium), fermentation reached the maximum value predicted by the model. To further optimize the shake flask fermentation process, single-factor experiments were conducted to investigate the effects of fermentation temperature, initial pH, seed age, inoculum size, and culture medium volume on A82846B yield. Ideal conditions were identified: temperature 30°C, initial pH 6.5, seed age 72 hours, inoculum size 2%, and culture medium volume 25 mL.

[0066] Example 5: Fermentation experiments were conducted using the starting strain Amycolatopsis orientalis (Accession Number: CGMCC NO.21140) with unoptimized fermentation conditions and culture medium, and the final strain Amycolatopsis orientalis AO-B (Accession Number: CGMCC NO.29179, Deposit Date: 2023.11.30) with optimized fermentation conditions and culture medium conditions, and the chloroeremomycin yields in the fermentation broths were compared.

[0067] The chloroeremomycin-producing starting and genetically engineered bacteria were cultured on YMG solid medium for 5 days. A 1 cm × 1 cm bacterial mass was scraped and inoculated into a seed medium. The starting and final engineered bacteria were cultured at 30°C for 48 hours and 72 hours, respectively, at 220 rpm. Mycelium from the seed culture medium of the starting and final engineered bacteria was inoculated into fermentation medium and GPM, respectively, and cultured at 30°C for 168 hours. Samples were collected at 24, 48, 72, 96, 120, 144, and 168 hours of culture to determine chloroeremomycin production.

[0068] Example 6: Chloroeremomycin production detection:

[0069] Step (1), HPLC conditions: Chromatographic column: C18 column (Aglient, Eclipse Plus XDB, , 4.6mm*250mm); detection wavelength: 280nm; flow rate: 1.00mL / min; injection volume: 20μL; experimental mobile phase: mobile phase A is water containing 0.1% formic acid, mobile phase B is 100% acetonitrile; HPLC program: 0-15min, phase B 5%-15%; 15-20min, phase B 15%-100%; 20-23min, phase B 100%; 23-30min, phase B 5%.

[0070] Step (2), Chloroeremomycin yield analysis: 1 mL of methanol was added to 1 mL of the fermentation broth obtained by fermentation. After sufficient shaking, the mycelium and solids were precipitated by centrifugation at 12,000 rpm / min for 10 min. The supernatant was filtered through a 0.45 μm sterile microporous filter membrane, and the filtrate was collected. The resulting sample was used for HPLC detection. Figure 3 Chloroeremomycin production change curve for the starting bacteria producing chloroeremomycin and the high-yield chloroeremomycin production engineered bacteria Amycolatopsis orientalis AO-B (deposit number: CGMCCNO.29179, deposit date: 2023.11.30).

[0071] In step (3), the genetically engineered bacterium Amycolatopsis orientalis AO-B (deposit number: CGMCC NO.29179, deposit date: 2023.11.30) produces high-yield Chloroeremomycin, and the yield is 3.1 times that of the starting strain, up to 428 mg / L. Oritavancin can effectively treat skin infections caused by Gram-positive bacteria. Therefore, the method for constructing a high-yield Chloroeremomycin bacterium described in the present invention has important application value.

Claims

1. An engineered bacterium that produces Chloroeremomycin, a direct precursor of oritavancin, characterized in that: The engineered bacteria have been deposited in the General Microbiology Center of China Culture Collection Administration Committee of Microorganisms and are classified and named as Amycolatopsis orientalis ( Amycolatopsis orientalis )AO-B, accession number: CGMCC NO.29179, deposit date: 2023.11.

30.

2. The use of the engineered bacteria according to claim 1 in the fermentation preparation of Chloroeremomycin, a direct precursor of oritavancin, is characterized in that: The engineering bacteria are classified and named as: Amycolatopsis orientalis (Amycolatopsis orientalis )AO-B, accession number: CGMCC NO.29179.

Images