Gender-specific genome sequence of scylla paramamosain and genetic sex identification method

Abstract

The invention relates to a sex-specific genome sequence of scylla paramamosain and a genetic sex identification method. The sex-specific genome sequence is as shown in SEQ NO.1 and SEQ NO.2; wherein the genomes of the individuals with the genetic sex being female contain the sequences SEQ NO.1 and SEQ NO.2 at the same time, and the genomes of the individuals with the genetic sex being male only contain the sequences SEQ NO.2. Meanwhile, the invention also develops a genetic sex identification method based on a PCR (Polymerase Chain Reaction) technology by utilizing the sex specific sequence. The method can be used for identification of sex specific large fragments of scylla paramamosain and rapid detection of genetic sex, has the advantages of high specificity, high accuracy, simplicity and convenience in operation, low cost and the like, can be used in the fields of scylla paramamosain sex control breeding industry, sex determination and differentiation mechanism research and the like, and has a wide application prospect.

Description

Technical Field

[0001] The invention belongs to the technical field of sex regulation and genetic sex identification of marine crabs, and particularly relates to a sex-specific genome sequence of a mud crab and a genetic sex identification method. Background Art

[0002] The mud crab belongs to the family Portunidae of the order Portunidae of the order Crustacea. It is widely distributed on the coasts of Asia. It is an important economic crab in China, Japan, the Mekong River region, and Vietnam. It is also an important aquaculture invertebrate species in China. In 2020, the production of artificially cultivated mud crabs and marine catches reached 140,738 and 71,196 tons respectively. Due to its high nutritional value, strong tolerance and easy transportation, it has a high market value.

[0003] Green crabs show obvious sexual dimorphism, such as body size, growth rate, nutritional value, degree of gonad development, etc., and these traits have high economic value. Compared with females, males tend to have larger bodies, but female crabs of the same size tend to grow faster. Female green crabs with mature ovaries and full gonads are more favored by the market and have higher economic value. Therefore, sex traits, especially female proportion traits, are one of the important traits for future breeding of pseudo-burrowing green crabs. The current theory of sex-controlled breeding technology and key technical methods of crabs are still imperfect, which is a key factor restricting the sex control of crabs. Summary of the invention

[0004] The technical problem to be solved by the present invention is to provide a sex-specific genome sequence of mud crab and a genetic sex identification method, which can accurately and quickly identify the genetic sex of mud crab individuals on a large scale.

[0005] The invention provides a sex-specific genome sequence of a mud crab, wherein the sex-specific genome sequence is a sequence shown as SEQ NO.1 and a sequence shown as SEQ NO.2; wherein the genome of a female individual with genetic sex contains both SEQ NO.1 and SEQ NO.2 sequences, and the genome of a male individual with genetic sex contains only SEQ NO.2 sequence.

[0006] Furthermore, the indels of the sex-specific genomic sequence are 4 insertions or deletions that can only be detected in the genome of female individuals, which are respectively a 3bp and 8bp deletion compared to the SEQ NO.2 sequence, and a 2bp and a 1bp insertion.

[0007] Furthermore, the SNP sites of the sex-specific genomic sequence refer to the SNP sites at positions 154, 175, 192, 231, 246, 251, 252, 270, 284, 326, 359, 377, 387, 388, 390, 416, and 440 of SEQ NO. 1 in the female genome, respectively.

[0008] The present invention also provides a method for genetic sex identification of mud crab, comprising the following steps:

[0009] (1) Extracting genomic DNA from the individual Scylla sylvatica to be identified: For the embryonic or zoea samples of Scylla sylvatica, a single individual was selected; for the megalopa or early crab samples of Scylla sylvatica, one cheliped was selected; for the individual from which blood could be drawn, 1 ml of blood was collected, anticoagulant was added, and the blood was centrifuged at 5000 rpm for 2 minutes to obtain blood cells;

[0010] (2) Using the genomic DNA extracted in step (1) as a template, PCR amplification was performed using control primers to obtain a PCR amplification product: wherein the control primers are: SEQ1-F: GCTGTGAAGCCAAACAACAAC; SEQ1-R: CCTCTTCTTTACACAGCCTCT;

[0011] (3) Perform agarose gel electrophoresis on the PCR amplification products obtained in step (2) and observe the electrophoresis results; all PCR products have a bright band at 225 bp. If there is no bright band, there is a problem with the template and it should be removed;

[0012] (4) The genomic DNA template verified in step (3) is amplified by PCR using female-specific primers, and then subjected to agarose gel electrophoresis; if a bright band appears at 224 bp, it is identified as female, and if no bright band appears at this position, it is identified as male; wherein the female-specific primers are: SEQ2-F: CTACTGTGAAGCCAAACAATT; SEQ2-R: TCCTAGCCTCTTCTTGATGTT.

[0013] Preferably, the reaction conditions for PCR amplification in steps (2) and (4) are: pre-denaturation at 94°C for 5 min; denaturation at 94°C for 30 s, annealing at 56°C for 30 s, extension at 72°C for 30 s, repeated for 30 cycles; and finally extension at 72°C for 7 min and storage at 4°C.

[0014] Preferably, the reaction system for PCR amplification in steps (2) and (4) is 25ul, including 12.5ul 2×TaqPCR Mix, the Taq enzyme should use a high-fidelity Taq enzyme with 3' to 5' exonuclease activity, 9.5ul ddH2O, 1ul each of the upstream and downstream primers, and 1ul of DNA template.

[0015] Preferably, the female-specific primers can be used to identify the genetic sex of Scylla pseudoburrowingii.

[0016] Beneficial Effects

[0017] (1) The present invention can be used to identify large sex-specific fragments of mud crabs and to quickly detect the genetic sex of individuals whose sex cannot be determined or pseudo-male or pseudo-female individuals. It has the advantages of high specificity, high accuracy, simple operation, and low cost. It can be used in the fields of sex-controlled breeding of mud crabs, research on sex determination and differentiation mechanisms, and has broad application prospects.

[0018] (2) The present invention designs female-specific primers that are suitable for a rapid, harmless, PCR-based sex verification method for different geographical populations, and can be used to distinguish between blue crab larvae whose sex is difficult to determine and pseudo-male and pseudo-female individuals caused by environmental conditions. The identification method is simple and effective. In addition, a pair of control primers are designed to verify the template, thereby avoiding inaccurate sex judgment caused by problems with the template itself. The present invention not only expands the method of genetic identification of blue crabs, but will also promote the research on sex regulation of blue crabs and lay the foundation for the single-sex breeding industry. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 The figure is the gel electrophoresis result using the identification method of the present invention. DETAILED DESCRIPTION

[0020] The present invention will be further described below in conjunction with specific embodiments. It should be understood that these embodiments are only used to illustrate the present invention and are not intended to limit the scope of the present invention. In addition, it should be understood that after reading the content taught by the present invention, those skilled in the art can make various changes or modifications to the present invention, and these equivalent forms fall within the scope limited by the appended claims of the application equally.

[0021] Example 1

[0022] 1. Sequence acquisition

[0023] A total of 218 individuals (108 females and 110 males) from seven populations of Scylla pseudoburrows were analyzed by genome resequencing. -10 1457 sex difference sites were screened and identified, all of which showed the characteristics of being mostly homozygous in males and mostly heterozygous in females, indicating that the sex determination type of the mud crab may be ZW type. The differences in some sex difference sites between male and female individuals were analyzed by first-generation sequencing, and a sequence of sex difference was discovered, namely the sequences shown in SEQ NO.1 and SEQ NO.2.

[0024] 2. Primer Design

[0025] Primers were designed using Primer Premier 5.0 software based on known DNA sequences and female-specific SNP sites.

[0026] In order to avoid the situation where no band is amplified due to template problems, which may lead to misjudgment of the results, a pair of primers was designed as a control, and their nucleotide sequences are as follows:

[0027] SEQ1-F:GCTGTGAAGCCAAACAACAAC;

[0028] SEQ1-R:CCTCTTCTTTACACAGCCTCT.

[0029] Based on the female Scylla pseudoburrowing specific DNA fragment as the target sequence, a pair of Scylla pseudoburrowing female specific primers were designed, and the nucleotide sequences are as follows:

[0030] SEQ2-F:CTACTGTGAAGCCAAACAATT;

[0031] SEQ2-R: TCCTAGCCTCTTCTTGATGTT.

[0032] 3. Sampling and Extraction of Genomic DNA

[0033] (1) Take 20 live mud crabs of known sex, including 10 males and 10 females. Take blood cell tissue and store it at -80℃ for later use. (2) The method for extracting genomic DNA is as follows: for samples of mud crab embryos or zoea, take a single individual; for samples of mud crab megalopa or early crablets, take one cheliped; for individuals from which blood can be drawn, take 1 ml of blood, add anticoagulant, centrifuge at 5000rpm for 2 minutes, and obtain blood cells. Use an animal tissue genomic DNA extraction kit to extract DNA from the sample, extract genomic DNA, measure the concentration, and then dilute to 100ng / μL; store in a -20℃ refrigerator for later use.

[0034] 4. PCR Amplification

[0035] The genomic DNA obtained in step 2 was used as a template for PCR amplification; the reaction system used for PCR amplification was 25ul, including 12.5ul 2×Taq PCR Mix, the Taq enzyme needed to use a high-fidelity Taq enzyme with 3' to 5' exonuclease activity, 9.5ul ddH2O, 1ul each of the upstream and downstream primers, and 1ul of DNA template; the reaction conditions for PCR amplification were: pre-denaturation at 94°C for 5min; denaturation at 94°C for 30s, annealing at 56°C for 30s, extension at 72°C for 30s, repeated for 30 cycles; finally extension at 72°C for 7min, and storage at 4°C.

[0036] 5. Detection of PCR products by agarose gel electrophoresis

[0037] (1) Agarose gel electrophoresis: Prepare 1.5% agarose gel, take 5 μL of 2K DNA Marker for loading, take 5 μL of each sample to be tested, add 1 μL of 6× loading buffer, and the electrophoresis conditions are: voltage 180 V, time 20-25 min.

[0038] (2) Gel imaging: After electrophoresis, place the agarose gel into a gel imager, set appropriate parameters, and then expose and take pictures.

[0039] 6. Determination of electrophoresis results

[0040] The effectiveness of the primers can be determined based on the presence or absence of specific bands. Figure 1 As shown, M is a 2k DNA marker, and the bands from top to bottom are 2000bp, 1000bp, 750bp, 500bp, 250bp, and 100bp. The control primers have a very bright band in both male and female individuals; the female-specific primers have a brighter band in genetically female individuals, but no band appears in genetically male individuals.

Claims

1. A sex-specific genome sequence of Scylla pseudoburrowingii, characterized in that: The sex-specific genome sequences are sequences shown as SEQ NO.1 and SEQ NO.2; wherein, the genome of a female individual with genetic sex contains both SEQ NO.1 and SEQ NO.2 sequences, and the genome of a male individual with genetic sex contains only SEQ NO.2 sequence.

2. The genome sequence according to claim 1, characterized in that: The indels of the sex-specific genomic sequence are 4 insertions or deletions that can only be detected in the haploid genome of female individuals with genetic sex, which are respectively a 3bp and 8bp deletion compared to the SEQ NO.2 sequence, and a 2bp and a 1bp insertion.

3. The genome sequence according to claim 1, characterized in that: The SNP sites of the sex-specific genomic sequence refer to the SNP sites at positions 154, 175, 192, 231, 246, 251, 252, 270, 284, 326, 359, 377, 387, 388, 390, 416, and 440 of SEQ NO. 1 in the female genome, respectively.

4. A method for genetic sex identification of mud crab, comprising the following steps: (1) Extracting genomic DNA from individual mud crabs to be identified: for samples of mud crab embryos or zoea, a single individual was taken; for samples of megalopa or early crab larvae, the chelipeds were taken; for individuals from which blood could be drawn, blood was taken, anticoagulant was added, and blood cells were obtained by centrifugation; (2) using the genomic DNA extracted in step (1) as a template and using control primers to perform PCR amplification to obtain a PCR amplification product: wherein, The control primers are: SEQ1-F: GCTGTGAAGCCAAACAACAAC; SEQ1-R: CCTCTTCTTTACACAGCCTCT; (3) Perform agarose gel electrophoresis on the PCR amplification products obtained in step (2) and observe the electrophoresis results; all PCR products have a bright band at 225 bp. If there is no bright band, there is a problem with the template and it should be removed; (4) using female-specific primers to perform PCR amplification on the genomic DNA template verified in step (3), and performing agarose gel electrophoresis; If a bright band appears at 224 bp, it is identified as female, and if there is no bright band at this position, it is identified as male; wherein the female-specific primers are: SEQ2-F: CTACTGTGAAGCCAAACAATT; SEQ2-R: TCCTAGCCTCTTCTTGATGTT.

5. The method for genetic sex identification according to claim 4, characterized in that: The reaction conditions for PCR amplification in steps (2) and (4) are: pre-denaturation at 94°C for 5 min; denaturation at 94°C for 30 s, annealing at 56°C for 30 s, extension at 72°C for 30 s, repeated for 30 cycles; and finally extension at 72°C for 7 min and storage at 4°C.

6. The method for genetic sex identification according to claim 4, characterized in that: The reaction system for PCR amplification in steps (2) and (4) is 25ul, including 12.5ul 2×Taq PCR Mix, Taq enzyme, 9.5ul ddH2O, 1ul each of upstream and downstream primers, and 1ul DNA template.

Images