CLOCK gene snp molecular marker related to yellow-feathered broiler feed conversion rate and application thereof

Abstract

The application discloses a yellow-feathered broiler feed conversion rate related CLOCK gene SNP molecular marker and application thereof, and belongs to the technical field of animal genetics and breeding and molecular biology. The SNP molecular marker polymorphism is G / A, is located at the 5903440th base of a chicken 27th chromosome CLOCK gene, and has an RS number of rs315082113. The SNP molecular marker polymorphism provided by the application is significantly related to a chicken feed conversion rate character, can be applied to selecting a chicken population with a low feed conversion rate character, improves the efficiency of a broiler industry, provides convenience and technical support for rapid breeding of a low feed conversion rate broiler, can effectively reduce feed costs in a production process, and improves economic benefits and competition of enterprises.

Description

Technical Field

[0001] This invention relates to the fields of animal genetics and breeding and molecular biology, specifically to a CLOCK gene SNP molecular marker related to feed conversion rate in yellow-feathered broiler chickens and its application. Background Technology

[0002] China is a major poultry producer, and the poultry industry, as a crucial component of agriculture, plays a vital role in supporting the daily diet of most of the country's residents. Reducing feed conversion ratio is essential for improving economic efficiency, and identifying and utilizing genes related to feed conversion ratio is of great significance for chicken production management. How to reduce feed conversion ratio in poultry is one of the key issues in poultry breeding.

[0003] Skeletal muscle plays a vital physiological role in animals, supporting the body, protecting internal organs, promoting blood circulation, and maintaining movement. Loss of function or quantity can lead to metabolic disorders and decreased immunity, resulting in a series of myogenic diseases. For meat-producing animals, skeletal muscle is the largest edible tissue in the carcass, and its quantity and quality directly determine the animal's economic value. Skeletal muscle development is regulated by multiple genes, and identifying genes that promote skeletal muscle development is crucial for improving the economic value of animals. Cai et al. found that the long non-coding RNA MYH1G-AS inhibits myoblast differentiation, drives the conversion of slow-twitch muscle fibers to fast-twitch fibers, and leads to muscle atrophy. Knockout of MYH1G-AS increases muscle mass and muscle fiber size. Conversely, overexpression of MYH1G-AS reduces gastrocnemius muscle mass and decreases muscle fiber size. The CLOCK gene can inhibit the expression of MYH1G-AS, alleviating the resulting decrease in muscle mass and promoting skeletal muscle development. Therefore, the CLOCK gene can be considered a candidate gene for breeding chickens based on feed conversion ratio. Currently, the SNP molecular markers of the CLOCK gene, which are related to feed conversion rate in yellow-feathered broiler chickens, have not been developed and utilized. Summary of the Invention

[0004] To address the aforementioned technical problems, the present invention aims to provide a CLOCK gene SNP molecular marker related to feed conversion rate in yellow-feathered broilers and its application, thereby solving the existing problems of lacking SNP molecular markers related to chicken feed conversion rate and using SNP molecular markers related to chicken feed conversion rate for screening and breeding broilers with low feed conversion rate.

[0005] The technical solution of the present invention to solve the above-mentioned technical problems is as follows:

[0006] A molecular marker for a CLOCK gene SNP associated with feed conversion ratio in yellow-feathered broilers, with a polymorphism of G / A, located at base 5903440 of the CLOCK gene on chromosome 27 of chicken, and RS number rs315082113.

[0007] Furthermore, the sequence of the SNP molecular marker is shown in SEQ ID NO.1, where R is the G>A mutation site. When R is G, it indicates a yellow-feathered broiler with low feed conversion ratio.

[0008] SEQ ID NO.1: 5'-AGGATTAAGTCCCAGTGTTCTCTGTTCAGCTGTC AGCCAGGAGAGGAGCATTCTCTGACATACAAGTAGTGACCAAGGCTCTGAATATTTCTGCCTGTCAAATCTTCAGCTAATTCGAGCGCTGTATATTTAGCATCCATGAGCAGAAAAATGAAAGCTTTTGGTTATCAGTAGCTTTTGGGGACATCATAAATACTGAGRCACCGAGTTCTAATCATT TTCTTGACACTTTTTTATCACGCAGGTTCATAGCCAAGAACATTATGAAGCTGCAGCGCCTGGGGATAACCCATGTTCTGAATGCAGCAGAGGGGAAGTCATTCATGCATGTGAACACTAATGCAGAATTCTATGAAGGCACAGGCATCACATACCATGGCATTAAAGCTAACGATACGCAGG-3'.

[0009] A primer combination for amplifying the above-mentioned SNP molecular markers includes the forward primer shown in SEQ ID NO.2 and the reverse primer shown in SEQ ID NO.3;

[0010] SEQ ID NO.2: 5'-TCCCAGTGTTCTCTGTTCAGCT-3';

[0011] SEQ ID NO. 3: 5'-ATCGTTAGCTTAATGCCATGGT-3'.

[0012] A kit for the above-mentioned SNP molecular markers, comprising the above-mentioned primer combination.

[0013] The above-mentioned SNP molecular markers or primer combinations or kits are used in screening yellow-feathered broiler chickens with low feed conversion ratios.

[0014] A method for screening yellow-feathered broiler chickens with low feed conversion ratio involves using PCR technology to amplify and sequence the aforementioned SNP molecular markers, screening individuals with the SNP molecular marker genotype GG as breeding chickens, and progressively increasing the frequency of the SNP molecular marker genotype GG to obtain yellow-feathered broiler chickens with low feed conversion ratio.

[0015] Further, PCR amplification was performed using the primer combinations or kits described above.

[0016] Furthermore, the PCR amplification system was as follows: 10 μL of 2×Taq Master Mix, 1 μL each of forward and reverse primers, 1 μL of DNA template, and ddH2O added to a final volume of 20 μL.

[0017] Furthermore, the PCR reaction conditions were as follows: 94℃ pre-denaturation for 2 min; 94℃ denaturation for 15 s, 56℃ annealing for 10 s, 72℃ extension for 30 s, 35 cycles; 72℃ extension for 5 min.

[0018] The present invention has the following beneficial effects:

[0019] This invention provides a CLOCK gene SNP molecular marker associated with feed conversion ratio in yellow-feathered broiler chickens. Among this SNP molecular marker, genotype and allele frequencies showed significant differences between the low and high feed conversion ratio groups (P < 0.01). In the low feed conversion ratio group, the frequency of allele G was significantly higher than that of allele A, and the frequency of genotype GG was significantly higher than that of genotype A. G The frequency of A indicates that the polymorphism of the SNP molecular markers provided by this invention is significantly correlated with the chicken feed conversion rate trait. It can be applied to select chicken flocks with low feed conversion rates, improve the efficiency of the broiler industry, provide convenience and technical support for the rapid breeding of broilers with low feed conversion rates, effectively reduce feed costs in the production process, and improve the economic benefits and competitiveness of enterprises. Attached Figure Description

[0020] Figure 1 For example, GWAS analysis of feed conversion ratio in Example 1 was performed, and a Manhattan plot was generated using SNP markers.

[0021] Figure 2 This is a sequencing diagram of the SNP molecular marker genotype in Example 2. Detailed Implementation

[0022] The principles and features of the present invention are described below with reference to the accompanying drawings. The examples given are for illustrative purposes only and are not intended to limit the scope of the invention. Unless otherwise specified in the examples, conventional conditions or conditions recommended by the manufacturer should be followed. Reagents or instruments whose manufacturers are not specified are all commercially available products.

[0023] Example 1: Screening of SNP molecular markers

[0024] 1872 healthy yellow-feathered broiler chickens were selected and fed together until 56 days of age. From 56 days of age, they were transferred to individual cages for separate feeding. The experiment ended at 98 days of age. Daily feed intake, initial body weight, and final body weight were recorded for each chicken. Feed conversion ratio was calculated using the following formula:

[0025]

[0026] In the formula, FCR is the feed conversion ratio; W f For feed consumption; W a To increase the weight of living organisms.

[0027] A lower FCR value indicates a lower feed conversion ratio, meaning less feed is consumed for the same production capacity, i.e., feed conservation. DNA was extracted from each sample, and the DNA samples underwent quality testing. DNA concentration was measured using a Qubit Fluorometer, and DNA fragment size and degradation were measured using agarose gel electrophoresis. The results showed that 99 samples were substandard, and the 1773 qualified DNA samples from yellow-feathered chicken breeders were used for subsequent library construction and sequencing. Simplified genome sequencing was performed using high-throughput yield measurement technology. Sequencing data underwent quality control and filtering to remove low-quality sequencing reads and potential false positive BNPs. Feed conversion ratio was used as a phenotype and correlated with SNP data. GWAS analysis was performed using the EMMAX program (http: / / genetics.cs.ucla.edu / emmax / index.html), and the analysis model is as follows:

[0028] y = Xb + Zu + m + e;

[0029] In the model, y represents the true value of the trait record, X represents the fixed-effects association matrix, b represents the fixed-effects vector, the fixed effects include batch effects and three principal component effects, Z represents the additive genetic effects association matrix, u represents the individual additive genetic effects vector, e represents the residual, and u ~ N(0, Gσ) 2 α ), e~N(0, Iσ 2 ε α), G represents the genomic kinship matrix, I represents the identity matrix, σ 2 α σ 2 ε α represents the variance of the additive genetic effect and the variance of the residuals, respectively, and m represents the SNP marker effect.

[0030] Based on the association analysis results, a SNP molecular marker associated with the feed conversion ratio trait in yellow-feathered broilers was identified. This molecular marker is located on chromosome 27 of yellow-feathered broilers. Figure 1 The Manhattan diagram is shown below. The mutation site and upstream and downstream sequences of this SNP molecular genetic marker are as follows:

[0031] 5'-AGGATTAAGTCCCAGTGTTCTCTGTTCAGCTGTCAGCCAGGAG AGGAGCATTCTCTGACATACAAGTAGTGACCAAGGCTCTGAATATTTCTGCCTGTCAAATCTTCAGCTAATTCGAGCGCTGTATATTTAGCATCCATGAGCAGAAAAATGAAAGCTTTTGGTTATCAGTAGCTTTTGGGGACATCATAAATACTGAGRCACCGAGTTCTAATCATTTTCTTG ACACTTTTTTATCACGCAGGTTCATAGCCAAGAACATTATGAAGCTGCAGCGCCTGGGGATAACCCATGTTCTGAATGCAGCAGAGGGGAAGTCATTCATGCATGTGAACACTAATGCAGAATTCTATGAAGGCACAGGCATCACATACCATGGCATTAAAGCTAACGATACGCAGG-3'(SEQ ID NO.1). R represents the G>A mutation site. When R is G, chickens have a lower feed conversion rate. 5'- and -3' represent the 5' end and 3' end of the nucleotide sequence, respectively.

[0032] Example 2: Validation of SNP molecular markers

[0033] The molecular markers obtained in Example 1 were validated in another yellow-feathered broiler population, totaling 1773 healthy individuals. All experimental chickens were fed together until 56 days of age, after which they were transferred to individual cages. The experiment ended at 98 days of age. 150 individuals with low feed conversion ratio (FCR < 3.0) and 150 individuals with high feed conversion ratio (FCR > 3.0) were selected. Blood samples were taken for DNA extraction. The mean FCR of the 150 individuals with low feed conversion ratio was 2.6 ± 0.38, and the mean FCR of the individuals with high feed conversion ratio was 3.4 ± 0.39. PCR reactions were performed using the extracted DNA as templates.

[0034] Forward primer: 5'-TCCCAGTGTTCTCTGTTCAGCT-3' (SEQ ID NO.2);

[0035] Reverse primer: 5'-ATCGTTAGCTTTAATGCCATGGT-3' (SEQ ID NO.3).

[0036] PCR amplification system: 10 μL of 2×Taq Master Mix, 1 μL each of forward and reverse primers, 1 μL of DNA template, and ddH2O to a final volume of 20 μL.

[0037] PCR reaction conditions: 94℃ pre-denaturation for 2 min; 94℃ denaturation for 15 s, 56℃ annealing for 10 s, 72℃ extension for 30 s, 35 cycles; 72℃ extension for 5 min.

[0038] The PCR products were sequenced and analyzed using the Sanger sequencing method.

[0039] The sequencing results were analyzed, and the genotype of each individual was recorded according to the sequencing peak diagram of each sample (e.g., Figure 2 In the sequencing map of genotype GG, only one peak appears at the corresponding locus, indicating that the alleles are the same (G). In the sequencing map of genotype GA, two peaks appear at the corresponding locus, indicating that the alleles are different (one is G and the other is A). One-way ANOVA using SPSS 26.0 was used to analyze the relationship between the genotype and allele of the SNP molecular marker and feed conversion ratio. The results are shown in Tables 1 and 2. For this SNP molecular marker, the genotype and allele frequencies showed highly significant differences between the low and high feed conversion ratio groups (P < 0.01). In the low feed conversion ratio group, the frequency of the G allele was higher than that of the A allele, and the frequency of the GG genotype was higher than that of the G genotype. A The frequency of the markers indicates that individuals with the GG genotype at position 201 have a superior feed conversion ratio phenotype compared to those with the GA genotype. This further demonstrates that the polymorphism of the screened molecular markers is significantly correlated with the feed conversion ratio trait, identifying them as SNP sites associated with the feed conversion ratio trait, which can be used for breeding yellow-feathered broilers with low feed conversion ratios.

[0040] Table 1. Statistical table of distribution differences of SNP molecular marker genotypes between low and high feed conversion ratios.

[0041]

[0042] Table 2. Statistical table of distribution differences of SNP molecular marker alleles between low and high feed conversion ratios.

[0043]

[0044] Example 3: Assisted molecular breeding method for feed conversion ratio trait in yellow-feathered broiler chickens using SNP molecular marker alleles

[0045] (1) Blood was collected from the wing vein of the individual to be tested, anticoagulated with EDTA, stored at -20℃, and DNA was extracted.

[0046] (2) PCR was performed using a kit for amplifying the above SNP molecular markers. The kit contained 2×TaqMaster Mix, forward and reverse primers (forward primer: 5'-TCCCAGTGTTCTC TGTTCAGCT-3' (SEQ ID NO.2), reverse primer: 5'-ATCGTTAGCTTTAATG CCATGGT-3' (SEQ ID NO.3), concentration 10 mmol / L), and ddH2O.

[0047] PCR amplification system: 10 μL of 2×Taq Master Mix, 1 μL each of forward and reverse primers, 1 μL of DNA template, and ddH2O to a final volume of 20 μL.

[0048] PCR reaction conditions: 94℃ pre-denaturation for 2 min; 94℃ denaturation for 15 s, 56℃ annealing for 10 s, 72℃ extension for 30 s, 35 cycles; 72℃ extension for 5 min.

[0049] (3) The PCR products were sequenced using the Sanger sequencing method.

[0050] (4) Based on the genotyping results, homozygous individuals with the SNP marker chr27-6510723 as the AA genotype were selected for breeding to reduce feed conversion rate and effectively reduce feed consumption and breeding costs. Individuals with this marker were selected to join the core breeding population, which can achieve the screening of alleles related to this trait and provide technical support for accelerating the progress of genetic selection.

[0051] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. A primer combination or kit for amplifying the SNP molecular marker of the CLOCK gene associated with feed conversion ratio in yellow-feathered broilers, used in screening yellow-feathered broilers with low feed conversion ratio, characterized in that, The SNP molecular marker polymorphism is G / A, and the RS number is rs315082113; when the SNP is G, it is a yellow-feathered broiler with low feed conversion ratio, and the kit includes the primer combination.

2. The application according to claim 1, characterized in that, The sequence of the SNP molecular marker is shown in SEQ ID NO.1, where R is the G>A mutation site.

3. The application according to claim 1, characterized in that, The primer combination includes the forward primer shown in SEQ ID NO.2 and the reverse primer shown in SEQ ID NO.

3.

4. A method for screening yellow-feathered broiler chickens with low feed conversion ratio, characterized in that, Using PCR technology, the SNP molecular markers described in any one of claims 1-3 are amplified and sequenced. Individuals with the SNP molecular marker genotype GG are screened and used as breeding chickens. The frequency of the SNP molecular marker genotype GG is increased generation by generation to obtain yellow-feathered broiler chickens with low feed conversion ratio.

5. The method for screening yellow-feathered broiler chickens with low feed conversion ratio according to claim 4, characterized in that, PCR amplification was performed using the primer combinations or kits described in any one of claims 1-3.

6. The method for screening yellow-feathered broiler chickens with low feed conversion ratio according to claim 4, characterized in that, The PCR amplification system was as follows: 10 μL of 2×Taq Master Mix, 1 μL each of forward and reverse primers, 1 μL of DNA template, and ddH2O added to a final volume of 20 μL.

7. The method for screening yellow-feathered broiler chickens with low feed conversion ratio according to claim 4, characterized in that, The PCR reaction conditions were: 94℃ pre-denaturation for 2 min; 94℃ denaturation for 15 s, 56℃ annealing for 10 s, 72℃ extension for 30 s, 35 cycles; 72℃ extension for 5 min.

Images