Application of BnCPL3 gene in regulating erucic acid content in rapeseed seeds

Abstract

The present invention discloses the application of BnCPL3 gene in regulating the erucic acid content of rapeseed seeds, belonging to the field of gene engineering technology. The nucleotide sequence of the BnCPL3 gene is shown in SEQ ID NO.1, and the regulation includes overexpressing the BnCPL3 gene in rapeseed to increase the erucic acid content of the rapeseed seeds. The present invention overexpresses BnCPL3 in Brassica napus and finds that BnCPL3 significantly increases the erucic acid content of rapeseed seeds. The discovery of the function of the BnCPL3 gene by the present invention can provide gene resources for crop breeding for improving the erucic acid content of rapeseed.

Description

Technical Field

[0001] The invention relates to the technical field of genetic engineering, and in particular to the application of a BnCPL3 gene in regulating the erucic acid content of rapeseed seeds. Background Art

[0002] Rapeseed, as the main source of edible vegetable oil and plant protein, occupies an important position in agricultural products. The composition and content of fatty acids in rapeseed are one of the important factors affecting the quality of rapeseed oil. Rapeseed oil fatty acids are mainly composed of palmitic acid, stearic acid, oleic acid, linoleic acid, linolenic acid, arachidic acid and erucic acid. Among them, erucic acid is a 22-carbon ultra-long chain fatty acid (22:1) and one of the fatty acids with the highest boiling point in rapeseed oil fatty acids. Since erucic acid is difficult to be metabolized by the human body and has adverse effects on health, most of the newly cultivated edible rapeseed varieties are "double-low" rapeseed with low glucosinolate and low erucic acid. On the other hand, research on high-erucic acid rapeseed oil is gradually emerging. High-erucic acid rapeseed oil is an ideal material for advanced lubricants in industries such as cast steel, aerospace, and navigation, and fillers in the plastic industry due to its high quality and low price.

[0003] The synthesis of erucic acid in rapeseed is first to produce palmitic acid through the de novo fatty acid synthesis pathway, and then palmitic acid is re-catalyzed by long-chain acyl-CoA synthetase located on the plasma membrane to generate acyl-CoA, and then further synthesizes very long-chain fatty acids under the synergistic action of fatty acid elongase (FAE1) and other enzymes. In the above synthesis pathway, fatty acid elongase is the enzyme acting in the first step of the elongation reaction and is also the rate-limiting enzyme in the entire elongation reaction process. Therefore, overexpression of FAE1 in rapeseed can promote the accumulation of erucic acid content in rapeseed, while mutation of the FAE1 gene will lead to a significant decrease in erucic acid content. In addition, other members of the fatty acid elongase complex, including ketoacyl-CoA reductase (KCR), hydroxyacyl-CoA dehydratase (HCD) and trans-enoyl-CoA reductase (ECR), are also very important for the synthesis of erucic acid in rapeseed. Therefore, interfering with the genes encoding the above enzymes in high-erucic acid materials will lead to a decrease in erucic acid content in rapeseed. Although breeders have cloned several genes involved in seed oil metabolism, these genes are mostly concentrated on encoding key enzymes in the anabolic pathway, while other transcription factors and kinases involved in the regulation of erucic acid content have not been studied in depth. Summary of the invention

[0004] The purpose of the present invention is to provide an application of the BnCPL3 gene in regulating the erucic acid content of rapeseed seeds to solve the problems existing in the above-mentioned prior art. The present invention overexpresses BnCPL3 in Brassica napus and finds that BnCPL3 significantly increases the erucic acid content of rapeseed seeds. The discovery of the function of the BnCPL3 gene in the present invention can provide gene resources for crop breeding to improve the erucic acid content of rapeseed.

[0005] To achieve the above object, the present invention provides the following solutions:

[0006] The present invention provides an application of a BnCPL3 gene in regulating the erucic acid content of rapeseed seeds. The nucleotide sequence of the BnCPL3 gene is shown in SEQ ID NO.1. The regulation includes overexpressing the BnCPL3 gene in rapeseed to increase the erucic acid content of the rapeseed seeds.

[0007] The present invention also provides a method for increasing the erucic acid content in rapeseed seeds, comprising the step of overexpressing the BnCPL3 gene in rapeseed, wherein the nucleotide sequence of the BnCPL3 gene is shown in SEQ ID NO.1.

[0008] Furthermore, the overexpression method comprises the following steps: constructing a recombinant plasmid by combining the BnCPL3 gene with an expression vector; and transferring the recombinant plasmid into rapeseed by Agrobacterium-mediated method to overexpress the BnCPL3 gene.

[0009] Furthermore, when the rapeseed is transformed by Agrobacterium-mediated method, the infection site of Agrobacterium is the rapeseed hypocotyl.

[0010] The present invention also provides an application of the BnCPL3 gene in cultivating rapeseed varieties with high erucic acid content. The nucleotide sequence of the BnCPL3 gene is shown in SEQ ID NO.1. The method for cultivating rapeseed varieties with high erucic acid content is to overexpress the BnCPL3 gene in rapeseed to obtain transgenic rapeseed with high erucic acid content.

[0011] The present invention also provides a method for cultivating a rapeseed variety with a high erucic acid content, comprising the steps of overexpressing the BnCPL3 gene in the rapeseed to obtain a stably inherited rapeseed variety with the BnCPL3 gene overexpressed.

[0012] Furthermore, the overexpression method comprises the following steps: constructing a recombinant plasmid by combining the BnCPL3 gene with an expression vector; and transferring the recombinant plasmid into rapeseed by Agrobacterium-mediated method to overexpress the BnCPL3 gene.

[0013] Furthermore, when the rapeseed is transformed by Agrobacterium-mediated method, the infection site of Agrobacterium is the rapeseed hypocotyl.

[0014] The present invention discloses the following technical effects:

[0015] The present invention discloses for the first time the application of rapeseed BnCPL3 gene in regulating the erucic acid content of rapeseed. By cloning the BnCPL3 gene and genetically transforming it into Brassica napus, an overexpression material of the BnCPL3 gene is created. It is found that overexpression of the BnCPL3 gene significantly increases the erucic acid content of rapeseed seeds, indicating that the BnCPL3 gene is involved in regulating the erucic acid anabolism of rapeseed. The discovery of the function of the BnCPL3 gene by the present invention can provide gene resources for crop breeding for improving the erucic acid content of rapeseed. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0017] Figure 1 This is the electrophoresis diagram of the PCR amplification product of BnCPL3 gene in rapeseed;

[0018] Figure 2 Schematic diagram of the pCAMBIA1300-pUBQ10-BnCPL3-flag vector structure;

[0019] Figure 3 This is the phenotype of BnCPL3-OE#1 and #2 transgenic positive plants at the seedling stage;

[0020] Figure 4 The figure is an analysis of the expression level of BnCPL3 in the parental and transgenic positive materials;

[0021] Figure 5 Seed phenotypes of the parental and transgenic positive materials BnCPL3-OE#1 and #2;

[0022] Figure 6 This is the near infrared analysis of the erucic acid content in WT, BnCPL3-OE#1, and #2. DETAILED DESCRIPTION

[0023] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but should be understood as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0024] It should be understood that the terms described in the present invention are only for describing a particular embodiment and are not intended to limit the present invention. In addition, for the numerical range in the present invention, it should be understood that each intermediate value between the upper and lower limits of the scope is also specifically disclosed. The intermediate value in any stated value or stated range, and each smaller range between any other stated value or intermediate value in the described range is also included in the present invention. The upper and lower limits of these smaller ranges can be independently included or excluded in the scope.

[0025] Unless otherwise indicated, all technical and scientific terms used herein have the same meanings as those generally understood by those skilled in the art. Although the present invention describes only preferred methods and materials, any methods and materials similar or equivalent to those described herein may also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of a conflict with any incorporated document, the content of this specification shall prevail.

[0026] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments of the present invention description without departing from the scope or spirit of the present invention. Other embodiments derived from the present invention description will be apparent to those skilled in the art. The present invention description and examples are exemplary only.

[0027] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0028] Example 1 Cloning of rapeseed BnCPL3 gene

[0029] 1. Use Trizol method to extract RNA from Brassica napus Westar. The specific operation is as follows:

[0030] (1) Add 500 μL of Trizol solution (Invitrogen, 15596026CN) to the fully ground sample, vortex and mix, and place on ice for 5 min;

[0031] (2) Then, add 100 μL of chloroform to each tube of sample, mix by inverting, and place on ice again for 5-10 min;

[0032] (3) After the reaction, the sample was centrifuged at 4°C, 12,000 rpm, for 10 min. After centrifugation, the sample was separated into three layers: an organic phase, an intermediate protein layer, and a colorless upper aqueous phase.

[0033] (4) Use a pipette to aspirate the upper aqueous phase containing RNA, transfer it to a new RNAase-free tube, and add an equal volume of isopropanol to precipitate the RNA;

[0034] (5) Centrifuge again at 12000 r / min for 10 min, discard the supernatant, and add 500 μL of 100% ethanol for rinsing;

[0035] (6) After drying at room temperature, 50 μL of RNA-free water was added to obtain Brassica napus RNA.

[0036] 2. Reverse transcription of RNA from Brassica napus to form cDNA and PCR amplification of BnCPL3 gene

[0037] (1) cDNA synthesis: Reverse transcription was performed using the Reverse Transcription Kit (R423-01, Novozymes) from Novozymes. 4× gDNAwiper Mix, RNA, and RNase-Free ddH were added according to the instructions. 2 O to remove genomic DNA, and then react according to the following steps: Step 1: 42°C, 2 min, Step 2: 4°C, 2 min. Then add 5×qRTSuperMix to the reaction solution obtained in Step 1 for reverse transcription reaction, and finally dilute the product 3 times with RNA-free water, mix well, and store at -80°C for later use.

[0038] (2) PCR amplification: 1 μL of cDNA with a concentration of 100 ng / μL was taken and amplification primers (BnCPL3-F: tcct ctagagtcgacactagtATGGGGAACGATGAGGATTTG (SEQ ID NO.3), BnCPL3-R: agtccatgatc cccgggtaccAGGTTTGATGGCAAAATTGCTT (SEQ ID NO.4), lowercase letters are vector homology arm sequences) were added to perform PCR reaction: annealing at 95°C for 5 min was completed and then amplification cycle was entered: 95°C for 30 s, 58°C for 30 s, 72°C for 4 min. After 34 cycles, the final extension was performed at 72°C for 5 min and the reaction was terminated at 20°C for 2 min. The BnCPL3 gene product was recovered after agarose gel electrophoresis ( Figure 1 The nucleotide sequence of the BnCPL3 gene is shown in SEQ ID NO.1, and the amino acid sequence encoded by the gene is shown in SEQ ID NO.2.

[0039] SEQ ID NO.1:

[0040]

[0041] SEQ ID NO.2:

[0042]

[0043] Example 2 Construction of overexpression vector

[0044] 1. Homologous recombination of overexpression vector

[0045] The overexpression vector pCAMBIA1300-pUBQ10-flag plasmid (the vector plasmid sequence is disclosed in the patent "CN118127038B-A BnARGOS gene for regulating the fatty acid content of rapeseed seeds and its application") was double-digested to obtain a linearized vector, and then the Novozyme Origin Recombination Kit (C116-01, Novozyme) was used to calculate the amount of vector fragments used, and the reaction system was prepared on ice, reacted at 37°C for 30 minutes; cooled to 4°C or placed on ice to obtain the recombinant vector pCAMBIA 1300-pUBQ10-BnCPL3-flag ( Figure 2 shown).

[0046] 2. E. coli transformation of recombinant products

[0047] (1) Thaw the cloning competent cells on ice, take 10 μL of the recombinant product and add it to the competent cells, flick the tube wall to mix, and let it stand on ice for 20 min;

[0048] (2) After heat shock at 42°C for 1 min, immediately cool on ice for 2 min;

[0049] (3) Add 900 μL LB medium and shake at 37°C for 1 h (200 rpm);

[0050] (4) Preheat the LB solid culture medium plates with corresponding resistance in a 37°C incubator;

[0051] (5) Centrifuge at 5,000 rpm for 5 min and discard the supernatant. Resuspend the cells in the remaining medium and spread them evenly on a plate containing the correct resistance using a sterile spreader.

[0052] (6) Incubate the cells in an incubator at 37°C for 12-16 hours.

[0053] 3. Positive clone screening and plasmid extraction

[0054] (1) Select several clones on the recombination reaction transformation plate for colony PCR identification. Use the positive clone identification primers: BnCPL3-GT-F (CTCTTCGATTTGTGATTTCTATCTAG, SEQ ID NO.5) and BnCPL3-GT-R (CATCATCACTGTCTTCAATCAC, SEQ ID NO.6) for PCR amplification. The appearance of a band slightly larger than the size of the inserted fragment indicates that the clone is correct.

[0055] (2) Then, the corresponding monoclonal colony was picked and inoculated into liquid LB medium containing appropriate antibiotics and cultured overnight. The plasmid was extracted for sequencing and identification. The small-scale extraction method of the plasmid was referred to the instruction manual of the Thermo Fisher Plasmid Extraction Kit (K0503, Thermo Fisher).

[0056] Example 3 Genetic transformation of rapeseed

[0057] 1. Sowing and germination

[0058] Select plump rapeseed seeds, disinfect them with 75% alcohol and 50% 84 disinfectant, put them in a sterile box, and culture them under dark light for 6 days.

[0059] 2. Agrobacterium transformation and propagation

[0060] The target plasmid was transferred into Agrobacterium GV3101, and the positive clones were selected and inoculated into YEP liquid medium with corresponding resistance, and incubated at 28℃ overnight. The next day, the culture was expanded at a ratio of 1:100 until OD 600 =about 0.6.

[0061] 3. Explant preparation, infection, and co-cultivation

[0062] Collect the bacteria by centrifugation and resuspend them in DM liquid medium for later use. Then cut the rapeseed hypocotyls with sterile scissors and put them into a plate. Incubate them with Agrobacterium suspension resuspended in DM liquid medium for 15 minutes. Discard the excess suspended bacterial solution, transfer the explants to M1 medium, and culture them at 24°C under dim light for 36-48 hours.

[0063] 4. Selection and subculture

[0064] Transfer the explants to M2 medium and culture them normally under light for 15 days. Then transfer the explants to M3 medium and subculture them every 20 days until green buds appear. Transfer the green buds to M4 medium and transplant them into soil when they grow up and take root.

[0065] The culture medium formula mentioned in the above experimental steps is as follows:

[0066] M1 medium formula: MS 4.4 g / L, sucrose 30 g / L, mannitol 18 g / L, 2,4-dichlorophenoxyacetic acid 1 mg / L, kinetin 0.3 mg / L, phytagel 5.5 g / L, and acetosyringone 100 μmol / L;

[0067] M2 medium formula: MS 4.4 g / L, sucrose 30 g / L, mannitol 18 g / L, 2,4-dichlorophenoxyacetic acid 1 mg / L, kinetin 0.3 mg / L, timentin 300 mg / L, sodium thiosulfate 150 μmol / L, hygromycin 50 mg / L and phytagel 5.5 g / L;

[0068] M3 medium: MS 4.4 g / L, glucose 10 g / L, xylose 0.25 g / L, 2-morpholineethanesulfonic acid 0.6 g / L, zeatin 2 mg / L, indoleacetic acid 0.1 mg / L, timentin 300 mg / L, silver nitrate 150 μmol / L, and phytagel 5.5 g / L;

[0069] M4 medium: MS 4.4 g / L, sucrose 10 g / L and phytagel 5.5 g / L;

[0070] DM liquid culture medium: MS 4.4 g / L, sucrose 30 g / L and acetosyringone 100 μmol / L.

[0071] Example 4 Identification of positive plants

[0072] 1. DNA extraction of transgenic rapeseed

[0073] The leaves of one oil plant were collected, and then quickly frozen in liquid nitrogen and DNA was extracted using the CTAB method. The specific steps are as follows:

[0074] (1) Place the sample in liquid nitrogen on a grinder and grind it thoroughly. Then add 400 μL of CTAB solution, shake it thoroughly and place it in a 65°C thermostat for 1 h.

[0075] (2) Add 400 μL of chloroform / isoamyl alcohol mixture to the EP tube, mix thoroughly by inversion, let stand until the solution in the tube separates, and centrifuge at 12,000 rpm for 10 min.

[0076] (3) Transfer the supernatant in the tube to a 1.5 mL EP tube, and then add 500 μL of pre-cooled anhydrous ethanol. At this time, DNA floccules will precipitate;

[0077] (4) Centrifuge at 12000 r / min for 10 min, discard the supernatant, and retain the white precipitate at the bottom;

[0078] (5) Add 700 μL of 75% ethanol, centrifuge at 12,000 rpm for 2 min, discard the supernatant, and repeat twice;

[0079] (6) After absorbing the liquid in the EP tube, open the tube cap and place it on the laboratory bench to dry. Add 50 μL of sterile water to the dried EP tube and mix well.

[0080] 2. PCR identification of resistance markers

[0081] The extracted transgenic rapeseed DNA was used as a template for PCR amplification using PCR primers BnCPL3-GT-F and BnCPL3-GT-R, followed by analysis by DNA gel electrophoresis to confirm the positive plants.

[0082] The results showed that the BnCPL3 gene was successfully overexpressed in rapeseed. Two plants, BnCPL3-OE#1 and #2, which successfully overexpressed the BnCPL3 gene, were selected. Their phenotypes were as follows Figure 3 shown.

[0083] Example 5 Real-time fluorescence quantitative PCR detection of transformed gene expression

[0084] RNA was extracted from leaves of positive plants overexpressing the BnCPL3 gene, and reverse transcription was performed using a reverse transcription kit (R423-01, Novozymes) from Novazon Biotechnology Co., Ltd.; specific qRT-PCR primers of the BnCPL3 gene (F:TTGCAAATGCTGTATCTAGC, SEQ ID NO.7; R:CATGTAGGCCCA TCAATAAA, SEQ ID NO.8) were designed using Primer Design software for real-time fluorescence quantitative detection, and three biological and three technical replicates were set up (liquid preparation, sample addition, etc. were performed in a 4°C metal bath or on ice).

[0085] qRT-PCR reaction conditions: first step: 95°C, 30s; second step: 95°C, 5s; 60°C, 30s, 40 cycles; fluorescence acquisition; statistical data, data analysis.

[0086] The results are as follows Figure 4 As shown, compared with the wild-type rapeseed WT, the expression level of BnCPL3 in the two plants OE#1 and #2 overexpressing the BnCPL3 gene was significantly increased.

[0087] Example 6 Determination of erucic acid content in rapeseed

[0088] Use FOSS near infrared multifunctional quality analyzer (NIRSDS2500) to measure the quality traits of rapeseed seeds such as erucic acid. Turn on the power, open the Simplicity software, preheat for about 30 minutes, and wait for the instrument to stabilize before starting the measurement. First use the standard sample for measurement, and then measure the sample after calibration. Take 5g of each sample and put it into the round sample box ( Figure 5 ), press it with a lid, place it on the rotating sample stage, perform sample scanning and analysis, and calculate and analyze the data after the measurement.

[0089] The results are as follows Figure 6 As shown, compared with the wild-type control WT, the erucic acid content in the seeds of transgenic plants OE#1 and #2 was significantly increased, indicating that overexpression of BnCPL3 can significantly increase the erucic acid content in rapeseed seeds.

[0090] The embodiments described above are only descriptions of the preferred modes of the present invention, and are not intended to limit the scope of the present invention. Without departing from the design spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by ordinary technicians in this field should all fall within the protection scope determined by the claims of the present invention.

Claims

1. Application of the BnCPL3 gene in regulating the erucic acid content in rapeseed seeds, characterized in that: The nucleotide sequence of the BnCPL3 gene is shown in SEQ ID NO.1, and the regulation includes overexpressing the BnCPL3 gene in rapeseed, which can increase the erucic acid content of the rapeseed seeds.

2. A method for increasing the erucic acid content in rapeseed seeds, characterized in that: The method comprises the step of overexpressing the BnCPL3 gene in rapeseed, wherein the nucleotide sequence of the BnCPL3 gene is shown as SEQ ID NO.

1.

3. The method according to claim 2, characterized in that The overexpression method comprises the following steps: constructing a recombinant plasmid by combining the BnCPL3 gene with an expression vector; and transferring the recombinant plasmid into rapeseed through Agrobacterium-mediated method to overexpress the BnCPL3 gene.

4. The method according to claim 3, characterized in that When using the Agrobacterium-mediated method to transform rapeseed, the infection site of Agrobacterium is the rapeseed hypocotyl.

5. Application of the BnCPL3 gene in breeding rapeseed varieties with high erucic acid content, characterized in that: The nucleotide sequence of the BnCPL3 gene is shown in SEQ ID NO.

1. The method for cultivating a rapeseed variety with a high erucic acid content is to overexpress the BnCPL3 gene in rapeseed to obtain transgenic rapeseed with a high erucic acid content.

6. A method for cultivating rapeseed varieties with high erucic acid content, characterized in that: The method comprises the steps of overexpressing the BnCPL3 gene in rapeseed to obtain a rapeseed variety with stably inherited BnCPL3 gene overexpression; the nucleotide sequence of the BnCPL3 gene is shown in SEQ ID NO.

1.

7. The method according to claim 6, characterized in that The overexpression method comprises the following steps: constructing a recombinant plasmid by combining the BnCPL3 gene with an expression vector; and transferring the recombinant plasmid into rapeseed through Agrobacterium-mediated method to overexpress the BnCPL3 gene.

8. The method according to claim 7, characterized in that When using the Agrobacterium-mediated method to transform rapeseed, the infection site of Agrobacterium is the rapeseed hypocotyl.

Images