Preparation method of dairy cow placenta extract CP2 and application of dairy cow placenta extract CP2 as antioxidant substance

Abstract

The invention discloses a preparation method of a dairy cow placenta extract CP2 and application of the dairy cow placenta extract CP2 as an antioxidant substance. The preparation method comprises the following steps: by taking normal delivery healthy Chinese Holstein dairy cow placenta homogenate as a substrate, homogenizing by using a tissue homogenizer, adding papain, acting for 4.7 hours under the conditions that the pH is 6.5 and the temperature is 55 DEG C, centrifuging after inactivating for 10 minutes in a boiling water bath, and collecting supernatant, thereby obtaining the dairy cow placenta extract CP2. The preparation method comprises the following steps: performing freeze drying to obtain CPE, separating CP2 in the CPE through chromatography, the amino acid composition of the CP2 is QPGLPGPAG (H-Gln-Pro-Gly-Leu-Pro-Gly-Pro-Ala-Gly-OH), the molecular formula of the CP2 is C35H56N10O11, the molecular weight of the CP2 is 792.89 Da, and the CP2 has good free radical scavenging ability, lipid peroxidation inhibition ability, transition metal chelating ability and reducing power, and can activate a Keap1 / Nrf2 pathway in oxidative stress cells so as to relieve the oxidative stress of the cells.

Description

Technical Field

[0001] The invention relates to the technical field of drug extraction, and in particular to a preparation method of a cow placenta extract CP2 and application of the cow placenta extract CP2 as an antioxidant. Background Art

[0002] Placental tissue contains a large number of biologically active substances, which have the effects of anti-oxidation, anti-fatigue, promoting metabolism, enhancing physiological functions and improving immunity. The traditional clinical utilization method of traditional Chinese medicine is to collect fresh placenta, steam and dry it, and grind it into medicine. In recent years, researchers have effectively improved the biological activity and total substance content of placental products by changing the steaming conditions and adding processing materials, but placental preparations with relatively single ingredients have not yet been prepared. Shen Liuhong et al. and Zhang Yue et al. used different proteases to hydrolyze cow placenta and predicted the antioxidant activity of the hydrolyzed products. They found that the peptides obtained after the hydrolysis of cow placenta have strong transition metal chelating ability, reducing power and scavenging ABTS free radicals. They can inhibit the oxidative stress of aging model mice by increasing the activity of antioxidant enzymes, delay skin aging and liver aging, and have good antioxidant function. However, these cow placenta extracts (CPE) are currently a mixture of polypeptides, and the cow placenta antioxidant peptide (CPAP) component that exerts antioxidant activity in CPE is still unclear. Therefore, the present invention uses chromatography to gradually fractionate CPE by ion exchange, molecular sieve chromatography column and RP-HPLC, and after identifying the polypeptide sequence in the fractionation product by LC-MS / MS, selects the polypeptide with the highest abundance and records it as CP2. It is also confirmed that the cow placenta extract CP2 can be used as an antioxidant. Summary of the invention

[0003] The technical problem to be solved by the present invention is to provide a preparation method of cow placenta extract CP2 and application of cow placenta extract CP2 as an antioxidant.

[0004] To achieve the above object, the technical solution of the present invention is as follows:

[0005] The first technical solution adopted by the present invention is a method for preparing cow placenta extract CP2, comprising the following steps:

[0006] Step 1, the cow placenta was cut into pieces and homogenized with a tissue homogenizer, papain was added, and the mixture was inactivated at pH 6.5 and 55°C for 4.7 hours, and then centrifuged after being inactivated in a boiling water bath for 10 minutes, and the supernatant was collected, freeze-dried, and freeze-dried for later use, which was recorded as CPE;

[0007] Step 2, the CPE obtained in step 1 is further separated by ion exchange chromatography; 25 mL of 30DEAE cellulose ion exchange resin filler is loaded into a 2×20 cm glass chromatography column, and 3 column volumes of phosphate buffer (pH=7.4) are used to wash and equilibrate the chromatographic column; an appropriate amount of CPE is added to phosphate buffer (pH=7.4) to prepare a 50 mg / mL sample solution, and the sample solution is added 2 cm away from the column surface; after loading, a phosphate buffer (pH=8.0) containing sodium chloride (0, 0.2, 0.4, 0.6 mol / L) is used for gradient elution, and the elution rate is 2 mL / min; 2 mL of eluate is collected in each tube, the absorbance is detected at 280 nm, and an elution curve is drawn; the eluate is divided into multiple fractions according to the elution curve; the DPPH free radical scavenging capacity of each fraction is measured (the concentration of each fraction is 5 mg / mL), and the strongest antioxidant fraction in step 2 is obtained;

[0008] Step 3, the fraction with the strongest antioxidant activity in step 2 is separated by molecular sieve chromatography; 20g of Sephadex G25 gel filler is weighed, 200mL of deionized water is added to a boiling water bath to swell for 2h, the pH value is adjusted to 6.5, impurities suspended on the water surface are poured out, and then slowly loaded into a 2×30cm glass chromatography column, about 5cm from the upper end of the column, and 3 column volumes are balanced with deionized water at 3mL / min; the fraction with the strongest antioxidant activity obtained in step 2 is taken, deionized water is added to prepare a 20mg / mL sample solution, and then 1mL of the sample solution is taken, and the sample solution is added 2cm from the column surface, and then deionized water is used as the eluent, and the flow rate is 3mL / min for elution, and finally 2mL of the eluent is collected in each tube, the absorbance is detected at 280nm, and an elution curve is drawn; the eluent is divided into multiple fractions according to the elution curve, and the DPPH free radical scavenging ability (concentration of 5mg / mL) is measured after freeze-drying to obtain the fraction with the strongest antioxidant activity in step 3;

[0009] Step 4, using RP-HPLC to separate the fraction with the strongest antioxidant activity in step 3; using Waters 2695 high performance liquid chromatograph for separation, taking the fraction with the strongest antioxidant activity obtained in step 3; preparing the lyophilized powder of the fraction into a 5 mg / mL sample solution, using a C18 reverse phase chromatographic column (4.6x250 mm) as the analytical column, 98% ultrapure water and 2% acetonitrile as mobile phase A, 2% ultrapure water and 98% acetonitrile as mobile phase B, and using linear gradient elution after loading, with a flow rate of 0.7 mL / min, and elution conditions, 0-5 min, mobile phase B 5%-8%; 5-40 min, mobile phase B 8%-18%; 40-62 min, mobile phase B 18%-32%; 62-64 min, mobile phase B 32% to 95%; the absorbance is detected at 214 nm, and the eluate can be divided into multiple fractions according to the liquid chromatogram; after freeze-drying each fraction, the DPPH free radical scavenging ability is determined (the concentration of each fraction is 0.1 mg / mL), and the fraction with the strongest antioxidant activity in step 4 is obtained;

[0010] Step 5, using LC-MS / MS to identify the fraction with the strongest antioxidant activity in step 4; using Easy-nLC high performance liquid chromatograph connected in series with Q-Exactive mass spectrometer to identify the polypeptide amino acid sequence in the fraction with the strongest antioxidant activity obtained in step 4; dissolving the fraction in 0.1% formic acid aqueous solution as a sample solution; liquid chromatography conditions, using a C18 reverse phase chromatographic column (0.15 mm×150 mm, 3 μm) as the analytical column, 0.1% formic acid aqueous solution as mobile phase A, 0.1% formic acid and 80% acetonitrile aqueous solution as mobile phase B, linear gradient elution after loading, flow rate of 600 nL / min, elution conditions, 0-2 min, mobile phase B 4%-8%; 2-45 min, mobile phase B 8%-28%; 45-55 min, mobile phase B 28%-40%; 55-56 min, mobile phase B 40%~95%; mass spectrometry analysis conditions are as follows: primary mass spectrometry parameters, Resolution is 70000, AGCtarget is 3e6, MaximumIT is 100ms, Scanrange is 100to 1500m / z; secondary mass spectrometry parameters, Resolution is 17500, AGCtarget is 1e5, MaximumIT is 50ms, TopN is 20, NCE / steppedNCE is 28; finally, the peptide with the highest abundance in the identification results is selected and recorded as CP2;

[0011] Step 6: According to the CP2 amino acid sequence, CP2 can be synthesized by solid phase method with a purity greater than 95%.

[0012] The cow placenta extract CP2 of the present invention is QPGLPGPAG (H-Gln-Pro-Gly-Leu-Pro-Gly-Pro-Ala-Gly-OH), with a molecular formula of C 35 H 56 N 10 O 11 , molecular weight 792.89Da, can be used as an antioxidant.

[0013] Obviously, according to the above contents of the present invention, in accordance with common technical knowledge and customary means in the art, without departing from the above basic technical ideas of the present invention, other various forms of modification, replacement or change may be made.

[0014] The above contents of the present invention are further described in detail below through specific implementation methods in the form of embodiments. However, this should not be understood as the scope of the above subject matter of the present invention being limited to the following examples. All technologies realized based on the above contents of the present invention belong to the scope of the present invention. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] Figure 1 Chromatographic separation process and identification results

[0016] Figure 2 CP2 liquid chromatography and secondary mass spectrometry

[0017] Figure 3 Chemical method for detecting the antioxidant activity of CP2

[0018] Figure 4 Effects of different concentrations of H2O2 on the activity of RAW264.7 cells

[0019] Figure 5 Effects of CP2 on the viability of normal and oxidatively stressed RAW264.7 cells

[0020] Figure 6 Effects of CP2 on antioxidant enzymes and MDA in RAW264.7 cells under oxidative stress

[0021] Figure 7 Effects of CP2 on the antioxidant pathway of oxidative stress cells

[0022] Figure 8 is the CP2DPPH free radical scavenging rate under different conditions DETAILED DESCRIPTION

[0023] Example 1 Preparation of Cow Placenta Extract CP2

[0024] 1 Materials and methods

[0025] 1.1 Materials and Instruments

[0026] 1.1.1 Materials and reagents

[0027] Cow placenta was collected from healthy cows that gave birth naturally in a large-scale ranch in Sichuan; 30DEAE cellulose ion exchange resin filler (L10W08KB), Nanovita Technology Co., Ltd.; Sephadex G25 gel filler (RH314160), Shanghai Roen Chemical Technology Co., Ltd.; sodium bicarbonate (144-55-8), sodium hydroxide (1310-73-2), sodium chloride (7647-14-5), Chengdu Cologne Chemical Co., Ltd.; hydrochloric acid (7647-01-0), Xilong Chemical Co., Ltd.; phosphate buffer (ST448), Shanghai Biyuntian Biotechnology Co., Ltd.; papain (G8430), pepsin (P8160), trypsin (T1300), Solarbio, USA; DPPH micro kit (R27137), Shanghai Yuanye Biotechnology Co., Ltd.; formic acid (695076), acetonitrile (34851), Sigma, USA.

[0028] 1.1.2 Test instruments and equipment

[0029] Pen pH meter (PH828), Dongguan Wanchuang Electronic Products Co., Ltd.; tissue homogenizer (FSH-2A), Changzhou Yuexin Instrument Manufacturing Co., Ltd.; electronic balance (JM-A30002), Zhuji Chaoze Weighing Equipment Co., Ltd.; constant temperature water bath (HH-S4A), Beijing Kewei Yongxing Instrument Co., Ltd.; vacuum freeze dryer (SCIENTZ-10N-A), Ningbo Xinzhi Freeze Drying Equipment Co., Ltd.; desktop high-speed refrigerated centrifuge (TGL-16.5M), Shanghai Lu Xiangyi Centrifuge Instrument Co., Ltd.; high performance liquid chromatograph (Waters2695), Waters Company, USA; ultra-micro spectrophotometer (Nano Drop OneC), high performance liquid chromatograph (Easy-nLC 1200), mass spectrometer (Q Exactive combined quadrupole Orbitrap), multi-function fluorescence chemiluminescence analyzer (Varioskan Flash), Thermo Fisher Scientific, USA.

[0030] 1.2 Test methods

[0031] 1.2.1 Preparation of bovine placenta extract

[0032] The cow placenta was cut into pieces and homogenized with a tissue homogenizer. Papain was added and allowed to act at pH 6.5 and 55°C for 4.7 h. After being inactivated in a boiling water bath for 10 min, the supernatant was collected and freeze-dried, which was recorded as CPE.

[0033] 1.2.2 Separation of CPAP by Chromatography

[0034] ① Ion exchange chromatography separation: Take 25mL 30DEAE cellulose ion exchange resin filler and load it into a 2×20cm glass chromatography column. Use 3 column volumes of phosphate buffer (pH = 7.4) to rinse and equilibrate the chromatographic column. Take an appropriate amount of CPE and add it to phosphate buffer (pH = 7.4) to prepare a 50mg / mL sample solution, and add the sample solution 2cm away from the column surface. After loading, use a phosphate buffer (pH = 8.0) containing sodium chloride (0, 0.2, 0.4, 0.6mol / L) for gradient elution, and the elution rate is 2mL / min. Collect 2mL of eluate in each tube, detect the absorbance at 280nm, and draw an elution curve. Divide the eluate into multiple fractions according to the elution curve. After desalting and freeze-drying, measure the DPPH free radical scavenging ability of each fraction (the concentration of each fraction is 5mg / mL), and obtain the fraction with the strongest antioxidant activity.

[0035] ② Molecular sieve chromatography separation: Weigh 20g Sephadex G25 gel filler, add 200mL deionized water and swell in a boiling water bath for 2h, adjust the pH value to 6.5, pour the impurities suspended on the water surface, and then slowly load it into a 2×30cm glass chromatography column, about 5cm from the top of the column, and balance 3 column volumes with deionized water at 3mL / min. Take the fraction with the strongest antioxidant activity obtained in the previous step, add deionized water to prepare a 20mg / mL sample solution, then take 1mL of the sample solution, add the sample solution 2cm away from the column surface, then use deionized water as the eluent, elute at a flow rate of 3mL / min, and finally collect 2mL of the eluent in each tube, detect the absorbance at 280nm, and draw an elution curve. According to the elution curve, the eluent is divided into multiple fractions, and the DPPH free radical scavenging ability (concentration of 5mg / mL) is measured after freeze-drying to obtain the fraction with the strongest antioxidant activity.

[0036] ③RP-HPLC separation: Waters 2695 high performance liquid chromatograph was used for separation, and the fraction with the strongest antioxidant activity obtained in the previous step was taken. The lyophilized powder of the fraction was prepared into a 5 mg / mL sample solution, and a C18 reverse phase chromatographic column (4.6x250 mm) was used as the analytical column, 98% ultrapure water and 2% acetonitrile were used as mobile phase A, and 2% ultrapure water and 98% acetonitrile were used as mobile phase B. After loading, a linear gradient elution was used, and the flow rate was 0.7 mL / min. The elution conditions were: 0-5 min, mobile phase B 5%-8%; 5-40 min, mobile phase B 8%-18%; 40-62 min, mobile phase B 18%-32%; 62-64 min, mobile phase B 32%-95%. The absorbance was detected at 214 nm, and the eluate could be divided into multiple fractions according to the liquid chromatogram. After freeze-drying each fraction, the DPPH free radical scavenging ability was determined (the concentration of each fraction was 0.1 mg / mL), and the fraction with the strongest antioxidant activity was obtained.

[0037] ④LC-MS / MS identification: Easy-nLC high performance liquid chromatograph connected to Q-Exactive mass spectrometer was used to identify the amino acid sequence of the polypeptide in the fraction with the strongest antioxidant activity obtained in the previous step. The fraction was dissolved in 0.1% formic acid aqueous solution as the sample solution. Liquid chromatography conditions: C18 reverse phase chromatography column (0.15mm×150mm, 3μm) was used as the analytical column, 0.1% formic acid aqueous solution was used as mobile phase A, 0.1% formic acid and 80% acetonitrile aqueous solution was used as mobile phase B, linear gradient elution was used after loading, the flow rate was 600nL / min, elution conditions: 0-2min, mobile phase B 4%-8%; 2-45min, mobile phase B 8%-28%; 45-55min, mobile phase B 28%-40%; 55-56min, mobile phase B 40%-95%. The mass spectrometry analysis conditions are as follows: primary mass spectrometry parameters: Resolution is 70000, AGCtarget is 3e 6 , MaximumIT is 100ms, Scanrange is 100to1500m / z; Secondary mass spectrometry parameters: Resolution is 17500, AGCtarget is 1e 5 , MaximumIT is 50ms, TopN is 20, and NCE / steppedNCE is 28. Finally, the peptide with the highest abundance in the identification results is selected and recorded as CP2.

[0038] 1.2.3 Synthetic cow placenta antioxidant peptides

[0039] According to the CP2 amino acid sequence, CP2 was synthesized by solid phase method with a purity greater than 95%.

[0040] 1.3 Data Analysis

[0041] SPSS26.0 software was used for statistical analysis, and the mean ± standard deviation of each index was calculated. Dunnett's T3 method was used for significance analysis. P>0.05 indicated no significant difference, P<0.05 indicated significant difference, and P<0.01 indicated extremely significant difference. GraphPad Prism 9.0.0 software was used for drawing.

[0042] 2 Results and analysis

[0043] 2.1 Chromatographic separation of CP2

[0044] In this study, ion exchange chromatography, molecular sieve chromatography and RP-HPLC were used to separate CPAP from CPE, and the best fraction was screened according to the DPPH free radical scavenging rate of each fraction. Finally, LC-MS / MS was used to identify the amino acid sequence of the polypeptide in the fraction. The separation and identification results are shown in Figure 1 The ion exchange chromatography separation results are shown in Figure 1 A, CPE was separated by 30DEAE column, and an obvious elution peak was detected at 280nm wavelength. Four fractions were obtained according to the order of elution, named D1, D2, D3, and D4. Among them, the free radical scavenging rate of D2 fraction was the highest at 5mg / mL, which was 15.20±0.24%; the free radical scavenging rate of D3 fraction was the lowest, which was 1.95±0.25% ( Figure 1 B). Therefore, fraction D2 was selected for further separation. The molecular sieve chromatography separation results are shown in Figure 1 C, using Sephadex G10 column to separate D2 fraction, a more obvious elution peak was detected at 280nm wavelength, and two fractions were obtained according to the order of peak elution, named G1 and G2. Among them, the free radical scavenging rate of G1 fraction was higher at 5mg / mL, which was 23.58±0.33%, while the free radical scavenging rate of G2 fraction was lower, which was 14.00±0.03% ( Figure 1 D). Therefore, the G1 fraction was selected for subsequent fractionation. The RP-HPLC separation results are shown in Figure 1 E. The G1 fraction was separated by high performance liquid chromatography (Waters 2695), and an obvious chromatographic peak was detected at a wavelength of 214 nm. Three fractions were obtained in the order of peak elution, named R1, R2 and R3. Among them, the free radical scavenging rate of the R2 fraction was the highest at 0.1 mg / mL, which was 10.35±0.15%, and the free radical scavenging rate of the R2 fraction was the lowest, which was 4.74±0.35% ( Figure 1F). After RP-HPLC separation, the purity of the fractionation product was the highest, so the R2 fraction was selected for subsequent peptide sequence identification. Using LC-MS / MS, combined with database retrieval software, a total of 21 peptides were identified from the R2 fraction, with the number of amino acids ranging from 7 to 11 and the molecular weight distribution ranging from 720.42 to 990.55 Da. The top 10 peptides in terms of abundance are shown in Table 1. Among them, the abundance of the peptide QPGLPGPAG is much higher than that of the other peptides, and it is the main component of the R2 fraction. Therefore, QPGLPGPAG (H-Gln-Pro-Gly-Leu-Pro-Gly-Pro-Ala-Gly-OH) was selected as CP2, and its molecular formula is C 35 H 56 N 10 O 11 , the molecular weight is 792.89Da, and the secondary mass spectrum is as follows Figure 1 As shown in G.

[0045] Table 1 Results of partial amino acid sequence identification of R2 fraction

[0046]

[0047] 2.2 Purity analysis of synthetic antioxidant peptides

[0048] After solid phase synthesis of CP2, its liquid chromatogram and mass spectrum are as follows Figure 2 As shown, it was found that the component with the highest purity in the synthetic products was CP2, and the purity was greater than 95%.

[0049] Example 2 Antioxidant activity application of cow placenta extract CP2

[0050] 1 Materials and methods

[0051] 1.1 Materials and Instruments

[0052] 1.1.1 Materials and reagents

[0053] CP2(QPGLPGPAG, molecular formula C 35 H 56 N 10 O 11 , molecular weight 792.89Da), purity greater than 95%; control drug is Vit C (53219860), Sinopharm Chemical Reagent Co., Ltd.;

[0054] RAW264.7 cells were kindly provided by the Pathology Laboratory of Sichuan Agricultural University; the culture medium was RAW264.7-specific culture medium (CM-0190) provided by Wuhan Pronocell Life Science Co., Ltd.

[0055] Ferrozine (A601542), Shanghai Bioengineering Co., Ltd.; DPPH micro kit (R27137), Shanghai Yuanye Biotechnology Co., Ltd.; hydrochloric acid (7647-01-0), Xilong Chemical Co., Ltd.; EDTA-Na 2 (53219860), thiobarbituric acid (30178034), ferrous sulfate heptahydrate (10012116), ammonium acetate (631-61-8), glacial acetic acid (64-19-7), isopropyl alcohol (67-63-0), methanol (67-56-1), Sinopharm Chemical Reagent Co., Ltd.; salicylic acid (69-72-7), H 2 O 2 (7722-84-1), ethanol (64-17-5), ferric chloride (10025-77-1), lecithin (8030-76-0), Chengdu Kelong Chemical Co., Ltd.; TBTZ (MC152L), SOD ELISA kit (ml643059), CAT ELISA (ml037752) kit, GSH-Px ELISA kit (ml058194), MDAELISA kit (ml094962), Shanghai ELISA Biotechnology Co., Ltd.; phosphate buffer (ST448), Shanghai Bio-Technology Co., Ltd.; MTS cell kit (G3580), Promega (Beijing) Biotechnology Co., Ltd.; RNA extraction solution (G3013), chloroform substitute (G3014), RNA dissolution solution (G3029), reverse transcription kit (G3337), MIX (G3326), RIPA lysis solution (G2002), BCA protein quantification kit (G2026), 5× reduced protein loading buffer (G2013), SDS-PAGE gel preparation kit (G2003), protein Marker (G2083), PVDF membrane (WGPVDF45), ECL chemiluminescence kit (G2014), electrophoresis buffer (G2081), TBS buffer (G0001), Wuhan Sewell Biotechnology Co., Ltd.

[0056] 1.1.2 Instruments and equipment

[0057] Electronic balance (JM-A30002), Zhuji Chaoze Weighing Equipment Co., Ltd.; electric constant temperature water bath (HH-S4A), Beijing Kewei Yongxing Instrument Co., Ltd.; inverted microscope (TS100-F), Nikon, Japan; ultra-low temperature refrigerator (88500V), multi-function fluorescence chemiluminometer (Varioskan Flash), Thermo Fisher Scientific, USA; fluorescence quantitative PCR instrument (CFX Connect), Bio-Rad, USA; clean bench (SW-CJ-1FD), Suzhou Antai Air Technology Co., Ltd.; magnetic stirrer (MS-150), decolorization shaker (DS-3D100), vertical electrophoresis instrument (SVE-2), electrophoresis power supply (SPW-6S), antibody incubation box (G9055-4), chemiluminometer (6100), Wuhan Sewell Biotechnology Co., Ltd.

[0058] 1.2 Test methods

[0059] 1.2.1 Chemical method for detecting antioxidant activity of CP2

[0060] (1) Detection of hydroxyl radical scavenging rate of CP2

[0061] CP2 and Vit C solutions were used as test solutions, and were recorded as CP2 group and control group, respectively. 300 μL 9mmol / L ferrous sulfate solution and 300 μL 8mmol / L H 2 O 2 Add to 1 mL of the test solution (concentrations are 0, 0.125, 0.25, 0.50, 1.00, 2.00 mg / mL), shake well, let stand for 10 min, add 300 μL of 9 mmol / L salicylic acid ethanol solution prepared with 50% ethanol, incubate at 37°C for 30 min, cool to room temperature, measure the absorbance at 510 nm, and record it as A1. Use distilled water instead of H 2 O 2 , measure the absorbance, recorded as A2; use distilled water instead of ferrous sulfate solution and H 2 O 2 , measure the absorbance, record it as A0. Calculate the hydroxyl radical scavenging rate according to the formula: Hydroxyl radical scavenging rate (%) = (A0-A1+A2) / A0×100.

[0062] (2) Detection of DPPH free radical scavenging rate of CP2

[0063] CP2 and Vit C solutions were used as test solutions, and were recorded as CP2 group and control group, respectively. 100 μL of the test solution (concentrations were 0, 0.125, 0.25, 0.50, 1.00, 2.00 mg / mL) was mixed with 100 μL of 0.2 mmol / L DPPH solution, placed at 37°C in the dark for 30 min, and the absorbance was measured at 517 nm, which was recorded as A1. Distilled water was used to replace the test solution, and the absorbance was measured, which was recorded as A0. The DPPH free radical scavenging rate was calculated according to the formula. DPPH free radical scavenging rate (%) = (A0-A1) / A0×100.

[0064] (3) Detection of lipid peroxidation inhibition rate of CP2

[0065] CP2 and Vit C solutions were used as test solutions, and were recorded as CP2 group and control group, respectively. 1 mL of lecithin solution (30 mg of lecithin, dissolved in 3 mL of 10 mmol / L pH = 7.4 phosphate buffer) was added to 1 mL of test solution (concentrations were 0, 0.25, 0.50, 1.00, 2.00, 4.00 mg / mL), mixed, and then 1 mL of 0.4 mmol / L ferric chloride was added, and incubated at 37°C for 60 min. After incubation, 2 mL of TCA-TBA-HCl solution (15 g of trichloroacetic acid, 0.37 g of thiobarbituric acid and 2 mL of concentrated hydrochloric acid were dissolved in ultrapure water and fixed to 100 mL) was added, cooled after boiling in a water bath for 15 min, centrifuged at 6000 r / min for 10 min, and the supernatant was taken to measure the absorbance at 532 nm, which was recorded as A1. Ultrapure water was used to replace the test solution, and the absorbance was measured, which was recorded as A0. The lipid peroxidation inhibition rate was calculated according to the formula: Lipid peroxidation inhibition rate (%) = (A0-A1) / A0×100

[0066] (4) Detection of transition metal ion chelation rate of CP2

[0067] CP2 and EDTA-Na 2 The solutions were used as the test solutions and were recorded as the CP2 group and the control group. Take 10 μL of 4 mmol / L ferrous sulfate solution and add it to 500 μL of the test solution (concentrations are 0, 0.25, 0.50, 1.00, 2.00, 4.00 mg / mL), mix well, react at room temperature for 3 minutes, then add 10 μL of 20 mmol / L ferroxine solution, mix well, react at room temperature in the dark for 10 minutes, and use a spectrophotometer to measure the absorbance at 562 nm, recorded as A1. Replace the test solution with distilled water, measure the absorbance, recorded as A0. Calculate the transition metal ion chelation rate according to formula 3-4. Transition metal chelation rate (%) = (A0-A1) / A0×100

[0068] (5) Detection of the reducing power of CP2

[0069] CP2 and Vit C solutions were used as test solutions, and were recorded as CP2 group and control group, respectively. Take 0.51g sodium acetate to 2mL glacial acetic acid, dilute to 25mL, as working solution 1; take 0.078g TPTZ powder, add 83μL concentrated hydrochloric acid, dilute to 25mL with distilled water, as working solution 2; weigh 0.162g ferric chloride to 30mL distilled water, shake well, as working solution 3. Working solutions 1, 2, and 3 were mixed in a volume ratio of 10:1:1 to prepare FRAP working solution. Take 0.5mL of the test solution (concentrations of 0, 0.50, 1.00, 2.00, 4.00, and 8.00 mg / mL), add 3mL of FRAP working solution, shake well, heat in a constant temperature water bath at 37℃ for 10min, and measure the absorbance at 593nm, which is recorded as A1. Replace the test solution with distilled water, measure the absorbance, and record it as A0. The reducing power is calculated according to formula 3-5: reducing power = A1 - A0.

[0070] 1.2.2 RAW264.7 cell recovery and culture

[0071] The cell cryopreservation tube was taken out from the ultra-low temperature refrigerator and immediately placed in a 37°C constant temperature water bath to thaw. After there was no ice residue in the tube, centrifuged at 1500r / min for 5min, and then the cryopreservation tube was opened under a sterile environment to remove the precipitate and resuspend it in complete culture medium to prepare a cell suspension.

[0072] The RAW264.7 cell suspension was placed at 37°C, 95% O 2 and 5% CO 2 The cells were cultured in a constant temperature incubator, and when the cell density exceeded 70% under an inverted microscope, the cells were subcultured at a ratio of 1:3. During the subculture process, the cells were blown with a 1 mL pipette to separate the cells from the culture dish, and the use of trypsin was avoided to prevent cell differentiation.

[0073] 1.2.3 Establishment of RAW264.7 cell oxidative stress model

[0074] (1) Inoculation: Take cells that are in the logarithmic growth phase and in good growth condition and inoculate them at 5×10 cells per well. 4 The cells were inoculated at a density of 100 μL / mL in a 96-well plate. The culture medium was discarded after culturing for 12 h.

[0075] (2) Grouping: A blank group (group C) and a model group (group M) were set up. 100 μL of complete culture medium was added to group C, and 100 μL of H2O2 at concentrations of 250, 300, 350, 400, and 450 μmol / L was added to group M. 2 O 2 After culturing for 6 h, the culture medium was discarded.

[0076] (3) Calculation of cell survival rate: The MTS method was used to determine the survival rate of RAW264.7 cells. 10 μL of MTS detection solution was added to each well. After incubation in the dark for 2 h, the absorbance of each well at 490 nm was measured by an ELISA instrument. The absorbance of group M was recorded as A1, and the absorbance of group C was recorded as A2. The cell survival rate was calculated according to formula 3-6. When the cell survival rate was close to 50%, H was selected. 2 O 2 The concentration was used as the modeling concentration for subsequent experiments. Cell survival rate % = A1 / A2×100.

[0077] 1.2.4 Effect of CP2 on the survival rate of normal RAW264.7 cells

[0078] (1) Vaccination: Same as 1.2.3.

[0079] (2) Grouping: C group and CP2 group were set up. 100 μL complete culture medium was added to C group; 100 μL complete culture medium containing CP2 was added to CP2 group, with final concentrations of 1.25, 2.5, 5, 10, 20, and 40 μg / mL. After culturing for 24 hours, the culture medium was discarded.

[0080] (3) Calculation of cell survival rate: Same as 1.2.3(3). The absorbance of group CP2 is recorded as A1, and the absorbance of group C is recorded as A2. The cell survival rate is calculated according to the formula, and the concentration range that has no inhibitory effect on the survival rate of RAW264.7 cells is selected for the detection in 1.2.5.

[0081] 1.2.5 Effect of CP2 on the survival rate of RAW264.7 cells induced by oxidative stress

[0082] (1) Vaccination: Same as 1.2.3.

[0083] (2) Grouping: C group, M group and CP2 group were set up. 100 μL complete culture medium was added to C group, and 100 μL containing 400 μmol / L H 2 O 2 Complete medium was added, and the culture medium was discarded after 6 hours of continuous culture. Then 100 μL of complete medium was added to the C and M groups; 100 μL of complete medium containing CP2 was added to the CP2 group, with final concentrations of 1.25, 2.5, 5, 10, and 20 μg / mL. After 24 hours of continuous culture, the culture medium was discarded.

[0084] (3) Calculation of cell survival rate: Same as 1.2.3(3). The absorbance of group M and CP2 is recorded as A1, and the absorbance of group C is recorded as A2. The cell survival rate is calculated according to the formula, and the optimal concentration of CP2 to alleviate oxidative stress in RAW264.7 cells is selected for detection in 1.2.6.

[0085] 1.2.6 Effects of cow placental antioxidant peptides on antioxidant-related indicators in oxidative stress cells

[0086] (1) Inoculation: Take cells that are in the logarithmic growth phase and in good growth condition and inoculate them at 1×10 per well. 6 The cells were inoculated at a density of 1000 μg / mL in a 6-well plate with an inoculation volume of 2000 μL. The culture medium was discarded after culturing for 12 h.

[0087] (2) Grouping: C group, M group and CP2 group were set up. 2000 μL complete culture medium was added to C group, and 2000 μL containing 400 μmol / L H 2 O 2 The complete medium was added for 6 hours and then the medium was discarded. Then 2000 μL of complete medium was added to the C and M groups, and 2000 μL of complete medium containing 20 μg / mL CP2 was added to the CP2 group. After 24 hours of continuous culture, the medium was discarded.

[0088] (3) Determination of cell antioxidant indexes: After washing three times with phosphate buffer, the cell suspension was collected with phosphate buffer for detection of antioxidant pathway genes and proteins in 1.2.7 and 1.2.8. The intracellular levels of SOD, CAT, GSH-Px and MDA were detected according to the instructions of the ELISA kit.

[0089] 1.2.7 Detection of relative expression of Keap1, Nrf2 and HO-1 mRNA

[0090] (1) Extracting RNA: Use RNA extraction solution to extract the intracellular RNA in 1.2.6.

[0091] (2) Reverse transcription: Perform reverse transcription on ice according to the instructions of the reverse transcription kit.

[0092] (3) Primer design: Primers were designed using primer 5 software and species-specific primer alignment was performed using the NCBI Primer-Blast system. HO-1 gene upstream primer: GCTAAGACCGCCTTCC-TGCT, downstream primer: ACGAAGTGACGCCATCTGTGA; Nrf2 gene upstream primer: TGTCTTAATACCGAAAACAAGCAGC, downstream primer: GACCACAGTTGCCCACTT-CTTTT; Keap1 upstream primer: CAGATTGACAGCGTGGTTCG, downstream primer: TGCGGGCAGTCGTATTTGA; GAPDH upstream primer: CCTCGTCCCGTAGACAA-AATG, downstream primer: TGAGGTCAATGAAGGGGTCGT.

[0093] (4) Detection: Take 0.1mL PCR reaction plate, add 7.5μL Mix, 1.5μL upstream and downstream primers, 2.0μL cDNA and 4.0μL sterile water to each well. Amplification conditions: pre-denaturation at 95℃ for 30s; denaturation at 95℃ for 15s; annealing at 60℃ for 30s; 40 cycles. GAPDH was used as the internal reference gene, and 2 -ΔΔCT Methods Analytical data.

[0094] 1.2.8 Detection of Keap1, Nrf2 and HO-1 protein expression

[0095] Take the cell suspension in 1.2.6 and lyse the cells with RIPA lysis buffer on ice at 4℃. Measure the protein concentration of each group according to the instructions of the BCA protein concentration assay kit. Use SDS-PAGE gel electrophoresis to separate, transfer and block, add primary antibody, incubate overnight, add secondary antibody, incubate at room temperature for 30 minutes, wash with TBST buffer, and observe with a chemiluminescence instrument.

[0096] 1.2.9 Effects of temperature, pH, and digestion environment on the antioxidant activity of CP2

[0097] (1) To determine the effect of temperature on the antioxidant activity of CP2.

[0098] Place 1 mL of 2.00 mg / mL CP2 solution in a 2 mL centrifuge tube and divide it into 4 groups. Heat them in a water bath at 25°C, 50°C, 70°C, and 90°C for 1 h, then quickly cool them in an ice water bath. Finally, determine and calculate the DPPH free radical scavenging rate according to the method in 1.2.1 (2).

[0099] (2) Determine the effect of pH on the antioxidant activity of CP2.

[0100] Place 1 mL of 2.00 mg / mL CP2 solution in a 2 mL centrifuge tube and divide it into 5 groups. Use 1 mol / L hydrochloric acid and sodium hydroxide solution to adjust the pH value of each group to 3, 5, 7, 9, and 11, respectively. After reacting at room temperature for 2 h, use 1 mol / L sodium hydroxide and hydrochloric acid solution to adjust the pH value to 7. Finally, determine and calculate the DPPH free radical scavenging rate according to the method in 1.2.1 (2).

[0101] (3) Determine the effect of digestive environment on the antioxidant activity of CP2.

[0102] 1 mL of 2.00 mg / mL CP2 solution was placed in 2 mL centrifuge tubes and divided into a non-digestion group (N group), a gastric digestion group (G group), and a gastrointestinal digestion group (GI group).

[0103] Group N: Take CPAP solution without any treatment. Determine and calculate the DPPH free radical scavenging rate according to the method in 1.2.1(2).

[0104] Group G: 4% pepsin solution was added to the CPAP solution, and the pH value was adjusted to 2 with 1 mol / L hydrochloric acid solution. The solution was reacted in a 37°C water bath for 2 h to simulate gastric digestion. After digestion, the solution was placed in a boiling water bath for 10 min to terminate gastric digestion. The DPPH free radical scavenging rate was determined and calculated according to the method in 1.2.1(2).

[0105] GI group: After the CPAP solution was digested in the stomach according to the operation procedure of group G, the pH value was adjusted to 5.3 with 0.9 mol / L sodium bicarbonate, and then to 7.5 with 1 mol / L sodium hydroxide. Trypsin was added according to the 4% polypeptide content, and intestinal digestion was simulated in a 37°C water bath. After the reaction for 1 hour, the solution was taken out and boiled in a water bath for 10 minutes to terminate intestinal digestion. The DPPH free radical scavenging rate was determined and calculated according to the method in 1.2.1(2).

[0106] 1.3 Data Analysis

[0107] SPSS26.0 software was used for statistical analysis, and the mean ± standard deviation of each index was calculated. Dunnett's T3 method was used for significance analysis. P>0.05 indicated no significant difference, P<0.05 indicated significant difference, and P<0.01 indicated extremely significant difference. GraphPad Prism 9.0.0 software was used for drawing. Compared with group C, "#" and "##" represent P<0.05 and P<0.01, respectively. Compared with group M, "*" and "**" represent P<0.05 and P<0.01, respectively.

[0108] 2 Results and analysis

[0109] 2.1 Chemical detection of CP2 antioxidant activity

[0110] Depend on Figure 3 It can be seen that the hydroxyl radical and DPPH free radical scavenging rates, lipid peroxidation inhibition rate, transition metal chelation rate and reducing power of CP2 increased with the increase of sample concentration, but its hydroxyl radical and DPPH free radical scavenging rates, lipid peroxidation inhibition rate and reducing power were significantly lower than those of Vit C, and its transition metal chelation rate was significantly lower than that of EDTA-Na 2 (P<0.01). CP2 hydroxyl radical scavenging rate IC 50 The DPPH free radical scavenging rate IC 50 The transition metal chelation capacity IC is 1.80 mg / mL. 50 The IC value of lipid peroxidation inhibition rate is 3.47 mg / mL. 50 The value is 3.62 mg / mL, and the reducing power is 0.42 at 8 mg / mL. Therefore, CP2 has good free radical scavenging ability, lipid peroxidation inhibition ability, transition metal chelating ability and reducing power.

[0111] 2.2H 2 O 2 Effects on the survival rate of RAW264.7 cells

[0112] The MTS method was used to determine the 2 O 2 Effects on RAW264.7 cell activity, see Figure 4 The cell survival rate increases with H 2 O 2 The concentration increases and decreases. 2 O 2 When the concentration was 200 μmol / L, the cell survival rate was higher than 90.00%, which was not significantly different from group C (P>0.05). When the concentration was 250 μmol / L, the cell survival rate was higher than 80.00%, which was significantly different from group C (P<0.05). When the concentration was 300-450 μmol / L, the cell survival rate was significantly different from group C (P<0.01). 2 O 2 When the concentration was 400 μmol / L, the cell survival rate dropped to 48.34±2.75%. At this time, the cells reached the damage requirement and still had a certain vitality, which met the requirements of the oxidative stress model. Therefore, 400 μmol / L was selected as the H 2 O 2 Concentrations that induce oxidative stress in RAW264.7 cells.

[0113] Effect of 2.3CP2 on the survival rate of normal and oxidatively stressed RAW264.7 cells

[0114] The MTS method was used to determine the effects of different concentrations of CP2 on the activity of normal RAW264.7 cells. The results are shown in Figure 5. When the CP2 concentration was 1.25-20.00μg / mL, the cell survival rate was not significantly different from that of group C (P>0.05). When the CP2 concentration was 40.00μg / mL, the cell survival rate was significantly lower than that of group C (P<0.01). Therefore, 1.25-20.00μg / mL was selected as the concentration range of CP2 to protect RAW264.7 cells. The effect of different concentrations of CP2 on the activity of oxidatively stressed RAW264.7 cells. After culturing oxidatively stressed RAW264.7 cells with CP2, the cell survival rate increased with the increase of CP2 concentration. After culturing with 1.25-5.00μg / mL CP2, the cell survival rate was not significantly different from that of group M (P>0.05); after culturing with 10.00-20.00μg / mL CP2, the cell survival rate was significantly higher than that of group M (P<0.01). After culture with 20.00 μg / mL CP2, the cell survival rate recovered to the highest level, which was 70.14±2.26%. Therefore, 20.00 μg / mL was selected as the concentration of CP2 to alleviate the oxidative stress of RAW264.7 cells.

[0115] Effects of 2.4CP2 on antioxidant indices of oxidative stress RAW264.7 cells

[0116] like Figure 6 As shown, H 2 O 2 After induction, the levels of antioxidant enzymes SOD, CAT and GSH-Px in RAW264.7 cells were extremely significantly decreased, and the level of MDA was extremely significantly increased (P<0.01). After CP2 culture, the levels of SOD and CAT in the cells were extremely significantly higher than those in the M group (P<0.01), and the SOD level recovered to 75.11±6.87ng / mL, and the CAT level recovered to 1386.22±92.26pg / mL; the GSH-Px level was significantly higher than that in the M group (P<0.05), and recovered to 78.50±5.61ng / mL; the MDA level was significantly lower than that in the M group, and dropped to 27.50±2.42nmol / mL (P<0.05). The results showed that CP2 could increase the levels of antioxidant enzymes in oxidative stress cells, reduce the level of MDA, and protect cells from oxidative stress.

[0117] Effects of 2.5CP2 on antioxidant pathways in RAW264.7 cells subjected to oxidative stress

[0118] like Figure 7 As shown, H 2 O 2 It can lead to a very significant increase in the expression of Keap1 gene and protein in RAW264.7 cells (P<0.01), and a very significant decrease in the expression of Nrf2 and HO-1 genes and proteins (P<0.01). CP2 culture can significantly reduce the expression of Keap1 gene (P<0.01) ( Figure 7A), and significantly increased the expression of Nrf2 and HO-1 genes (P<0.01) ( Figure 7 B, C). At the same time, CP2 significantly reduced the expression of Keap1 protein (P<0.01) and significantly increased the expression of Nrf2 and HO-1 proteins (P<0.01) ( Figure 7 D, E), which is consistent with the gene expression results. This shows that CP2 can activate the Keap1 / Nrf2 pathway in RAW2664.7 cells with oxidative stress, thereby alleviating the oxidative stress of RAW264.7 cells.

[0119] 2.6 Effects of temperature, pH, and digestion environment on the antioxidant activity of CP2

[0120] like Figure 8 As shown in the figure, the CP2 DPPH radical scavenging rate decreased with the increase of temperature. The CP2 DPPH radical scavenging rate was significantly different at different temperatures (P<0.05). At 25-50℃, 50-70℃ and 70-90℃, CP2 decreased by 8.60%, 26.97% and 49.92%, respectively. This shows that temperature can affect the antioxidant activity of CP2, and its antioxidant activity is best at 25℃.

[0121] The DPPH free radical scavenging rate of CP2 decreased with the increase of acidity and alkalinity. Except that there was no significant difference between the free radical scavenging rate of CP2 at pH = 3 and pH = 9 (P>0.05), the free radical scavenging rate of CP2 was significantly different at different pH values ​​(P<0.05). When the pH values ​​were 7-5, 5-3, 7-9, and 9-11, CP2 decreased by 12.52%, 39.96%, 43.89%, and 31.25%, respectively. The results showed that acidity and alkalinity can affect the antioxidant activity of CP2, and its antioxidant activity is best at pH = 7.

[0122] The CP2 DPPH radical scavenging rate decreased as it was digested and decomposed. The CP2 radical scavenging rates in the G and GI phases were significantly lower than those in the N phase (P<0.01). The CP2 radical scavenging rate in the G phase decreased by 79.21%, and the CP2 radical scavenging rate in the GI phase decreased by 86.28%. The above results indicate that gastric digestion and gastrointestinal digestion affect the antioxidant activity of CP2, and its antioxidant activity is best in a non-digestive environment.

Claims

1. A method for preparing cow placenta extract CP2 and application of cow placenta extract CP2 as an antioxidant, characterized in that: The steps include: Step 1, the cow placenta was cut into pieces and homogenized with a tissue homogenizer, papain was added, and the mixture was inactivated at pH 6.5 and 55°C for 4.7 hours, and then centrifuged after being inactivated in a boiling water bath for 10 minutes, and the supernatant was collected, freeze-dried, and freeze-dried for later use, which was recorded as CPE; Step 2, the CPE obtained in step 1 is further separated by ion exchange chromatography; 25 mL of 30DEAE cellulose ion exchange resin filler is loaded into a 2×20 cm glass chromatography column, and the chromatographic column is washed and balanced with 3 column volumes of phosphate buffer (pH = 7.4); an appropriate amount of CPE is added to phosphate buffer (pH = 7.4) to prepare a 50 mg / mL sample solution, and the sample solution is added 2 cm away from the column surface; After loading, phosphate buffer (pH=8.0) containing sodium chloride (0, 0.2, 0.4, 0.6 mol / L) was used for gradient elution at a rate of 2 mL / min; 2 mL of the eluate was collected in each tube, the absorbance was detected at 280 nm, and the elution curve was drawn; The eluate was divided into multiple fractions according to the elution curve; the DPPH free radical scavenging capacity of each fraction was measured (the concentration of each fraction was 5 mg / mL), and the fraction with the strongest antioxidant activity in step 2 was obtained; Step 3, the fraction with the strongest antioxidant activity in step 2 is separated by molecular sieve chromatography; 20 g of Sephadex G25 gel filler is weighed, 200 mL of deionized water is added to swell in a boiling water bath for 2 h, the pH value is adjusted to 6.5, impurities suspended on the water surface are poured out, and then slowly loaded into a 2×30 cm glass chromatography column, about 5 cm from the top of the column, and 3 column volumes are balanced with deionized water at 3 mL / min; the fraction with the strongest antioxidant activity obtained in step 2 is taken, deionized water is added to prepare a 20 mg / mL sample solution, and then 1 mL of the sample solution is taken, and the sample solution is added 2 cm from the column surface, and then deionized water is used as the eluent at a flow rate of 3 mL / min for elution, and finally 2 mL of the eluent is collected in each tube, the absorbance is detected at 280 nm, and an elution curve is drawn; The eluate was divided into multiple fractions according to the elution curve, and the DPPH free radical scavenging ability was measured after freeze-drying (concentration was 5 mg / mL), and the fraction with the strongest antioxidant activity in step 3 was obtained; Step 4, using RP-HPLC to separate the fraction with the strongest antioxidant activity in step 3; using Waters 2695 high performance liquid chromatograph for separation, taking the fraction with the strongest antioxidant activity obtained in step 3; preparing the lyophilized powder of the fraction into a 5 mg / mL sample solution, using a C18 reverse phase chromatographic column (4.6x250 mm) as the analytical column, 98% ultrapure water and 2% acetonitrile as mobile phase A, 2% ultrapure water and 98% acetonitrile as mobile phase B, and using linear gradient elution after loading, with a flow rate of 0.7 mL / min, and elution conditions, 0-5 min, mobile phase B 5%-8%; 5-40 min, mobile phase B 8% to 18%; 40 to 62 min, mobile phase B 18% to 32%; 62 to 64 min, mobile phase B 32% to 95%; detect absorbance at 214 nm, and the eluate can be divided into multiple fractions according to the liquid chromatogram; after freeze-drying each fraction, measure the DPPH free radical scavenging ability (the concentration of each fraction is 0.1 mg / mL), and obtain the fraction with the strongest antioxidant activity in step 4; Step 5, using LC-MS / MS to identify the fraction with the strongest antioxidant activity in step 4; using Easy-nLC high performance liquid chromatograph connected in series with Q-Exactive mass spectrometer to identify the polypeptide amino acid sequence in the fraction with the strongest antioxidant activity obtained in step 4; dissolving the fraction in 0.1% formic acid aqueous solution as a sample solution; liquid chromatography conditions, using a C18 reverse phase chromatographic column (0.15 mm×150 mm, 3 μm) as the analytical column, 0.1% formic acid aqueous solution as mobile phase A, 0.1% formic acid and 80% acetonitrile aqueous solution as mobile phase B, linear gradient elution after loading, flow rate of 600 nL / min, elution conditions, 0-2 min, mobile phase B 4%-8%; 2-45 min, mobile phase B 8%-28%; 45-55 min, mobile phase B 28%-40%; 55-56 min, mobile phase B 40%~95%; mass spectrometry analysis conditions are as follows: primary mass spectrometry parameters, Resolution is 70000, AGCtarget is 3e6, MaximumIT is 100ms, Scanrange is 100to 1500m / z; secondary mass spectrometry parameters, Resolution is 17500, AGCtarget is 1e5, MaximumIT is 50ms, TopN is 20, NCE / steppedNCE is 28; finally, the peptide with the highest abundance in the identification results is selected and recorded as CP2; Step 6: According to the CP2 amino acid sequence, CP2 can be synthesized by solid phase method with a purity greater than 95%. The cow placenta extract CP2 of the present invention is QPGLPGPAG (H-Gln-Pro-Gly-Leu-Pro-Gly-Pro-Ala-Gly-OH), with a molecular formula of C 35 H 56 N 10 O 11 , molecular weight 792.89Da.

2. Use of the cow placenta extract CP2 obtained according to the extraction method described in claim 1 as an antioxidant.

Images