A molecular marker for identifying high or low soluble solids content of melon fruit and application thereof
By developing SSC-CAPS molecular markers in the melon genome and using SNP variant sites (c/g) to identify the soluble solids content of melon fruits, the problem of rapid identification in existing technologies has been solved, enabling quality control and efficient breeding of melons during the seedling stage.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- HENAN AGRICULTURAL UNIVERSITY
- Filing Date
- 2024-08-13
- Publication Date
- 2026-04-28
AI Technical Summary
Current technology lacks effective methods for rapidly identifying and controlling the soluble solids content of melon fruits, making market quality control difficult to achieve.
SSC-CAPS molecular markers located at positions 21,807,825 to 21,808,062 on chromosome 2 of the melon genome DHL92 v3.6.1 were developed. The soluble solids content of melon fruits was identified by using the c/g of SNP variant sites. The soluble solids content of fruits was detected by PCR amplification and enzyme digestion electrophoresis.
This technology enables rapid assessment of the soluble solids content of melon fruits during the seedling stage, distinguishing between melons with high and low soluble solids content, thus improving the efficiency of melon breeding.
Smart Images

Figure CN119193896B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biotechnology, specifically relating to a molecular marker for identifying the soluble solids content of melon fruits and its application. Background Technology
[0002] melon( cucumis melo Melon (L.) is an important cucurbitaceous crop. Its fruit is rich in vitamins and minerals, has high economic value, and is one of the world's top ten fruits, possessing high nutritional and economic value. Although China has a long history of melon cultivation and ranks first in the world in terms of cultivation area and yield, the quality of the fruit is inconsistent, and market quality control urgently needs to be addressed from the source.
[0003] Sweetness is an important flavor quality of melons, primarily determined by the content of soluble sugars in the pulp. Soluble sugars are the main component of soluble solids. Visually measuring the soluble solids content in the pulp is currently a common and effective method for rapidly identifying the sweetness of melon pulp. Research on controlling the soluble solids content and sweetness of melons has made progress. Yang Yong et al. (2022) constructed an F2 population using "high-sugar VZX × low-sugar material HP" as parents and located a QTL with a span of 3.29 Mb on chromosome 8 using the BSA method. Shahwar et al. (2023) constructed a recombinant inbred line using "USDa-846-1 × top Mark" as parents and located QTLs related to soluble solids content on chromosomes 1, 2, 6, 7, 8, 9, and 10, respectively. However, current techniques do not document the identification of soluble solids content in fruits. This patent detected significant loci associated with the soluble solids content of melon fruits through genome-wide association analysis, identified genes and SNP variation sites that control the soluble solids content of melon fruits, developed a codominant CAPS marker, and validated it in a natural melon population. The results showed that the marker can be used to guide molecular marker-assisted breeding to identify the level of soluble solids content in melons. Summary of the Invention
[0004] This invention provides a molecular marker and its application for identifying the soluble solids content of melon fruits. It can be used to determine the soluble solids content of melon fruits during the seedling stage, make an initial judgment on the sweetness of the fruits, and accelerate the breeding process of high-sugar melons.
[0005] This invention provides a molecular marker for identifying the soluble solids content of melon fruits, named the SSC-CAPS molecular marker. This marker is located at positions 21,807,825 to 21,808,062 on chromosome 2 of the melon genome DHL92 v3.6.1, with the nucleotide sequence shown in SEQ ID NO.1. This molecular marker is located on the chromosome... MELO3C026992The promoter region of the gene (chr02:21802395..21807407), the coding sequence of which is shown in SEQ ID NO.2, and the promoter sequence of which is shown in SEQ ID NO.3.
[0006] As mentioned above, the SNP mutation site is located at position 37 of the sequence shown in SEQ ID NO.1, and the SNP site is a c / g binary allelic variant.
[0007] As mentioned above, at the SNP mutation sites, melon materials containing allelic variant c exhibit low average soluble solids content in their fruits, while melon materials containing allelic variant g exhibit high average soluble solids content in their fruits.
[0008] This invention also provides a detection primer for a molecular marker to identify the soluble solids content of melon fruit. The nucleotide sequences of the primer pairs are shown in Table 2, and a restriction endonuclease taq1 capable of recognizing the aforementioned SNP sites is also provided. This molecular marker belongs to the CAPS marker family.
[0009] The present invention also provides a method for identifying the soluble solids content of melon fruit, the method comprising the step of applying the above-mentioned molecular marker.
[0010] The above method for determining the soluble solids content of melon fruit includes the following steps:
[0011] (1) Extract genomic DNA from the melon samples being tested;
[0012] (2) Using the DNA obtained in step (1) as a template, perform PCR amplification using the specific primers described above, and digest the amplification product with Taq1 enzyme, perform electrophoresis and / or genome sequencing.
[0013] (3) The results of electrophoresis and / or genome sequencing in step (2) shall be used to determine the criteria for judgment:
[0014] If the electrophoresis product has a characteristic band of 237 bp or the sequence shown in SEQ ID NO.1, the sample indicates a high soluble solids content in the fruit. If the electrophoresis product has a characteristic band of 201 bp or the sequence shown in SEQ ID NO.4, the sample indicates a low soluble solids content in the fruit. If the electrophoresis product has two characteristic bands of 201 bp and 237 bp, respectively, the sample is heterozygous.
[0015] Effects: The nucleotide sequence of the molecular marker provided by this invention is shown in SEQ ID NO.1. The SNP site is located at position 37 of the sequence shown in SEQ ID NO.1. This SNP site is c / g. The allelic variation of fruits with high soluble solids content is g, and the allelic variation of fruits with low soluble solids content is c. A CAPS marker capable of identifying this SNP site was also developed. Using the molecular marker provided by this invention, the soluble solids content of melons can be identified, distinguishing between melons with high and low soluble solids content. This allows for the identification of melon materials with high soluble solids content at the seedling stage, preliminary screening of high-sugar melon materials, and accelerates the breeding process of high-sugar melons. Attached Figure Description
[0016] Figure 1 This is a map showing the SNP density distribution of germplasm used in genome-wide association analysis of melon.
[0017] Figure 2 Manhattan plot for genome-wide association analysis of soluble solids content in melon fruit, where: the horizontal axis represents the genomic location of each variant site; the vertical axis represents each marker site in the MLM model. P The value is the negative logarithm to base 10; the red horizontal dashed line represents the threshold; the red box indicates the significant association sites discovered.
[0018] Figure 3 The QQ plot is a genome-wide association analysis of the soluble solids content trait in melon fruit, where: the horizontal axis represents the negative logarithm of the expected observed P-values, which is assumed to follow a uniform distribution [0, 1]; the vertical axis represents the negative logarithm of the observed P-values, which is base 10.
[0019] Figure 4 This is a schematic diagram of the associated gene and the SNP mutation site (chr02_21807861) in the promoter region of the gene.
[0020] Figure 5 The restriction endonuclease cleavage site is a molecular marker for SSC-CAPS.
[0021] Figure 6 Box plots showing the distribution of soluble solids content in fruit samples from three genotypes corresponding to the SNP variant chr02_21807861; *** represents p <0.001.
[0022] Figure 7 Sequence alignment of e-PCR products from SSC-CAPS-labeled primers for five de novo sequencing materials.
[0023] Figure 8The image shows the polyacrylamide gel electrophoresis results of PCR products of SSC-CAPS molecular markers after digestion with restriction endonuclease Taq1. Lane M represents the marker (2000×), lanes 1-7 are melon samples with high soluble solids content, and lanes 8-14 are melon samples with low soluble solids content.
[0024] In the sequence list:
[0025] SEQ ID NO.1 is the nucleotide sequence (237bp) of the SSC-CAPS molecular marker.
[0026] SEQ ID NO.2 is a gene MELO3c026992 The encoded sequence (1569bp).
[0027] SEQ ID NO.3 is a gene MELO3c026992 The promoter sequence (2000bp).
[0028] SEQ ID NO.4 is the nucleotide sequence (201 bp) after digestion with SSC-CAPS molecular markers. Detailed Implementation
[0029] The present invention will be further described below with reference to the embodiments. Experimental methods in the following embodiments that do not specify specific conditions are generally performed using methods known in the art. Unless otherwise specified, reagents and consumables used in the embodiments can be purchased commercially.
[0030] Example 1: Identifying SNP sites significantly associated with soluble solids content in melon fruits
[0031] 1. Phenotypic Data Acquisition: The research materials consisted of 200 polymorphic core germplasm materials of melon, including 164 cultivar materials and 36 wild materials, selected from the National Watermelon and Melon Germplasm Bank (Zhengzhou, China). These materials were planted at the research base of Maozhuang Science and Education Park, Henan Agricultural University, Zhengzhou City in 2017, 2018, and 2023, respectively. Five to ten plants of each material were planted twice a year, in spring and autumn. After fruit maturity, well-developed mature fruits were selected to determine their soluble solids content (SSC), with three biological replicates. The phenotypic data from the six replicates were fitted and used for subsequent genome-wide association analysis (GWAS) (Table 1).
[0032]
[0033] 2. Obtaining SNP genotype data: Using 200 core germplasm materials of melon as the GWAS analysis population, total DNA was extracted from the population materials using a modified CTAB method. After ultrasonic fragmentation, fragments of 300 bp were selected by electrophoresis. PCR amplification and library construction were performed, and quality-controlled libraries were sequenced (Illumina). Raw read adapter removal, random primer removal, and low-quality read filtering were then performed. The processed clean-reads were aligned to the DHL92 v3.6.1 reference genome of melon to obtain whole-genome variation information. Variation information was quality controlled according to the following criteria: maximum SNP deletion rate greater than 80% and minimum allele frequency greater than 5%. After quality control, 2,538,320 valid SNPs were obtained, with a total effective genome length of 375,356,489 bp. On average, there was one SNP variation per 147 bases on the chromosome. The density and distribution of whole-genome variation markers are shown below. Figure 1 Table 2. Based on this, the data were standardized using IDAK software to calculate the covariance matrix and decompose the eigenvalues, finally obtaining the dimensionality-reduced data. The data with 5 principal components were used as covariates. At the same time, IDAK was used to estimate the kinship between two individuals in the population and establish a kinship K-matrix for subsequent GWAS analysis.
[0034]
[0035] 3. Identification of SNPs significantly associated with soluble solids content in melons: GWAS analysis was performed using a mixed linear model (MLM) in TASSEL 5.0 software, combined with the phenotypic and SNP genotypic data. When the p-value of the detected variant was less than 3.94 × 10⁻⁶, the association was considered significant. -7 At that time, it was considered a significantly associated site. Manhattan plots (Figure 2) and QQ plots (Figure 3) of the p-values of the whole genome loci were plotted using R packages. The results showed that the soluble solids content trait in melon fruit formed a peak on chromosome 2, and the QQ plots fit consistently, proving the accuracy of the association analysis. The Lead_SNP site of the peak on chromosome 2 is: chr02_21469098. Through gene function annotation, a candidate gene was found near 0.34 Mb of the Lead_SNP. MELO3C02699 (chr02:21802395..21807407). This gene encodes the sugar transporter protein, abbreviated as... STP This gene (Figure 4) plays a crucial role in sugar transport, growth, and development in plants. GWAS analysis was performed on population materials. STP Sequence analysis of the gene revealed a single SNP mutation (chr02_21807861:c>g) in its promoter region. Figure 5 ).
[0036] 4. Genotypic and Phenotypic Analysis: Allelic variation analysis of the SNP locus chr02_21807861 in the GWAS analysis population revealed a binary allelic variation (c / g). Three genotypes were found at this locus in the population: gg, cg, and cc. The gg and cc genotypes accounted for 91% of the population, representing the predominant genotypes and indicating high homozygosity at this SNP locus. Analysis of the SSC phenotypes corresponding to these three genotypes showed that the average soluble solids content (SSC) was 6.43% for the cc genotype, 8.17% for the gg genotype, and 7.15% for the cg genotype. One-way ANOVA analysis revealed that the soluble solids content of the fruit from the gg genotype was significantly higher than that of the fruit from the cc genotype. p <0.001 (Figure 6). Further analysis showed that the average soluble solids content of melon fruits containing only allelic variant g at SNP site chr02_21807861 was 8.12%, while the average soluble solids content of melon fruits containing only allelic variant c was 6.49%.
[0037] The SNP site chr02_21807861 provided in this embodiment is associated with the soluble solids content trait of melon, and its nucleotide sequence is shown in SEQ ID NO.1. This molecular marker is located on the chromosome. MELO3C026992 The promoter region of the gene (chr02:21802395..21807407), the coding sequence of which is shown in SEQ ID NO.2, and the promoter sequence of which is shown in SEQ ID NO.3.
[0038] Example 2: Validation of the binary variant g / c at the SNP site chr02_21807861 in high-quality sequencing materials
[0039] 1. Five melon accessions that had undergone de novo sequencing were collected: high-sucrose-accumulating accessions DHL92, Harukei-3, Payzawat, and charmono (http: / / cucurbitgenomics.org / v2), and low-sucrose-accumulating accession IVF77 (http: / / cucurbitgenomics.org / v2). These five accessions showed significant differences in soluble solids content (SSI) in their fruits, as shown in Table 3. ePCR was performed on their genomes using primers that marked SSI content in melon fruits. The amplification products are shown in Figure 7. The ePCR results showed a c / g variation at SNP position 37, demonstrating that this marker can distinguish between high-sugar and low-sugar melon accessions.
[0040]
[0041] Example 3: SNP mutation site-specific restriction enzyme site analysis and CAPS marker development
[0042] 1. Specific restriction enzyme site analysis: Based on the SNP variant site (chr02_21807861) obtained in Example 1, the sequence of this site (200bp at each end) was extracted: tttatttaattcctaatttcatgatttaccataattttaaccttgatttttaattgaaatattcattatctttttgtttttaaaatgtctttctgatttttgtatgttttacttcataaatgaaaaggattattatttgttgttgttgttgtttaaaatcgatgat The restriction endonuclease information caused by chr02_21807861 was searched using the online enzyme digestion recognition software dCAPS Finder 2.0 (http: / / helix.wustl.edu / dcaps / dcaps.html). The endonuclease Taq1 was selected, and its digestion recognition sequence is tcga.
[0043] 2. Primer design: PCR primers were designed using Primer3 (v.0.4.0) (https: / / bioinfo.ut.ee / primer3-0.4.0 / ) software. The product length was 80-400bp. Based on this, a pair of specific primers were designed, as shown in Table 4.
[0044]
[0045] Example 4: Application of CAPS molecular markers in other melon materials
[0046] 1. Sample preparation: Fourteen randomly selected melon breeding materials were used as samples, of which seven were materials with high soluble solids content and seven were materials with low soluble solids content (Table 5). Seeds from the 14 melon materials were germinated and raised into seedlings using conventional methods. When the seedlings grew to the two-leaf-one-heart stage, the heart leaves were removed and their genomic DNA was extracted using a modified CTAB method for later use.
[0047]
[0048] 2. PCR Amplification: PCR amplification was performed on the DNA from the 14 melon samples listed in Table 4 using the specific primers designed in Example 2. The amplification system was 10 μL, including: 1 μL DNA template, 0.5 μL each of the forward and reverse primers for the SSC-CAPS molecular marker, 5 μL 2× Phanta Flash Master Mix, and 3 μL ddH2O. The PCR amplification program was: 98℃ pre-denaturation for 30 s; 98℃ denaturation for 10 s, 50℃ annealing for 5 s, 72℃ extension for 5 s, for a total of 33 cycles; and 72℃ extension for 1 min. The PCR products were detected by agarose gel electrophoresis, yielding a single band, indicating good primer specificity, and the PCR amplification product was 237 bp in length.
[0049] 3. Enzyme digestion of amplified products: The PCR amplified products were digested with restriction enzyme Taq1. The digestion system was 10 μL, including: 1 μL of restriction enzyme Taq1, 5 μL of PCR amplified product, 2 μL of 10×NE Buffer, and 2 μL of ddH2O. The digestion program was: incubation at 65℃ for 3 h. The digested products were electrophoresed on a 7% polyacrylamide gel. The electrophoresis results are shown below. Figure 8As shown in the figure. Electrophoresis results showed differences in electrophoretic bands between melon materials with high and low soluble solids content. In melon materials with low soluble solids content, PCR amplification products could form two bands, 201 bp and 36 bp, after enzyme digestion, but only the 201 bp band was detected by electrophoresis (the 36 bp band was too short and migrated out of the gel in a very short time during electrophoresis and could not be detected). In contrast, in melon materials with high soluble solids content, PCR amplification products could not be digested by enzymes, and electrophoresis showed a band size of 237 bp.
[0050] Therefore, by using the SSC-CAPS molecular marker provided in Example 3, it is possible to distinguish the soluble solids content of melon fruits during the seedling stage, thereby enabling rapid screening of high-sweetness melon breeding materials and accelerating the breeding process of melon varieties.
[0051] In summary, the above embodiments are merely general descriptions of the present invention. However, the scope of protection of the present invention is not limited thereto. Any improvements and modifications made without departing from the essence of the present invention shall fall within the scope of protection claimed by the present invention.
Claims
1. The application of an SNP molecular marker for identifying the soluble solids content of melon fruits in identifying the soluble solids content of melon fruits, characterized in that: The nucleotide sequence of the molecular marker, as shown in SEQ ID NO.1, is located on chromosome 2 of the melon, and a c / g binary polymorphism exists at the 37th SNP of the nucleotide sequence shown in SEQ ID NO.
1.
2. The application of the CAPS marker of the SNP described in claim 1 in identifying the soluble solids content of melon fruit, wherein the CAPS marker comprises primers and taq1 restriction endonuclease; The forward primer sequence is 5'-gatgattttggtcactctttacaa-3'; The reverse primer sequence is 5'-aggtgttgatcccgtcagtaa-3'.
3. A method for identifying the soluble solids content of melon fruit using the SNP molecular marker described in claim 1, characterized in that: Includes the following steps: Step 1: Extraction of genomic DNA from the melon sample being tested; Step 2: Using the DNA obtained in Step 1 as a template, perform PCR amplification using the CAPS molecular marker primers described in claim 2, and digest the amplification product with Taq1 enzyme and perform electrophoresis. Step 3: Determine the results of the electrophoresis performed in Step 2. The determination criteria are as follows: If the electrophoresis product has a characteristic band of 237 bp, the sample has a high soluble solids content in the fruit; if the electrophoresis product has a characteristic band of 201 bp, the sample has a low soluble solids content in the fruit; if the electrophoresis product has two characteristic bands of 201 bp and 237 bp, the sample is heterozygous.
4. The application of a kit for detecting the SNP of claim 1 in identifying the soluble solids content of melon fruit, the kit comprising the CAPS marker of claim 2.
Citation Information
Patent Citations
Molecular marker and use thereof
CN105802961A
Molecular marker for indicating and identifying character of orange pulp of melon, and primer and application thereof
CN106834529A