An SNP marker related to evaluating the onset risk of hereditary multiple osteochondroma and its application

By detecting the SNP marker rs557364026, using PCR and Sanger sequencing technology, the problem of risk assessment of genetic multiple osteochondroma was solved, accurate identification of high-risk populations was achieved, and the potential of FUT7 as a potential therapeutic target was revealed.

CN119193822BActive Publication Date: 2025-05-30SUN YAT SEN UNIVERSITY CANCER CENTER (CANCER HOSPITAL AFFILIATED TO SUN YAT SEN UNIVERSITY CANCER RESEARCH INSTITUTE OF SUN YAT SEN UNIVERSITY)
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202311132409.4
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2023-09-04
Publication Date
2025-05-30
Estimated Expiration
2043-09-04

AI Technical Summary

Technical Problem

The prior art is difficult to effectively evaluate the risk of genetic multiple osteochondroma, especially in high incidence populations.

Method used

By detecting the specific SNP marker rs557364026 (mutated form A>C, located in the FUT7 gene), the genotype of an individual is determined by using PCR amplification and Sanger sequencing technology to evaluate its risk of disease.

Benefits of technology

Accurate identification of high-risk populations of genetic multiple osteochondroma has been achieved, providing a genetic reference for early prevention and intervention, and revealing the possibility of FUT7 as a new potential therapeutic target.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119193822B_ABST
    Figure CN119193822B_ABST
Patent Text Reader

Abstract

The present invention provides an SNP marker related to evaluating the onset risk of hereditary multiple osteochondromas, and the marker is rs557364026, and the mutation form is A>C. The present invention also provides a kit for evaluating the onset risk of hereditary multiple osteochondromas, a method for evaluating the onset risk of hereditary multiple osteochondromas, a nucleic acid molecule, specific primers for detecting the SNP marker, and the application of the SNP marker. The present invention can accurately evaluate the onset risk of hereditary multiple osteochondromas.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The invention belongs to the technical field of biological detection, and specifically relates to a SNP marker related to evaluating the risk of hereditary multiple osteochondroma and an application thereof. Technical Background

[0002] Hereditary Multiple Exostoses (HME), also known as Hereditary Multiple Osteochondromas (HMO), is a type of autosomal dominant genetic disease. It is characterized by multiple benign bone tumors covered by cartilage caps. Because the disease can interfere with the growth of normal epiphyses and lead to bone deformities, most patients have short stature, abnormal limb alignment and functional impairment. The incidence of multiple osteochondromas shows obvious regional and familial characteristics. In the Caucasus, the incidence of osteochondroma is about 0.9-2.0 people per 100,000 people; in the Indian community in the Pauingassi region of Canada, the incidence is as high as 1,310 people per 100,000 people; in my country, more than 1,000 cases have been reported in the past 23 years. Since multiple osteochondromas are hereditary and have the possibility of malignant transformation into chondrosarcoma, the development of molecular markers for disease risk assessment will help identify individuals at high risk of hereditary multiple osteochondromas and provide a genetic reference for their early preventive intervention.

[0003] Genetic polymorphism refers to the phenomenon that two or more types of variation or genotypes coexist in the same biological population. Among them, single nucleotide polymorphism (SNP) is the most important and most common heritable variation, which is widely distributed in the human genome. At present, many studies have confirmed that specific SNPs can cause different individuals to have different susceptibility to diseases. In addition, the incidence of hereditary multiple osteochondroma is mainly affected by genetic factors. In summary, obtaining SNP detection for people with a high incidence of hereditary multiple osteochondroma is a technical problem that needs to be solved urgently in this field. Summary of the invention

[0004] The purpose of the present invention is to provide a SNP marker for evaluating the risk of hereditary multiple osteochondroma and its application, wherein the marker is specifically targeted at a high-risk population for hereditary multiple osteochondroma.

[0005] To achieve the above objectives, the present invention provides a SNP marker for evaluating the risk of hereditary multiple osteochondroma, wherein the SNP marker is rs557364026, and the mutation form is A>C (Chr9:139925298-A>C, FUT7c.893T>G, p.Phe298Cys).

[0006] On the other hand, the present invention also provides a kit for evaluating the risk of developing hereditary multiple osteochondromas. Among them, the kit includes specific primers for detecting the amplified SNP sites according to Claim 1. Preferably, the nucleotide sequences of the primers are as shown in SEQ ID NO: 1 to 4.

[0007] The primers are used to amplify the above SNP sites, and their nucleotide sequences (5'→3') are as follows:

[0008] The first pair of PCR primers: FUT7F1: CCCATAATCCCAGCTACTTG; FUT7R1: GCAAAGGCCCAGAAGTCA, and the length of the amplification product is 3.4 kb;

[0009] The second pair of nested primers: FUT7F2: AGAATCACTTGAACCCGGAAGGTGGAG; FUT7R2: CCCACGAGGCACTGCTCAGATGTTTAT, and the length of the amplification product is 3.2 kb.

[0010] Using the kit of the present invention, through PCR amplification, Sanger sequencing is performed on a single band of the obtained PCR product, so as to obtain the sequence information of the fragment. Then, the corresponding genotype of the tested person is obtained by comparing the sequence information, and heterozygous carriers can be distinguished. Finally, the risk of developing multiple osteochondromas in an individual is evaluated according to the genotype information of the site.

[0011] On the other hand, the present invention also provides a method for evaluating the risk of developing hereditary multiple osteochondromas. Among them, by detecting the SNP markers according to Claim 1, the gene type of the amplification product of the SNP markers is identified. When the gene type of rs557364026 in the detection result is C, it is determined as a high-risk population.

[0012] On the other hand, the present invention also provides a nucleic acid molecule for evaluating the risk of developing hereditary multiple osteochondromas. Among them, the nucleic acid molecule includes a nucleotide sequence as shown in SEQ ID NO: 5 (TACCAACGCTGCTTTGCCTGG).

[0013] On the other hand, the present invention also provides the use of the detection reagent of the nucleic acid molecule for preparing a kit for evaluating the risk of developing hereditary multiple osteochondromas.

[0014] On the other hand, the present invention also provides the use of the reagent for detecting the SNP markers in the preparation of a kit for evaluating the risk of developing hereditary multiple osteochondromas.

[0015] On the other hand, the present invention also provides the use of a reagent for regulating the expression of the gene FUT7 where the SNP marker is located in the preparation of a drug for treating hereditary multiple osteochondromas.

[0016] On the other hand, the present invention also provides a set of specific primers for detecting the SNP marker, wherein the nucleotide sequences of the primers are as shown in SEQ ID NO: 1 to 4.

[0017] The present invention is convenient for sampling, only requiring the peripheral blood of the detector, and is easy to operate. The SNP is detected by specific amplification primers, and the individual's disease risk is evaluated through the SNP results. By using the molecular diagnostic method of the present invention, the high-risk population of hereditary multiple osteochondromas can be accurately identified, and preventive intervention measures can be guided. The present invention also reveals a new potential therapeutic target FUT7 for hereditary multiple osteochondromas, which can be used to guide the treatment measures for patients with hereditary multiple osteochondromas, and thus be applied to scientific research and clinical work. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 Shows that the gene FUT7 regulates the expression of the hereditary multiple osteochondroma pathogenic gene EXT1. (A) After knocking down the expression of FUT7 or Fut7 in COS7 or ATDC5 cell lines using siRNA respectively, the expression changes of EXT1 or Ext1 mRNA were detected by qPCR. (B) After overexpressing FUT7WT or FUT7p.phe298Cys in COS7 or ATDC5 cell lines respectively, the expression changes of EXT1 or Ext1 mRNA were detected by qPCR. (C) After overexpressing FUT7WT or FUT7p.phe298Cys in COS7 or ATDC5 cell lines respectively, the expression changes of EXT1 protein were detected by western blot. *, p < 0.05; ***, p < 0.001; ****, p < 0.0001.

[0019] Figure 2 Shows the Sanger sequencing signal peak map of the rs557364026 (Chr9:139925298 - A>C) T / G heterozygous (HME risk type) locus, and the double peaks are indicated by the arrows in the figure.

[0020] Figure 3 Is the sequence alignment information map obtained by Sanger sequencing of the PCR product. The red font G is the mutation site, and the black bold font T is the base corresponding to the mutation site in the genome. DETAILED DESCRIPTION OF THE EMBODIMENTS

[0021] In order to more concisely and clearly demonstrate the technical solutions, objectives, and advantages of the present invention, the present invention will be further described in detail below with reference to specific embodiments.

[0022] The whole-exome sequencing method (WES) can efficiently screen out disease-susceptible SNPs. First, the inventor obtained a risk locus for hereditary multiple osteochondromas using the whole-exome sequencing method: rs557364026 (Chr9:139925298-A>C, FUT7c.893T>G, p.Phe298Cys). The 10 bp sequence information before and after the above SNP locus is as follows: TACCAACGCT[T / G]CTTTGCCTGG. The nucleic acid molecule containing this sequence (SEQ ID NO: 5 (TACCAACGCTGCTTTGCCTGG)) can be used to evaluate the risk of developing hereditary multiple osteochondromas. Then, the function of the gene - FUT7 where this SNP locus is located was analyzed to determine the relationship between FUT7 and hereditary multiple osteochondromas, clarify its mechanism of action, and evaluate its potential as a new therapeutic target.

[0023] The present invention further clarifies that the gene - FUT7 where this SNP is located has an important regulatory effect on hereditary multiple osteochondromas. FUT7 can regulate the expression of the pathogenic gene EXT1 of hereditary multiple osteochondromas, revealing a new potential therapeutic target for hereditary multiple osteochondromas.

[0024] The above risk-susceptible locus was obtained by the following method:

[0025] 1. Sample collection: In an HME family, peripheral blood specimens and clinical data of patients with hereditary multiple osteochondromas and healthy controls were collected.

[0026] 2. Genomic DNA extraction, WES library construction and sequencing: Peripheral blood genomic DNA was extracted using the DNeasy Blood and Tissue Kit (Qiagen, Valencia, CA), and then the Human All Exon Kit (Agilent Technologies, USA) was used for exon enrichment and amplification library construction, and finally library sequencing was performed.

[0027] 3. Statistical analysis: For WES analysis, the process includes data quality control, variant calling, and candidate list generation. First, the raw data is quality-controlled using fastQC, and adapter sequences are removed using cutadapt. Then, the sequencing reads are aligned to the human reference genome (GRCh37 / hg19) using BWA, and the bam file is sorted and PCR duplicates are removed using picard. Next, the Genome analysis tool kit (GATK) is used to perform local indel realignment, base quality score recalibration, and haplotype calling according to the GATK pipeline. Further, to identify candidate mutations, known common SNPs and indices are first compared with the 1000Genome Project and dbSNP138, and candidate mutations are screened out. Subsequently, the remaining SNPs are further shortlisted if they are defined as harmful mutations by the Protein Variation Effect Analyzer (PROVEAN). Finally, candidate genes with harmful mutations shared by affected family members are screened through the data of the Exome Aggregation Consortium. In addition, Sanger sequencing is further used for verification.

[0028] Example 1

[0029] I. DNA extraction from samples:

[0030] The DNeasy Blood and Tissue Kit was used for the extraction of genomic DNA from peripheral blood. According to the product manual, the specific steps are as follows:

[0031] (1) 3 mL of peripheral blood from patients with hereditary multiple osteochondromas or control subjects was drawn into an EDTA anticoagulant tube.

[0032] (2) 1 mL of anticoagulated blood was added to a 15 mL centrifuge tube, 20 μL of proteinase K and 2.4 mL of Buffer AL were added, vortexed thoroughly, and incubated in a water bath at 70 °C for 30 min (shake it at intervals until the solution becomes clear).

[0033] (3) 2 mL of absolute ethanol was added and vortexed again; the above mixture was added to the filter column in two portions, centrifuged at 3000 rpm for 3 minutes, and the filtrate was discarded.

[0034] (4) 2 mL of Buffer AW1 was added to the column, centrifuged at 5000 rpm for 1 minute, and the filtrate was discarded.

[0035] (5) 2 mL of Buffer AW2 was added to the column, centrifuged at 5000 rpm for 1 minute, and the filtrate was discarded.

[0036] (6) The column was centrifuged at 5000 rpm for 3 minutes to dry it, and then transferred to a sterile 1.5 mL centrifuge tube.

[0037] (7) Add 150 μL of Buffer AE, incubate at room temperature for 5 minutes, and centrifuge at 5000 rpm for 5 minutes.

[0038] (8) DNA quality detection: Use 2.0 to detect the DNA concentration, and 0.7% agarose gel electrophoresis to detect the DNA integrity.

[0039] II. Construction and Sequencing of Whole Exome Sequencing Library

[0040] (1) Fragmentation and recovery of genomic DNA: First, take 3 μg of DNA and fragment it using an ultrasonic instrument (Covaris M220); then, use the Agencourt AMPure XP kit (Beckman Coulter, USA) to recover the fragments according to the ratio of DNA solution:beads = 1:1.5 following the product manual. Finally, use the Agilent DNA 1000 kit and Agilent Bioanalyzer 2100 to detect whether the size of the fragmented DNA meets the requirements (the average size should be about 250 bp).

[0041] (2) Construction of exome library: Follow the instructions of the Human All Exon Kit (Agilent Technologies, USA). Generally, it includes the following steps: end repair of DNA fragments and addition of adapters, hybridization, exome capture, and fragment size selection, with the selected fragment length being 300 - 500 bp.

[0042] (3) Library sequencing: Use the Agilent DNA 1000 kit to detect the sample concentration and fragment size, then dilute the sample to 10 nM and submit it for sequencing. Use the Illumina sequencing platform and strictly follow the manufacturer's recommended parameters for sequencing to obtain the raw sequencing data.

[0043] III. Bioinformatics Analysis

[0044] The analysis process of WES includes quality control, finding variant sites, and screening of candidate genes.

[0045] (1) The raw data is subjected to quality inspection by fastQC and the adapters are removed using cutadapt.

[0046] (2) The clean reads are aligned with the human reference genome (UCSC hg 19) by BWA, and the bam file is sorted and PCR duplicates are removed using picard.

[0047] (3) According to the Genome Analysis Toolkit (GATK) best practice workflow, GATK was used for indel alignment, base call recalibration, and haplotype calling.

[0048] (4) Filtering SNVs: According to the dbSNP and 1000 Genomes Project data, known SNVs were removed.

[0049] (5) Selection of candidate functional SNVs: The SIFT or PolyPhen software was used to analyze SNVs to predict SNVs that cause protein functional changes; in addition, candidate genes with harmful mutations shared by affected family members were screened through Exome Aggregation Consortium data.

[0050] (6) Verification of candidate SNVs: Using peripheral blood genomic DNA as a template, PCR amplification and sequencing were used to determine the correctness of SNVs. At the same time, for genes enriched with candidate SNVs, Sanger sequencing was used to detect other cases. Finally, it was determined that rs557364026 (Chr9:139925298 - A>C, FUT7 c.893T>G, p.Phe298Cys) was closely related to the onset of hereditary multiple osteochondromas.

[0051] IV. Gene function analysis

[0052] (1) Specific siRNAs targeting the sequences of FUT7 were designed to knockdown human FUT7 and mouse Fut7.

[0053] (2) Expression vectors overexpressing FUT7 wild type (FUT7WT) and FUT7 mutant (FUT7 c.893T>G, p.Phe298Cys) were constructed.

[0054] (3) In COS-7 and ATDC5 cell lines, FUT7 was knocked down and overexpressed respectively, and the expression changes of the multiple osteochondroma pathogenic gene EXT1 in the cell lines were detected. The results showed that knocking down FUT7 or Fut7 could reduce the expression of EXT1 or Ext1 mRNA in COS7 or ATDC5 cells ( Figure 1 , A). Conversely, overexpressing FUT7WT could promote the expression of EXT1 or Ext1 mRNA. At the same time, compared with FUT7WT, FUT7 mutant (FUT7 c.893T>G, p.Phe298Cys) could reduce the expression of EXT1 or Ext1 mRNA ( Figure 1, B). Meanwhile, overexpression of FUT7WT can promote the expression of EXT1 protein in COS7 or ATDC5 cells. At the same time, compared with FUT7WT, FUT7 mutant (FUT7c.893T>G, p.Phe298Cys) can reduce the expression of EXT1 protein ( Figure 1 , C).

[0055] The above results suggest that FUT7 plays an important regulatory role in hereditary multiple osteochondromas, and its mutation (FUT7c.893T>G, p.Phe298Cys) will reduce the expression level of EXT1, a key pathogenic gene in the development of hereditary multiple osteochondromas. Therefore, FUT7 can be used as a new potential therapeutic target. For example, using drugs to promote the high expression of FUT7 in cartilage can help further increase the expression level of EXT1, thereby reducing the risk of multiple osteochondromas. For patients who have already developed multiple osteochondromas, targeting the increase of FUT7 expression may reduce the number of multiple sites and slow down the disease, which is a potential new treatment mechanism.

[0056] Example 2: Use of the prediction kit

[0057] (1) Extract the genomic DNA of the peripheral blood of the subject to be tested by the above method.

[0058] (2) First, use a specific pair of outer primers to amplify the fragment containing the rs557364026 (Chr9:139925298-A>C) site. The primer information is shown in Table 1:

[0059] Table 1: Amplification primers

[0060]

[0061] The first-round PCR reaction system uses HS (Premix) (TaKaRa, Code No R040Q). The composition of the PCR reaction solution (50 μL system) is shown in Table 2, and the reaction conditions are shown in Table 3:

[0062] Table 2: First-round PCR reaction system

[0063] Reagent Usage amount Final concentration PrimeSTAR HS (Premix) 25 μL 1x FUT7F1 10 - 15 pmol 0.2 - 0.3 μM FUT7R1 10 - 15 pmol 0.2 - 0.3 μM Peripheral blood genomic DNA of the subject to be tested <200 ng Sterilized water To 50 μL

[0064] Table 3: PCR reaction conditions for the first pair of outer primers

[0065]

[0066] After the first-round PCR reaction, dilute the PCR product 10 times for standby.

[0067] (3) Amplify the fragment containing the rs557364026 (Chr9: 139925298 - A>C) locus using specific second - pair internal primers. The composition of the second - round PCR reaction solution (50 μL system) is shown in Table 4, and the PCR reaction conditions are shown in Table 5:

[0068] Table 4: Second - round PCR reaction system

[0069] Reagent Usage amount Final concentration PrimeSTAR HS (Premix) 25 μL 1x FUT7F2 10 - 15 pmol 0.2 - 0.3 μM FUT7R2 10 - 15 pmol 0.2 - 0.3 μM The first PCR product after dilution 2 μL Sterilized water To 50 μL

[0070] Table 5: PCR reaction conditions for the second - pair internal primers

[0071]

[0072] (4) Electrophoresis: Perform DNA electrophoresis to quality - check the target band (the fragment size meets the expectation and the band is single).

[0073] (5) Sanger sequencing: Perform Sanger sequencing on the single band in the PCR product. Use the primers in the above - mentioned direction for sequencing to obtain the sequence information of this fragment, combined with the peak - map file in ab1 format of the sequencing result.

[0074] (6) Sequencing result analysis: According to the sequence information, align to obtain the corresponding genotype of the tested person. The peak map can distinguish heterozygous carriers.

[0075] (7) Evaluation of disease risk: Evaluate the multiple osteochondroma disease risk of an individual according to the genotype information of this locus and divide the risk level.

[0076] Example 3: Application example

[0077] Perform SNP genotyping on 1 sample by the above method.

[0078] The specific steps are as follows:

[0079] I. Preparation of sample DNA: Extract DNA according to the method of Example 1. The DNA has a concentration of 80 ng / μL, about 50 μL, and 260 / 280 = 1.90.

[0080] II. PCR amplification and Sanger sequencing: After performing nested two - round PCR successively using the primers in Table 1, send the single band for Sanger sequencing to obtain the sequencing peak map and genotype information containing this SNP. The results are as Figure 2 shown. The peak map can clearly distinguish the signals of the detected SNP, indicating that the corresponding primer sequence design is reasonable and the PCR product is accurate and reliable.

[0081] III. Alignment of the sequenced sequences with the reference genome: Using the online alignment database (http: / / genome.ucsc.edu / cgi-bin / hgBlat), the sequences obtained by Sanger sequencing were aligned to the human reference genome (GRCh37 / hg19). The results are as Figure 3 shown. The comparison results indicate that the products obtained by PCR are all located within the pre-designed amplification intervals, covering the detected SNPs. This locus can play a role in predicting the risk of developing hereditary multiple osteochondromas.

Claims

1. Use of specific primers with nucleotide sequences as shown in SEQ ID NO: 1 to 4 for preparing a kit for evaluating the risk of developing hereditary multiple osteochondromas.