DNA bar code for identifying musk shrew species and application thereof

Abstract

The invention provides a DNA bar code for identifying musk shrew species and application thereof, and relates to the technical field of species identification. The DNA bar code comprises at least one of a large berezovskirew DNA bar code, a Shandong small berezovskirew DNA bar code, a grey berezovskirew DNA bar code, a Dongyang river berezovskirew DNA bar code, a white-tail large berezovskirew DNA bar code, a south middle berezovskirew DNA bar code, a north small berezovskirew DNA bar code, a Taiwan grey berezovskirew DNA bar code, a southwest middle berezovskirew DNA bar code and a Wuzhishan small berezovskirew DNA bar code; compared with a traditional morphological identification method, the method has the advantages that DNA bar codes are adopted for identifying the musk shrew species, rapid and accurate identification of the ten musk shrew species is achieved, the identification time is shortened, and the identification accuracy of the ten musk shrew species is improved. The technical problem that in the prior art, a rapid musk shrew species identification method which does not depend on the experience of classification personnel is lacked is solved.

Description

Technical Field

[0001] The present invention relates to the technical field of species identification, and in particular to a DNA barcode for identifying species of the genus Myna and an application thereof. Background Art

[0002] The genus Crocidura belongs to the order Eulipotyphla, family Soricidae, subfamily Crocidurinae. There are 16 species of the genus Crocidura distributed in my country. Some species of the genus Crocidura are carriers of the epidemic hemorrhagic fever hantavirus, and different species carry different hantaviruses. The distribution area of ​​​​the genus Crocidura animals is close to human living areas, and even live in human living areas. The identification of its species is the key to preventing and controlling epidemic hemorrhagic fever.

[0003] However, the appearance of the species of the genus Muscicapus is relatively similar, and there is a certain overlap in the range of morphological parameters between species. In addition, the holotype specimens of the species of the genus Muscicapus distributed in my country for morphological classification are mostly collected by foreign researchers, and these holotype specimens are stored in foreign specimen museums and museums, which makes comparative research very inconvenient. Therefore, morphological classification requires high classification personnel and identification experience. Therefore, it is urgent to find a new method to make up for the shortcomings of traditional classification methods. Summary of the invention

[0004] One of the purposes of the present invention is to provide a DNA barcode for identifying species of the genus Myna, so as to solve the technical problem that there is a lack of a method for identifying species of the genus Myna that is fast and does not rely on the experience of taxonomists in the prior art.

[0005] A second object of the present invention is a method for identifying species of the genus Myna.

[0006] The third object of the present invention is to provide a material for detecting the DNA barcode of a species of the genus Myna and use it in identifying the species of the genus Myna.

[0007] A fourth object of the present invention is to provide a primer pair for amplifying the above-mentioned DNA barcode.

[0008] A fifth object of the present invention is to provide the use of the above-mentioned DNA barcode or the above-mentioned primer pair in the preparation of a product for identifying species of the genus Myna.

[0009] A sixth object of the present invention is to provide a reagent for identifying species of the genus Myna.

[0010] A seventh object of the present invention is to provide a kit for identifying species of the genus Myna.

[0011] In order to achieve the above-mentioned purpose of the present invention, the following technical solutions are particularly adopted:

[0012] In a first aspect, the present invention provides a DNA barcode for identifying species of the genus Myrmecophaga, wherein the DNA barcode includes at least one of a DNA barcode of a giant myrmecophaga, a DNA barcode of a small myrmecophaga from Shandong, a DNA barcode of a gray myrmecophaga, a DNA barcode of a Dongyangjiang myrmecophaga, a DNA barcode of a white-tailed giant myrmecophaga, a DNA barcode of a middle myrmecophaga from South China, a DNA barcode of a small myrmecophaga from North China, a DNA barcode of a Taiwan gray myrmecophaga, a DNA barcode of a middle myrmecophaga from Southwest China, and a DNA barcode of a small myrmecophaga from Wuzhishan.

[0013] The nucleotide sequences of the giant musk shrew DNA barcode, Shandong small musk shrew DNA barcode, gray musk shrew DNA barcode, Dongyangjiang musk shrew DNA barcode, white-tailed giant musk shrew DNA barcode, South China middle musk shrew DNA barcode, northern small musk shrew DNA barcode, Taiwan gray musk shrew DNA barcode, southwestern middle musk shrew DNA barcode and Wuzhishan small musk shrew DNA barcode are shown as SEQ ID NOs. 1 to 10, respectively.

[0014] In a second aspect, the present invention provides a method for identifying species of the genus Myna, comprising detecting the homology between a specific fragment in the total DNA of the tested species of the genus Myna and the DNA barcode described in claim 1. If the homology is greater than 98%, the tested species of the genus Myna is the species of the genus Myna corresponding to the DNA barcode having a homology of greater than 98%.

[0015] Furthermore, the detection method includes performing PCR amplification using the total DNA of the tested musk shrew species as a template, and comparing the sequencing result of the amplified product with the DNA barcode;

[0016] Preferably, the amplification conditions are pre-denaturation at 94°C for 4 minutes; denaturation at 94°C for 1 minute, annealing at 52°C for 1 minute, extension at 72°C for 1 minute, 30 cycles; and extension at 72°C for 7 minutes.

[0017] Furthermore, the primer pair for PCR amplification includes a DNA molecule with nucleotide sequences as shown in SEQ ID NO.11 and SEQ ID NO.12.

[0018] Furthermore, the length of the amplified product is 304 bp.

[0019] In a third aspect, the present invention provides the use of a substance for detecting DNA barcodes of species of the genus Myna in identifying species of the genus Myna.

[0020] In a fourth aspect, the present invention provides a primer pair for amplifying the above-mentioned DNA barcode, wherein the primer pair comprises a DNA molecule with nucleotide sequences as shown in SEQ ID NO.11 and SEQ ID NO.12.

[0021] In a fifth aspect, the present invention provides the use of the above-mentioned DNA barcode or the above-mentioned primer pair in the preparation of a product for identifying species of the genus Myna.

[0022] In a sixth aspect, the present invention provides a reagent for identifying species of the genus Myna, comprising the above-mentioned primer pair.

[0023] In a seventh aspect, the present invention provides a kit for identifying species of the genus Myna, comprising the above-mentioned primer pair or the above-mentioned reagent;

[0024] Preferably, DNA polymerase, Mg 2+ , dNTP, PCR Buffer and one or more of sterile water.

[0025] The present invention provides a DNA barcode for identifying species of the genus shrew, and constructs DNA barcodes of 10 species of the genus shrew. Compared with the traditional morphological identification method, the DNA barcode is used to identify species of the genus shrew, and the 10 species of the genus shrew are quickly and accurately identified, the identification time is shortened, and the accuracy of the identification of the 10 species of the genus shrew is improved. The technical problem of the lack of a method for identifying species of the genus shrew that can be fast and does not rely on the experience of the classification personnel is solved in the prior art. DETAILED DESCRIPTION

[0026] Unless otherwise defined herein, scientific and technical terms used in conjunction with the present invention shall have the meanings commonly understood by those of ordinary skill in the art. The meaning and scope of the terms should be clear, however, in the case of any potential ambiguity, the definitions provided herein take precedence over any dictionary or external definitions. In this application, unless otherwise stated, the use of "or" means "and / or". In addition, the use of the term "including" and other forms is non-limiting.

[0027] The methods and techniques of the present invention are generally performed according to conventional methods well known in the art and as described in various general and more specific references that are cited and discussed throughout the present specification unless otherwise indicated.

[0028] On the one hand, the present invention provides a DNA barcode for identifying species of the genus Myrmecophaga, wherein the DNA barcode includes at least one of a DNA barcode of a giant myrmecophaga, a DNA barcode of a small myrmecophaga from Shandong, a DNA barcode of a gray myrmecophaga, a DNA barcode of a Dongyangjiang myrmecophaga, a DNA barcode of a white-tailed giant myrmecophaga, a DNA barcode of a middle myrmecophaga from South China, a DNA barcode of a small myrmecophaga from North China, a DNA barcode of a Taiwan gray myrmecophaga, a DNA barcode of a middle myrmecophaga from Southwest China, and a DNA barcode of a small myrmecophaga from Wuzhishan.

[0029] The nucleotide sequences of the giant musk shrew DNA barcode, Shandong small musk shrew DNA barcode, gray musk shrew DNA barcode, Dongyangjiang musk shrew DNA barcode, white-tailed giant musk shrew DNA barcode, South China middle musk shrew DNA barcode, northern small musk shrew DNA barcode, Taiwan gray musk shrew DNA barcode, southwestern middle musk shrew DNA barcode and Wuzhishan small musk shrew DNA barcode are shown as SEQ ID NOs. 1 to 10, respectively.

[0030] The present invention constructs DNA barcodes of 10 species of the genus Myrmecophaga. Compared with the traditional morphological identification method, the DNA barcodes are used to identify the genus Myrmecophaga species, which realizes rapid and accurate identification of the 10 species of the genus Myrmecophaga, shortens the identification time, and improves the accuracy of the identification of the 10 species of the genus Myrmecophaga. The technical problem of the lack of a method for identifying the genus Myrmecophaga species that is rapid and does not rely on the experience of the taxonomists in the prior art is solved.

[0031] According to another aspect of the present invention, a method for identifying a species of the genus Myna is also provided, comprising detecting the homology between a specific fragment in the total DNA of the tested species of the genus Myna and the DNA barcode according to claim 1. If the homology is greater than 98%, the tested species of the genus Myna is the species of the genus Myna corresponding to the DNA barcode having a homology of greater than 98%.

[0032] Among them, total DNA is genomic DNA extracted from blood, cell or tissue samples.

[0033] In some specific embodiments, the detection method includes performing PCR amplification using the total DNA of the tested shrew species as a template, and comparing the sequencing results of the amplified product with the DNA barcode.

[0034] In some specific embodiments, the amplification conditions are pre-denaturation at 94°C for 4 minutes; denaturation at 94°C for 1 minute, annealing at 52°C for 1 minute, extension at 72°C for 1 minute, 30 cycles; and extension at 72°C for 7 minutes.

[0035] In some specific embodiments, the nucleotide sequence of the primer pair for PCR amplification is:

[0036] The forward primer was 5′-CGACCTATGACATGAAAAATCA-3′ (SEQ ID NO. 11);

[0037] The reverse primer is 5'-CACCAATRTTTCATGTTTCRAG-3', note R = A or G (SEQ ID NO. 12).

[0038] In some specific embodiments, the length of the amplified product is 304 bp.

[0039] Specifically, the PCR product can be analyzed by agarose gel electrophoresis, and the size of the PCR fragment can be detected using a DNA marker. If a clear band of about 300 bp appears and there are no other bands, it can be sent to a biological company for sequencing. The electrophoresis is 1%-2% agarose gel electrophoresis.

[0040] According to another aspect of the present invention, there is also provided a use of a material for detecting a DNA barcode of a species of the genus Myna in identifying the species of the genus Myna.

[0041] According to another aspect of the present invention, a primer pair for amplifying the above-mentioned DNA barcode is also provided, wherein the primer pair comprises a DNA molecule having a nucleotide sequence as shown in SEQ ID NO.11 and SEQ ID NO.12.

[0042] According to another aspect of the present invention, there is also provided the use of the above-mentioned DNA barcode or the above-mentioned primer pair in the preparation of a product for identifying species of the genus Myna.

[0043] According to another aspect of the present invention, a reagent for identifying species of the genus Myna is provided, comprising the above-mentioned primer pair.

[0044] According to another aspect of the present invention, there is also provided a kit for identifying species of the genus Myna, comprising the above primer pair or the above reagent;

[0045] In some specific embodiments, DNA polymerase, Mg 2+ , dNTP, PCR Buffer and one or more of sterile water.

[0046] The DNA polymerase used was ETaq high-fidelity enzyme.

[0047] The technical solution of the present invention will be clearly and completely described below in conjunction with the embodiments. Obviously, the described embodiments are part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0048] Information on the source of the collected species of the genus Musk Shrew:

[0049] Giant Musk Shrew Crocidura lasiura: A total of 14 giant musk shrew specimens were obtained. Specimen No. 4 was collected in Hengdaohezi area of ​​Heilongjiang Province, specimen No. 4 was collected in Mudanfeng area, specimen No. 3 was collected in Fenghuangshan area, and specimen No. 3 was collected in Xinbin area of ​​Liaoning Province.

[0050] Shandong small musk shrew Crocidura shantungensis: A total of 47 Shandong small musk shrew specimens were obtained. Specimen No. 2 was collected in Changting area of ​​Heilongjiang Province, specimen No. 3 was collected in Jingpo Lake area, specimen No. 6 was collected in Mishan area, specimen No. 1 was collected in Mudanfeng area, specimen No. 1 was collected in Fenghuangshan area, specimen No. 1 was collected in Dalai Lake area of ​​Inner Mongolia Autonomous Region, specimen No. 13 was collected in Xinbin area of ​​Liaoning Province, specimen No. 2 was collected in Langfang area of ​​Hebei Province, and specimen No. 18 was collected in Xinzhuang area of ​​Shandong Province.

[0051] Crocidura attenuata: A total of 17 specimens of Crocidura attenuata were obtained. Specimen No. 7 was collected in Qingchuan area of ​​Sichuan Province, specimen No. 1 was collected in Pengzhou area, specimen No. 3 was collected in Mingshan area, specimen No. 4 was collected in Yingjing area, specimen No. 1 was collected in Muchuan area, specimen No. 1 was collected in Huayingshan area, and specimen No. 1 was collected in Kaixian area of ​​Chongqing.

[0052] Crocidura dongyangjiangensis: A total of 3 specimens of Dongyang River Musk Shrew were obtained, and specimen No. 3 was collected in Liupanshui, Guizhou.

[0053] Crocidura dracula: A total of 6 specimens of Crocidura dracula were obtained, and specimen No. 6 was collected in Eryuan, Yunnan.

[0054] Crocidura rapax: A total of 20 specimens of Crocidura rapax were obtained. Specimen No. 5 was collected in Anshun, Guizhou, specimen No. 13 was collected in Bijie, and specimen No. 2 was collected in Liupanshui.

[0055] Crocidura suaveolens: A total of 8 specimens of Crocidura suaveolens were obtained, and specimen No. 8 was collected in the Altay region of Xinjiang.

[0056] Taiwan gray musk shrew Crocidura tanakae: A total of 54 Taiwan gray musk shrew specimens were obtained. Specimen No. 15 was collected in Anshun, Guizhou, specimen No. 21 was collected in Bijie, specimen No. 4 was collected in Liupanshui, specimen No. 10 was collected in Tongren, and specimen No. 4 was collected in Zunyi.

[0057] Crocidura vorax, Southwestern Musk Shrew: A total of 3 specimens of Crocidura vorax were obtained. Specimen No. 1 was collected in Songtao area of ​​Guizhou, specimen No. 1 was collected in Leigongshan area of ​​Guizhou, and specimen No. 1 was collected in Jinfoshan area of ​​Chongqing.

[0058] Wuzhishan small musk shrew Crocidura wuchihensis: A total of 3 specimens of Wuzhishan small musk shrew were obtained, and specimen No. 3 was collected in Diaoluo Mountain area of ​​Hainan.

[0059] Example 1 DNA barcodes for identification of species of the genus Muscicapida

[0060] Total DNA was extracted from the tissues of 10 species of the genus Myna collected, the full sequence of the Cytb gene was amplified, the amplified products were sequenced (Harbin Boshi Biotechnology Co., Ltd.), and then sequence analysis and comparison were performed. The high mutation regions were selected, and a sequence standard database of various species of the genus Myna was established. On the basis of comparing the database DNA, the product results of the polymerase chain reaction under specific conditions were analyzed to obtain the DNA barcode for identifying the species of the genus Myna, thereby achieving the purpose of rapid and accurate identification of the species of the genus Myna.

[0061] SEQ ID NO.1 (DNA barcode of Crocidura lasiura):

[0062] CGAAAAACTCACCCACTAATAAAAATTGTTAACAGCTCTTTCATTGACCTCCCAGCACCTTCAAACATTTCATCATGATGAAACTTTGGCTCCCTATTAGGAATTTGCTTAATTGCAAAATCCTAACCGGATTATTTTTAGCTATACACTA CACATCAAATACTATAACAGCTTTCTCCTCCGTCACTCACATCTGTCGAGATGTAAATTACGGTTGACTAATCCGATAACCTTCACGCCAACGGAGCCTCCATATTTTTCATTTGTCTCTTCCTTCACGTAGGCCGAGGACTCTATTATGGCT.

[0063] SEQ ID NO.2 (Shandong small musk shrew Crocidura shantungensis DNA barcode):

[0064] CGAAAAACTCATCCACTAATAAAAATTGTTAACAGTTCCTTCATTGACTTACCAGCACCTTCAAACATCTCATCATGATGAAATTTCGGCTCCTTACTAGGAATTTGCTTAATCGCACAAATCTTAACCGGATTATTTTTAGCTATACACTATACATCAGACACTATAACAGCCTTTTCCTCCGTTACACATATTTGCCGAGACGTAAACTATGGCTGACTAATCCGATATCTCCATGCTAACGGTGCCTCTATATTTTTCATTTGCTTATTCCTCCACGTAGGACGAGGCCTCTATTATGGCT。

[0065] SEQ ID NO.3 (DNA barcode of Crocidura attenuata):

[0066] CGAAAAACCCATCCACTAATAAAAATTGTTAACAGCTCTTTCATTGACCTCCCAGCACCTTCAAACATTTCATCATGATGAAATTTTGGCTCCCTACTAGGAATTTGCTTAATCGCACAAATCCTAACCGGACTATTTCTAGCTATACACTACACATCAGACACCATAACAGCCTTCTCCTCCGTTACGCATATTTGCCGAGATGTAAATTATGGTTGACTAATTCGATATCTTCACGCCAACGGAGCCTCCATATTTTTCATTTGTCTATTCCTTCACGTGGGCCGAGGACTCTATTATGGCT。

[0067] SEQ ID NO.4 (DNA barcode of Crocidura dongyangjiangensis):

[0068] CGAAAAACTCATCCACTAATAAAAATTTAACAACTCTTTCATTGACCTTCCAGCACCTTCAAACATTTCGTCATGAAATTTTGGCTCCCTACTAGGAATCTGCTTAGTTGCACAAATCCTAACCGGATTATTTCTAGCCATACATTA TACATCAGACACCATAACCCTTCTCTTCCGTCACACATATTTGCCGAGATGTAAATTATGGGTGACTAATTCGCTACCTTCACGCCAACGGAGCCTCCATATTTCATTTGCCTGCCTCCATGTAGGTCGAGGACTATATTATGGCT。。

[0069] SEQ ID NO.5 (Crossroads Dracula DNA):

[0070] CGAAAGACCCACCCACTAATAAAATTTGTTAACAGCTCTTTTATTGACCTACCAGCACCCTCAAAATATTTCATGATGAAACTTTGGCTCCTTATTAGGAATCTGCTTAATCGCACAAATCCTAACCGGACTATTTCTAGCAATACACTA TACATCAGACACCATAACCGCCTTCTCCTCCGTTACACACATCTGCCGCGATGTAAATTACGGTTGATTAATTCGATATCTCCGCTAACGGAGCCTCCATATTTTTTTTTTTCCTCCATGCCGGACGAGGATTATATTATGGCT。。

[0071] SEQ ID NO.6 (Crocidura rapax DNA sequence):

[0072] CGAAAAACTCACCCACTAATAAAAATTGTTAACAGCTCTTTCATTGACCTTCCAGCACCTTCAAACATTTCATCATGATGAAATTTTGGCTCCCTACTAGGAATTTGCTTAATCGCACAAATTCTAACCGGACTATTCCTAGCTATACACTACACATCAGACACCATAACAGCCTTCTCCTCCGTTACACATATCTGCCGAGATGTAAATTATGGTTGACTAATTCGATATCTTCACGCCAATGGAGCCTCCATATTTTTCATTTGTCTATTCCTTCACGTGGGCCGAGGACTCTACTACGGCT。

[0073] SEQ ID NO.7 (DNA barcode of Crocidura suaveolens):

[0074] CGAAAAACACACCCACTAATAAAAATTGTTAACAGCTCTTTTATTGACTTACCAGCACCCTCAAACATCTCATCATGATGGAACTTCGGCTCCTTACTAGGAATTTGCTTAATCATACAAATCCTAACCGGACTATTTTTAGCTATGCACTATACATCCGATACTATAACAGCCTTTTCCTCCGTTACACATATCTGCCGAGACGTAAATTATGGTTGATTAATTCGATATCTCCACGCTAACGGTGCTTCCATATTTTTTATTTGCCTATTCCTCCACGTAGGACGAGGACTTTATTATGGCT。

[0075] SEQ ID NO.8 (DNA barcode of Crocidura tanakae):

[0076] CGAAAAACTCACCCACTAATAAAATTTGTTAACAGCTCTTTCATCGACCTCCCAGCACCCTCAAACATTTCATCATGGAACTTTGGCTCCTTATTAGGCATCTGTTTAATTGCACAAATCCTAACCGGACTATTCTTAGCTATACACTA CACATCAGATACCATAACCCTTTTCCTCCGTCACACATATCTGTCGAGATGTAAATTATGGCTGACTAATCCGATCTTCACGCCAATGGAGCCTCCATATTTCATTTGCCTATTCCTTCATGTAGGCCGAGGACTTTTATTATGGTT。。

[0077] SEQ ID NO.9 (Crocidura vorax DNA data):

[0078] CGAAAAACTCACCCACTAATAAAAATCGTTAACAGCTCTTTTATTGACCTTCCAGCACCCTCAAACATTTCATCATGAAATTTTGGCTCCCTACTAGGAATTTGCTTAATCGCACAAATCCTAACCGGATTTTTTTAGCTATACATTA CACATCAGACACCATAACCCTTCTCCTCCGTTACACACATCTGTCGAGATGTAAATTATGGCTGACTAATTCGATATCTTCACGCCAACGGAGCCTCCATATTCTTCATCTGCCTATTCCTTCATGGGCCGAGGACTTTACTACGGCT。。

[0079] SEQ ID NO.10 (Crocidura wuchihensis DNA data):

[0080] CGAAAAACCCACCCACTAATAAAAATTATTAATAGCTCTTTTATTGATCTCCCCGACCCTCAAACATTTCATCATGATGAAATTTTGGTTCCTTACTAGGAATTTGCTTAATCGCACAAATCCTAACTGGATTATTTTTAGCTATACACTA TACATCAGATACCATAACAGCCTTCTCCTCCGTTACACATATCTGCCGAGATGTAAATTATGGCTGACTAATTCGATACCTCCACGCCAATGGCGCCTCCATATTTTTTATCTGCCTATTCCTTCATGTAGGCCGAGGACTTTACTATGGCT.

[0081] Specific primer pairs were designed based on the sequences before and after the DNA barcodes of 10 species of the genus Myna:

[0082] The forward primer was 5′-CGACCTATGACATGAAAAATCA-3′ (SEQ ID NO. 11);

[0083] The reverse primer is 5'-CACCAATRTTTCATGTTTCRAG-3', note R = A or G (SEQ ID NO. 12).

[0084] Statistics of genetic distance between DNA barcodes and collected musk shrew species:

[0085] Giant musk shrew Crocidura lasiura: The genetic distance between the DNA barcode of giant musk shrew and collection specimen No. 14 is 0.0000-0.0066.

[0086] Crocidura shantungensis: The genetic distance between the DNA barcode of Crocidura shantungensis and collection specimen No. 47 is 0.0000-0.0165.

[0087] Crocidura attenuata: The genetic distance between the DNA barcode of Crocidura attenuata and collection specimen 17 is 0.0000-0.0170.

[0088] Crocidura dongyangjiangensis: The genetic distance between the DNA barcode of Crocidura dongyangjiangensis and collection specimen No. 3 is 0.0000-0.0033.

[0089] Crocidura dracula: The genetic distance between the DNA barcode of Crocidura dracula and collection specimen No. 6 is 0.0000-0.0100.

[0090] Crocidura rapax: The genetic distance between the DNA barcode of Crocidura rapax and collection specimen No. 20 is 0.0000-0.0133.

[0091] Crocidura suaveolens: The genetic distance between the DNA barcode of Crocidura suaveolens and collection specimen No. 8 is 0.0000-0.0067.

[0092] Taiwan gray musk shrew Crocidura tanakae: The genetic distance between the DNA barcode of Taiwan gray musk shrew and collection specimen No. 54 is 0.0000-0.0090.

[0093] Southwestern musk shrew Crocidura vorax: The genetic distance between the DNA barcode of southwestern musk shrew and collection specimen No. 3 is 0.0000-0.0066.

[0094] Wuzhishan small musk shrew Crocidura wuchihensis: The genetic distance between the DNA barcode of Wuzhishan small musk shrew and collection specimen No. 3 is 0.0000-0.0066.

[0095] If the homology is above 98%, it can be determined that the tissue to be tested is from a species of the genus Myna.

[0096] Example 2

[0097] The DNA barcode provided in Example 1 was used to identify the musk shrew sample to be identified, and the musk shrew sample was identified as the musk shrew specimen 2023HD82 collected from the Hengdaohezi forest area in Mudanjiang City, Heilongjiang Province. The specific steps are as follows:

[0098] 1. Use the phenol-chloroform method to extract the genomic DNA of the sample muscle tissue, and dilute the DNA concentration of the sample to 0.1μg / μl~2μg / μl with sterile deionized water.

[0099] 2. Amplify the DNA fragment and perform polymerase chain reaction, that is, use specific primers for amplification. The primer pair sequence is:

[0100] LSQ304: 5'-CGACCTATGACATGAAAAATCA-3';

[0101] HSQ304: 5'-CACCAATRTTTCATGTTTCRAG-3' Note: R = A or G.

[0102] The amplification conditions were pre-denaturation at 94°C for 4 minutes; denaturation at 94°C for 1 minute, annealing at 52°C for 1 minute, and extension at 72°C for 1 minute, for 30 cycles; and extension at 72°C for 7 minutes.

[0103] 3. The PCR product was analyzed by agarose gel electrophoresis, and the size of the PCR fragment was detected using DNA marker, and a clear band of about 300 bp appeared. The PCR product was purified and sequenced (Harbin Boshi Biotechnology Co., Ltd.), and the sequence was:

[0104] CGAAAAACTCACCCACTAATAAAAATTGTTAACAGCTCTTTCATTGACCTCCCAGCACCTTCAAACATTTCATCATGATGAAACTTTGGCTCCCTATTAGGAATTTGCTTAATTGCAAAATCCTAACCGGATTATTTTTAGCTATACACTACA CATCAGATACTATAACAGCTTTCTCCCCGTCACTCACATCTGTCGAGATGTAAATTACGGTTGACTAATCCGATAACCTTCACGCCAACGGAGCCTCCATATTTTTCATTTGTCTCTTCCTTCACGTAGGCCGAGGACTCTATTATGGCT(SEQ ID NO.13).

[0105] 5. ClustalW software was used for sequence alignment, and MEGA11.0 software was used for cluster analysis of the target sequence and the DNA barcode provided in Example 1. It was found that the 2023HD82 specimen and the giant musk shrew (Crocidura lasiura) were clustered into one branch.

[0106] 6. MEGA11.0 software was used to calculate that the genetic distance between the 2023HD82 specimen and the giant musk shrew barcode was 0.0033, and the similarity was above 98%.

[0107] 7. The test result shows that specimen 2023HD82 is giant musk shrew (Crocidura lasiura), which is the same as the result of traditional morphological identification.

[0108] Example 3

[0109] Different from Example 2, the musk shrew sample to be identified is the musk shrew specimen 2020GZ98. The sequencing results of the PCR product are:

[0110] CGAAAAACTCACCCACTAATAAAAATTGTTAACAGCTCTTTCATTGACCTCCCAGCACCTTCAAACATTTCATCATGATGAAATTTTGGCTCCCTACTAGGAATTTGCTTAATCGCACAAATCCTAACCGGACTATTCCTAGCTATACACTACA CATCAGACACCATAACAGCTTTCTCCTCCGTTACACATATCTGCCGAGATGTAAATTATGGTTGACTAATTCGATATCTTCACGCCAATGGAGCCTCCATATTTTTCATTTGTCTATTCCTTCACGTGGGCCGAGGACTCTACTATGGCT(SEQ ID NO.14).

[0111] Compared with the DNA barcode provided in Example 1, it was found that the similarity with Crocidura rapax was the highest, reaching 99.00%, and the similarity with Crocidura attenuata was 97.04%. Therefore, specimen 2020GZ98 was determined to be Crocidura rapax, which was the same as the traditional morphological identification result.

[0112] Comparative Example 1

[0113] The difference from Example 1 is that the position of the Cytb gene in the barcode is changed, and a new replacement barcode is selected that is 9 bp later than the DNA barcode provided in Example 1, and the length is still 304 bp:

[0114] Alternative barcode for Crocidura rapax:

[0115] CACCCACTAATAAAAATTGTTAACAGCTCTTTCATTGACCTTCCAGCACCTTCAAACATTTCATCATGATGAAATTTTGGCTCCCTACTAGGAATTTGCTTAATCGCACAAATTCTAACCGGACTATTCCTAGCTATACACTACACATCAGACA CCATAACAGCCTTCTCCTCCGTTACACATATCTGCCGAGATGTAAATTATGGTTGACTAATTCGATATCTTCACGCCAATGGAGCCTCCATATTTTTCATTTGTCTATTCCTTCACGTGGGCCGAGGACTCTACTACGGCTCTTATATAT(SEQ ID NO.15).

[0116] Alternative barcode for Crocidura attenuata:

[0117] CATCCACTAATAAAAATTGTTAACAGCTCTTTCATTGACCTCCCAGCACCTTCAAACATTTCATCATGATGAAATTTTGGCTCCCTACTAGGAATTTGCTTAATCGCACAAATCCTAACCGGACTATTTCTAGCTATACACTACACATCAGACA CCATAACAGCCTTCTCCTCCGTTACGCATATTTGCCGAGATGTAAATTATGGTTGACTAATTCGATATCTTCACGCCAACGGAGCCTCCATATTTTTCATTTGTCTATTCCTTCACGTGGGCCGAGGACTCTATTATGGCTCTTATATAT(SEQ ID NO.16).

[0118] Comparative Example 2

[0119] Different from Example 2, the replacement barcode provided in Comparative Example 1 was used to identify the genus shrew specimen 2020GZ98. The sequencing results of the PCR product were:

[0120] CACCCACTAATAAAAATTGTTAACAGCTCTTTCATTGACCTCCCAGCACCTTCAAACATTTCATCATGATGAAATTTTGGCTCCCTACTAGGAATTTGCTTAATCGCACAAATCCTAACCGGACTATTCCTAGCTATACACTACACATCAGACA CCATAACAGCTTTCTCCTCCGTTACACATATCTGCCGAGATGTAAATTATGGTTGACTAATTCGATATCTTCACGCCAATGGAGCCTCCATATTTTTCATTTGTCTATTCCTTCACGTGGGCCGAGGACTCTACTATGGCTCTTATATAT(SEQ ID NO.17).

[0121] Compared with the replaced barcode provided in Comparative Example 1, it was found that the similarity with the South China Central Musk Shrew (Crocidura rapax) was 98.70%, and the similarity with the Gray Musk Shrew (Crocidura attenuata) was 98.03%. There were two species with a homology of more than 98%, so the newly replaced barcode could not effectively distinguish species.

[0122] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or replace some or all of the technical features therein with equivalents. However, these modifications or replacements do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention.

Claims

1. A DNA barcode for identifying species of the genus Muscicapidae, characterized in that: The DNA barcode includes at least one of a DNA barcode of a giant musk shrew, a DNA barcode of a Shandong small musk shrew, a DNA barcode of a gray musk shrew, a DNA barcode of a Dongyangjiang musk shrew, a DNA barcode of a white-tailed giant musk shrew, a DNA barcode of a South China middle musk shrew, a DNA barcode of a northern small musk shrew, a DNA barcode of a Taiwan gray musk shrew, a DNA barcode of a Southwest middle musk shrew, and a DNA barcode of a Wuzhishan small musk shrew; The nucleotide sequences of the giant musk shrew DNA barcode, Shandong small musk shrew DNA barcode, gray musk shrew DNA barcode, Dongyangjiang musk shrew DNA barcode, white-tailed giant musk shrew DNA barcode, South China middle musk shrew DNA barcode, northern small musk shrew DNA barcode, Taiwan gray musk shrew DNA barcode, southwestern middle musk shrew DNA barcode and Wuzhishan small musk shrew DNA barcode are shown as SEQ ID NOs. 1 to 10, respectively.

2. A method for identifying species of the genus Myna, characterized in that: The method comprises detecting the homology between a specific fragment in the total DNA of the tested shrew species and the DNA barcode according to claim 1. If the homology is greater than 98%, the tested shrew species is the shrew species corresponding to the DNA barcode with a homology greater than 98%.

3. The method according to claim 2, characterized in that The detection method comprises performing PCR amplification using the total DNA of the tested musk shrew species as a template, and comparing the sequencing result of the amplified product with the DNA barcode; Preferably, the amplification conditions are pre-denaturation at 94°C for 4 minutes; denaturation at 94°C for 1 minute, annealing at 52°C for 1 minute, extension at 72°C for 1 minute, 30 cycles; and extension at 72°C for 7 minutes.

4. The method according to claim 3, characterized in that The primer pair for PCR amplification includes DNA molecules with nucleotide sequences as shown in SEQ ID NO.11 and SEQ ID NO.

12.

5. The method according to claim 4, characterized in that The length of the amplified product is 304 bp.

6. Application of a substance for detecting DNA barcodes of species of the genus Myna in identifying species of the genus Myna.

7. A primer pair for amplifying the DNA barcode according to claim 1, characterized in that: The primer pair includes DNA molecules with nucleotide sequences as shown in SEQ ID NO.11 and SEQ ID NO.

12.

8. Use of the DNA barcode according to claim 1 or the primer pair according to claim 7 in the preparation of a product for identifying species of the genus Myna.

9. A reagent for identifying species of the genus Muscicapidae, characterized in that: Comprising the primer pair described in claim 7.

10. A kit for identifying species of the genus Muscicapidae, characterized in that: comprising the primer pair of claim 7 or the reagent of claim 9; Preferably, DNA polymerase, Mg 2+ , dNTP, PCR Buffer and one or more of sterile water.