Method for identifying resistance ability of sorghum variety to sorghum anthracnose

Abstract

The invention discloses a method for identifying the resistance ability of a sorghum variety to sorghum anthracnose. The invention belongs to the technical field of biology, and particularly relates to a method for identifying the resistance ability of a sorghum variety to sorghum anthracnose. The method for identifying the resistance ability of the sorghum variety to the sorghum anthracnose comprises the following steps: detecting genome DNA (Deoxyribose Nucleic Acid) of sorghum to be identified; the sorghum anthracnose resistance of the to-be-identified sorghum of which the genome DNA does not contain the InDel molecular marker 1 and the molecular marker 2 is higher than or candidates higher than that of the to-be-identified sorghum of which the genome DNA contains the InDel molecular marker 1 and the molecular marker 2; the InDel molecular marker 1 is a double-stranded DNA molecule at the 43rd-50th site of which the nucleotide sequence of one strand is SEQ ID No.1; and the InDel molecular marker 2 is a double-chain DNA molecule of which the nucleotide sequence of one chain is SEQ ID No.5.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and in particular relates to a method for identifying the resistance of sorghum varieties to sorghum anthracnose. Background Art

[0002] Anthracnose is one of the most common and serious diseases in sorghum production. It is more likely to occur and spread in warm and humid tropical and subtropical planting areas. Sorghum anthracnose (Colletotrichum sublineola) can not only cause the leaves of sorghum plants to wilt, but also cause stem rot, causing the plant to fall over, and even damage the ear, making the grain smaller, resulting in a 69%-100% reduction in sorghum yield. Once sorghum leaf diseases occur, they spread very quickly, causing all the leaves of the plant to die within a few days, resulting in serious yield losses. The use of agricultural and chemical control measures is not effective in preventing the disease, and the promotion and use of disease-resistant varieties is effective and scientific and environmentally friendly. Therefore, strengthening the screening of sorghum disease-resistant gene resources will help accelerate the breeding process of disease-resistant varieties.

[0003] Compared with traditional technologies, molecular marker-assisted breeding technology will greatly improve the breeding efficiency of improved anthracnose-resistant varieties. Molecular markers are genetic markers based on nucleotide sequence variation within genetic material between individuals, and are a reflection of polymorphism at the nucleotide sequence level. InDel markers, or insertion and deletion markers, refer to the differences between two parents in the whole genome. Specifically, it refers to the insertion or deletion of nucleotide fragments of different sizes in the sequence of the same site of the genome between closely related species or different individuals of the same species. InDel markers have the advantages of rich polymorphism, high density, high accuracy, stable variation, and simple detection. In addition, they have low DNA quality requirements and sample quantity requirements, and can even amplify highly degraded DNA. Therefore, InDel markers have made important progress in the fields of molecular marker-assisted breeding of crops, germplasm resource analysis and molecular-assisted genetic breeding, and population genetic analysis. Therefore, exploring sites related to sorghum anthracnose resistance is of great significance for screening sorghum varieties with anthracnose resistance, providing an important theoretical basis for the effective development of sorghum breeding, and at the same time, it has great economic value. Summary of the invention

[0004] The main problem to be solved by the present invention is how to identify or assist in identifying the anthracnose resistance of sorghum varieties and carry out sorghum breeding.

[0005] In order to solve the above problems, the present invention provides a method for identifying the resistance of sorghum varieties to sorghum anthracnose.

[0006] The present invention first provides a method for identifying the resistance of sorghum varieties to sorghum anthracnose, comprising the following steps:

[0007] Detecting whether the genomic DNA of the sorghum to be identified contains InDel molecular marker 1 and InDel molecular marker 2, the sorghum anthracnose resistance of the sorghum to be identified whose genomic DNA does not contain the InDel molecular marker 1 and molecular marker 2 is stronger or higher than that of the sorghum to be identified whose genomic DNA contains the InDel molecular marker 1 and / or molecular marker 2;

[0008] The InDel molecular marker 1 is a double-stranded DNA molecule whose nucleotide sequence on one strand is positions 43 to 50 of SEQ ID No. 1;

[0009] The InDel molecular marker 2 is a double-stranded DNA molecule whose nucleotide sequence on one strand is SEQ ID No.5.

[0010] In a specific embodiment, the above method comprises the following steps:

[0011] (1) using the genomic DNA of the sorghum to be identified as a template and using identification primer set 1 to perform PCR amplification to obtain PCR product 1;

[0012] (2) identifying the resistance of sorghum to sorghum anthracnose according to whether the PCR product 1 contains the InDel molecular marker 1 described above, and obtaining the sorghum preliminary screening variety to be identified with strong resistance;

[0013] (3) using the genomic DNA of the sorghum variety to be identified obtained in (2) as a template, and performing PCR amplification using identification primer set 2 to obtain PCR product 2;

[0014] (4) identifying the resistance of sorghum to sorghum anthracnose according to whether the PCR product 2 contains the InDel molecular marker 2 described above, and obtaining the sorghum to be identified with strong resistance, that is, a sorghum variety with resistance to sorghum anthracnose;

[0015] The sorghum to be identified whose PCR product 1 does not contain the InDel molecular marker 1 described above has a higher or candidate higher resistance to sorghum anthracnose than the sorghum to be identified whose PCR product contains the InDel molecular marker 1 described above;

[0016] The nucleotide sequence of the PCR product 1 may be SEQ ID No.1 or SEQ ID No.2.

[0017] The double-stranded DNA molecule at positions 43-50 of SEQ ID No. 1 is molecular marker 1.

[0018] Furthermore, the sorghum to be identified whose PCR product 1 contains a DNA molecule whose nucleotide is the SEQ ID No. 2 has a higher or candidate higher resistance to sorghum anthracnose than the sorghum to be identified whose PCR product contains the InDel molecular marker 1 mentioned above (positions 43-50 of the SEQ ID No. 1).

[0019] The sorghum to be identified whose PCR product 2 does not contain the InDel molecular marker 2 described above has a higher or candidate higher resistance to sorghum anthracnose than the sorghum to be identified whose PCR product contains the InDel molecular marker 2 described above;

[0020] The nucleotide sequence of the PCR product 2 may be SEQ ID No.5 or SEQ ID No.6.

[0021] Furthermore, the sorghum to be identified whose PCR product 2 contains a DNA molecule whose nucleotide is the SEQ ID No. 6 has a higher or candidate higher resistance to sorghum anthracnose than the sorghum to be identified whose PCR product contains the InDel molecular marker 2 (the SEQ ID No. 5) described above.

[0022] The identification primer set 1 is composed of a forward primer and a reverse primer, wherein the forward primer is a single-stranded DNA that specifically binds to the upstream of the InDel molecular marker 1 in the sorghum genomic DNA, and the reverse primer is a single-stranded DNA that specifically binds to the downstream of the InDel molecular marker 1 in the sorghum genomic DNA;

[0023] The identification primer set 2 consists of a forward primer and a reverse primer, wherein the forward primer is a single-stranded DNA that specifically binds to the upstream of the InDel molecular marker 2 in the sorghum genomic DNA, and the reverse primer is a single-stranded DNA that specifically binds to the downstream of the InDel molecular marker 2 in the sorghum genomic DNA.

[0024] In a specific embodiment, the PCR amplification reaction system is 25 μl, consisting of 50-100 ng of genomic DNA of sorghum leaves to be tested, 1 μL of forward primer aqueous solution (concentration of 10 pmol / μL), 1 μL of reverse primer aqueous solution (concentration of 10 pmol / μL), 12.5 μL 2×Taq PCR Master Mix (Nanjing Novogene Biotechnology Co., Ltd., P111-01) and ddH2O.

[0025] The reaction conditions of the PCR amplification are: pre-denaturation at 95°C for 3 min; 95°C for 15 sec, 55°C for 15 sec, 72°C for 30 sec, 35 cycles; 72°C for 5 min; and storage at 4°C.

[0026] In a specific embodiment, the identification primer set 1 in the above method consists of primer F and primer R, the nucleotide sequence of primer F is SEQ ID No.3, and the nucleotide sequence of primer R is SEQ ID No.4; the identification primer set 2 consists of primer F1 and primer R1, the nucleotide sequence of primer F1 is SEQ ID No.7, and the nucleotide sequence of primer R1 is SEQ ID No.8.

[0027] The identification primer set 1 and identification primer set 2 in the method described above also fall within the scope of protection of the present invention.

[0028] The present invention also provides an application of an InDel molecular marker or a substance for detecting the InDel molecular marker, wherein the InDel molecular marker is the InDel molecular marker 1 and the InDel molecular marker 2 described above; the application may be any of the following:

[0029] 1) Use of InDel molecular markers or substances for detecting the InDel molecular markers in identifying or assisting in identifying the resistance of sorghum to sorghum anthracnose,

[0030] 2) Application of InDel molecular markers or substances for detecting the InDel molecular markers in sorghum breeding.

[0031] In the above application, the substance contains PCR primers for amplifying a sorghum genomic DNA fragment including the InDel molecular marker 1 and the InDel molecular marker 2.

[0032] In the above application, the PCR primers are identification primer set 1 and identification primer set 2, the identification primer set 1 consists of a forward primer and a reverse primer, the forward primer is a single-stranded DNA that specifically binds to the upstream of the InDel molecular marker 1 in the sorghum genomic DNA, and the reverse primer is a single-stranded DNA that specifically binds to the downstream of the InDel molecular marker 1 in the sorghum genomic DNA;

[0033] The identification primer set 2 consists of a forward primer and a reverse primer, wherein the forward primer is a single-stranded DNA that specifically binds to the upstream of the InDel molecular marker 2 in the sorghum genomic DNA, and the reverse primer is a single-stranded DNA that specifically binds to the downstream of the InDel molecular marker 2 in the sorghum genomic DNA.

[0034] In the above application, the identification primer set 1 consists of primer F and primer R, the nucleotide sequence of primer F is SEQ ID No.3, and the nucleotide sequence of primer R is SEQ ID No.4; the identification primer set 2 consists of primer F1 and primer R1, the nucleotide sequence of primer F1 is SEQ ID No.7, and the nucleotide sequence of primer R1 is SEQ ID No.8.

[0035] In the above application or method, the sorghum is a sorghum variety or a sorghum inbred line.

[0036] The present invention also provides a method for sorghum breeding, which comprises selecting sorghum whose genomic DNA does not contain the InDel molecular marker 1 and the InDel molecular marker 2 as a parent for breeding.

[0037] Furthermore, the sorghum whose genomic DNA contains the SEQ ID No. 2 mentioned above and the SEQ ID No. 6 can be selected as a parent. BRIEF DESCRIPTION OF THE DRAWINGS

[0038] Figure 1 The polyacrylamide gel electrophoresis test results of genotyping of 96 sorghum varieties based on primers F / R for InDel molecular marker 1. Lane 1 is Marker (Tiangen Biochemical Technology (Beijing) Co., Ltd., product catalog number MD206), and the remaining lanes are sorghum varieties.

[0039] Figure 2 The polyacrylamide gel electrophoresis test results of genotyping of 96 sorghum varieties based on primers F / R for InDel molecular marker 1. Lane 1 is Marker (Tiangen Biochemical Technology (Beijing) Co., Ltd., product catalog number MD206), and the remaining lanes are sorghum varieties.

[0040] Figure 3 The polyacrylamide gel electrophoresis test results of genotyping of 96 sorghum varieties based on primers F / R for InDel molecular marker 1. Lane 1 is Marker (Tiangen Biochemical Technology (Beijing) Co., Ltd., product catalog number MD206), and the remaining lanes are sorghum varieties.

[0041] Figure 4 The polyacrylamide gel electrophoresis test results of genotyping of 29 sorghum varieties based on primers F / R for InDel molecular marker 1. Lane 1 is Marker (Tiangen Biochemical Technology (Beijing) Co., Ltd., product catalog number MD206), and the remaining lanes are sorghum varieties.

[0042] Figure 5The results of agarose electrophoresis for genotyping of 38 sorghum samples using primers F1 / R1 for molecular marker 2. All lanes are sorghum samples. DETAILED DESCRIPTION

[0043] The present invention is further described in detail below in conjunction with specific embodiments, and the examples provided are only for illustrating the present invention, rather than for limiting the scope of the present invention. The examples provided below can be used as a guide for further improvements by those of ordinary skill in the art, and do not constitute a limitation of the present invention in any way.

[0044] The experimental methods in the following examples, unless otherwise specified, are all conventional methods, and are performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials, reagents, etc. used in the following examples, unless otherwise specified, can all be obtained from commercial channels.

[0045] Unless otherwise specified, the quantitative tests in the following examples were performed three times and the results were averaged.

[0046] The sorghum variety PI 564163 (BTx623) in the following examples is American grain sorghum, which has been recorded in: Bai Chunming, Wang Chunyu, Wang Ping, Zhu Zhenxing, Lu Xiaochun. Analysis of QTL for tannin content and color in sorghum grains. Journal of Plant Genetic Resources. 2017, 18(5): 860-866. It is preserved by the Sorghum Research Institute of Liaoning Academy of Agricultural Sciences. The public can obtain the biological material from the applicant, and the biological material is only used for repeating the experiment of the present invention and cannot be used for other purposes.

[0047] The disease-resistant variety IS 3121 in the following examples has been recorded in: Upadhyaya, HD, Pundir, RPS, Dwivedi, SL, Gowda, LLC, Reddy, VG, Singh, S. 2009. Developin a mini core collection of sorghum for diversified utilization of germplasm. It is preserved by the Sorghum Research Institute of Liaoning Academy of Agricultural Sciences. The public can obtain the biological material from the applicant, and the biological material is only used for repeating the experiments of the present invention and cannot be used for other purposes.

[0048] The sorghum 233 (IS***) in the following examples is a mini core collection, which has been recorded in: Upadhyaya, HD, Pundir, RPS, Dwivedi, SL, Gowda, LLC, Reddy, VG, Singh, S. 2009. Developin a mini core collection of sorghum for diversified utilization of germplasm. The public can obtain the biological material from the applicant, which is only used for repeating the experiments of the present invention and cannot be used for other purposes.

[0049] The sorghum anthracnose fungus (Colletotrichum sublineola) in the following examples has been recorded in Yang Xia, Cao Shang, Yu Guangyu, Wang Lulu, Tai Lianmei, Zuo Yuhu, Ke Xiwang, Guo Yongxia. Isolation and identification of pathogenic fungi of sorghum anthracnose in Heilongjiang Province. Microbiology Bulletin, 2021, 48(5): 1571-1579. The public can obtain the biological material from the applicant, and the biological material is only used for repeating the experiments of the present invention and cannot be used for other purposes.

[0050] Example 1: Method for Identifying Sorghum Varieties' Resistance to Sorghum Anthracnose

[0051] Sorghum variety PI 564163 was used as the reference genome (https: / / phytozome-next.jgi.doe.gov / info / Sbicolor_v3_1_1, Genbank: ABXC00000000.3, updated on April 7, 2017). InDel78535 was located on sorghum chromosome 7, positions 10793210-10793339. The allelic variation type was the insertion type (referred to as In-78535 type) or deletion type (referred to as Del-78535 type) of the InDel78535 variation sequence. The nucleotide sequence of InDel78535 variation was 5'-TGACAGCAAACTTTGTGGATCTACCGGACTTCAGCCCGACGAGGCGACCTGGCGACACCCCGCCGCCGCTGTCC TTGTCCGCCACATCTGAGCATCTCTGGTGAGTTTCTACTGAGTAGAGAGTTGGGAG-3' (SEQ ID No. 1). There is an insertion and deletion mutation of nucleotide "5'-GGCGACCT-3'" in the InDel78535 variant sequence, and the insertion and deletion fragment of 8 bp is molecular marker 1.

[0052] Sorghum variety PI 564163 was used as the reference genome (Genbank: ABXC00000000.3, updated on April 7, 2017). InDel78554 was located on sorghum chromosome 7, positions 10799213-10799651. The allelic variation type was the insertion type (referred to as InDel78554 type) or deletion type (InDel78554 type) of the InDel78554 variation sequence. The nucleotide sequence of InDel78554 was 5'-GCGACCTGCTACTTTCATTTCGGTTCAGCCTTTTTATTTTCTCTCCCTCGTGCTGTCAGCCAGTCTCTATTTCTAAGGCCTTGTTTAGTTCACCTTGAAAACCAAAAAGTTTTCAAGATTCCCTGTCACATCGAA TTTTGTGGCACATGCATGAAATATTAAATATAGACGAAAACAAAAACTAATTACACAGTTTAGCTGTAAATCACGAGACGAATCTTTTGATCCTAGTTAGTCCATGATTGGATAATATTTGTCACAAACAAACGAAAGTGCTACAGTATCGAAAA CTTTTCACTTTTCGGAACTAAACAAGCCTTACGCAGTGCAGTCAAAAAATATTGCAATCACGCAGTGCAGTTTTCCATGACTAAGCGACAGAATAGTATGCAGTTTTTAATGTCGTGCACCACGGCGAAAGGGACTTTCGTCTGTGTTG-3'(SEQ ID No.5).

[0053] There are multiple SNP site allele variations and InDel deletions in the InDel78554 variant sequence. SNP variations occur in the 32nd (T / A) variation, 354th (A / G) variation, 380th (A / T variation), and 405th (G / deletion) variation of SEQ ID No.5 in the sequence list; the 165bp InDel variant sequence of SEQ ID No.5 from 70 to 234 is missing and the 89bp variant sequence of SEQ ID No.5 from 241 to 329 is used as the sorghum anthracnose resistance InDel molecular marker 2.

[0054] 1. Use the CTAB method to extract the genomic DNA of the sorghum leaves to be tested

[0055] The sorghum to be tested is sorghum variety PI 564163, etc. (see Table 1 for details).

[0056] The quality and concentration of the genomic DNA of the sorghum leaves to be tested must meet the requirements of PCR. The standard is: 1% agarose gel electrophoresis shows clear DNA bands, no obvious impurities, and no degradation; UV spectrophotometer NanoDrop2000 (ThermoScientifc, Waltham, MA, USA) detects OD 260nm / OD 280nm Between 1.6-2.0, DNA concentration is above 50ng / μL.

[0057] 2. First genotyping

[0058] A. PCR amplification

[0059] Using the genomic DNA of the sorghum leaves to be tested in step 1 as a template, PCR amplification was performed using the identification primer set 1 consisting of an upstream primer F and a downstream primer R to obtain a PCR amplification product. The PCR amplification reaction was performed in a BIO-RAD T100TM Thermalcycler PCR instrument.

[0060] Upstream primer F: 5'-TGACAGCAAACTTTGTGGATC-3' (SEQ ID No. 3);

[0061] Downstream primer R: 5'-CTCCCAACTCTCTACTCAGTAGAAAC-3' (SEQ ID No. 4).

[0062] The reaction system was 25 μL, consisting of 50–100 ng of genomic DNA from sorghum leaves to be tested, 1 μL of an aqueous solution of upstream primer F (concentration of 10 pmol / μL), 1 μL of an aqueous solution of downstream primer R (concentration of 10 pmol / μL), 12.5 μL of 2× Taq PCR Master Mix (Nanjing Novozyme Biotechnology Co., Ltd., P111-01), and ddH2O.

[0063] The reaction conditions were as follows: pre-denaturation at 95°C for 3 min; 95°C for 15 sec, 55°C for 15 sec, 72°C for 30 sec, 35 cycles; 72°C for 5 min; and storage at 4°C.

[0064] B. Result determination

[0065] The PCR amplification product obtained in step 2 (referred to as PCR product 1) was subjected to polyacrylamide gel electrophoresis, and the length of the amplified fragment showed polymorphism. The molecular weight standards of Marker pBR322 DNA / Msp were 26, 34, 67, 76, 90, 110, 123, 147, 160, 180, 190, 201, 217, 238, 242, 309, 404, 527 and 622 from bottom to top.

[0066] PCR identification was performed using identification primer set 1 (F / R). If the size of PCR amplification product 1 was 130 bp (nucleotide sequence was SEQ ID No. 1), the sorghum to be tested was the same as the PCR product of the susceptible variety PI 564163, that is, the genotype of the InDel78535 site was the insertion type of the InDel78535 variant sequence (referred to as the In-78535 type); if the size of PCR amplification product 1 was 122 bp (nucleotide sequence was SEQ ID No. 2), the sorghum to be tested was the same as the PCR product of the resistant variety IS 3121, that is, the genotype of the InDel78535 site was the deletion type of the InDel78535 variant sequence (referred to as the Del-78535 type), and the PCR product of the resistant variety had 8 fewer nucleotides 5'-GGCGACCT-3' than that of the susceptible variety. The 8 bp InDel variant sequence is the sorghum anthracnose resistance InDel molecular marker 1, and the nucleotide sequence of the sorghum anthracnose resistance InDel molecular marker 1 is positions 43 to 50 of SEQ ID No.1.

[0067] In summary, the length of the amplified fragment of the identification primer set 1 (F / R) showed polymorphism, and the sizes of the product amplified fragments were 130 bp and 122 bp, respectively, which were consistent with the expected size, confirming the effectiveness of the molecular marker InDel78535.

[0068] 3. Second genotyping

[0069] The disease-resistant genotype identified in step 2 was verified using the following identification primers F1 / R1 labeled InDel78554, and the PCR amplification product (referred to as PCR product 2) was detected by 1% agarose gel electrophoresis. The reaction system and reaction conditions were the same as above.

[0070] The information of identification primer F1 / R1 is as follows:

[0071] F1: 5'-GCGACCTGCTACTTTCATTC-3' (SEQ ID No. 7);

[0072] R1: 5'-CAACACAGACGAAAGTCCCT-3' (SEQ ID No. 8).

[0073] The principles for judging by agarose gel electrophoresis are as follows:

[0074] PCR identification was performed using identification primer set 2 (F1 / R1). If the size of PCR amplification product 2 was 439 bp (nucleotide sequence was SEQ ID No. 5), the sorghum to be tested was the same as the PCR product of the susceptible variety PI 564163, that is, the genotype of the InDel78554 site was the insertion type of the InDel78554 variant sequence (referred to as the In-78554 type); if the size of PCR amplification product 2 was 270 bp (nucleotide sequence was SEQ ID No. 6), the sorghum to be tested was the same as the PCR product of the disease-resistant variety IS 3121, that is, the genotype of the InDel78554 site was the deletion type of the InDel78554 variant sequence (referred to as the Del-78554 type).

[0075] In summary, the length of the amplified fragment of the identification primer set 2 (F1 / R1) showed polymorphism, and the molecular marker amplified fragments were 439bp and 270bp, respectively, which were consistent with the expected size, confirming the effectiveness of the molecular marker InDel78554.

[0076] In summary, the above two markers InDel78535 and InDel78554 are used for step-by-step identification. If in the genome of the sorghum to be tested, the marker InDel78535 (molecular marker 1) is identified as a resistant genotype (i.e., the allele type of the marker InDel78535 is the Del-78535 type), and the marker InDel78554 (molecular marker 2) is identified as a resistant genotype (i.e., the allele type of the marker InDel78554 is the Del-78554 type), then the sorghum to be tested is determined to be a sorghum anthracnose (Colletotrichum sublineola) resistant variety.

[0077] Example 2: Application of markers InDel78535 and InDel78554 in identifying resistance to sorghum anthracnose (Colletotrichum sublineola)

[0078] 1. Field phenotype identification (resistance, susceptibility) of sorghum anthracnose

[0079] The tested sorghum anthracnose fungus (Colletotrichum sublineola) was isolated from sorghum leaves. It was found to be a highly pathogenic strain through morphological and molecular biological identification and field pathogenicity determination. It was preserved in the Sorghum Institute of Liaoning Academy of Agricultural Sciences.

[0080] Propagation of sorghum anthracnose bacteria: Inoculate the test strain on a casein lactose hydrolysate medium plate and culture at 24°C with alternating light and dark for about 20 days until the colonies produce orange-yellow conidia. Wash the spores with sterile water, filter through double-layer gauze, and adjust the spore volume to 1×10 5 Bacterial suspension of pcs / mL is used for inoculation.

[0081] The test site is located in the experimental field of the Sorghum Institute of Liaoning Academy of Agricultural Sciences. From 2020 to 2023, the field artificial inoculation method was used to identify the disease resistance of sorghum. The seeds were sown in late April, with 2 rows, 5m long, and 0.6m spacing. One seedling was left in each hole, and about 40 seedlings were kept in each area. The experiment was repeated twice in each year.

[0082] The inoculation period for identification of sorghum anthracnose resistance is the plant's trumpet stage, generally 10-11 leaves for mid-maturing and late-maturing varieties, and 9 leaves for early-maturing varieties. It is advisable to choose the evening or a light rainy day for inoculation. Use the spray inoculation method to evenly spray the spore suspension on the surface of the leaves around the trumpet of the plant. The spray amount should be such that the spore suspension is evenly sprayed without droplets flowing on the leaves. Within 48 hours after inoculation, artificially assist in water spraying and moisturizing to increase the infection rate of the pathogen. About 40 to 50 days after inoculation, the sorghum grains enter the milky stage for disease investigation. Visually inspect the disease status of each identification material, focusing on the upper and lower 2 leaves of the inoculation site. According to the description of disease symptoms, leaf by leaf was investigated and the disease status was recorded. The average disease level was calculated according to the technical specifications for identification of sorghum resistance to major diseases [1,2] ([1] Xu Jing, Liu Kejie, Hu Lan, Jiang Yu, Wang Yan, Zhang Minghui, You Guanglan, Xu Xiude, Wang Yanhong, Huang Xinyang. Technical specifications for identification of sorghum resistance to anthracnose DB 21 / T 2807-2017. Shenyang: Liaoning Provincial Bureau of Quality and Technical Supervision, 2017. [2] Hu Lan, Xu Xiude, Jiang Yu, Liu Kejie, Xu Jing, Zhang Minghui, Dong Huaiyu, Wang Lijuan, Guo Yingwei. DB21T2219.1-2014 Technical specifications for identification of sorghum resistance to target spot disease. Shenyang: Liaoning Provincial Bureau of Quality and Technical Supervision, 2014). As long as there are lesions on the leaves and conidia on the lesions, the leaves are considered susceptible, and those without conidia on the lesions are considered resistant. The disease resistance of the identified materials was evaluated based on the results of two years.

[0083] Identification and evaluation criteria for anthracnose resistance of sorghum germplasm resources:

[0084] Disease level 1: There are a few small chlorotic spots on the leaves, accounting for less than 5% of the leaf area, and there are no conidia on the spots, which means high resistance to HR

[0085] Disease level 3: There are a small number of lesions on the leaves, accounting for 5.1%-20% of the leaf area, and there are sporadic conidia on the lesions, which is disease-resistant R

[0086] Disease level 5: There are many lesions on the leaves, accounting for 20.1%-40% of the leaf area, and there are conidia on the lesions, which is medium resistance MR

[0087] Disease level 7: The lesions on the leaves are connected, accounting for 40.1%-70% of the leaf area, and there are conidia on the lesions, which is susceptible S.

[0088] Disease level 9: The leaves are covered with lesions, accounting for more than 70.1% of the leaf area, and there are conidia on the lesions. The whole leaf is almost dead, which is highly susceptible to HS.

[0089] Although divided into 5 levels, in this study, disease level 3 and above was considered susceptible, and disease level 1 and above was considered resistant.

[0090] The specific results of sorghum anthracnose resistance identification are shown in Table 1.

[0091] 2. Genotyping of 266 sorghum varieties

[0092] The genotypes of the molecular markers InDel78535 and InDel78554 of 266 sorghum varieties were identified using the identification primer set 1 and the identification primer set 2 in Example 1. The specific results are shown in Tables 1 and Figure 1-Figure 5 .

[0093] Table 1. Phenotypic results of sorghum anthracnose in 266 sorghum varieties and genotypic results of InDel78535 and InDel78554

[0094]

[0095]

[0096]

[0097]

[0098]

[0099]

[0100]

[0101]

[0102]

[0103] The identification results are shown in Tables 1 and 2: A total of 266 varieties were identified, of which 253 were susceptible varieties and only 13 were resistant varieties.

[0104] The first round of genotyping of the sorghum to be tested was performed using identification primer 1, and a total of 246 susceptible varieties (the band pattern of PCR product 1 was the same as SEQ ID No. 1, i.e., the In-78535 genotype) and 20 resistant varieties (the band pattern of PCR product 1 was the same as SEQ ID No. 2, i.e., the Del-78535 genotype) were identified. Subsequently, identification primer 2 was used to perform the second round of genotyping on the 20 resistant varieties of sorghum to be tested that had been classified in the first round and 15 varieties randomly selected from the 246 susceptible sorghum varieties, and a total of 25 susceptible varieties (the band pattern of PCR product 2 was the same as SEQ ID No. 5, i.e., the In-78554 genotype) and 13 resistant varieties (the band pattern of PCR product 2 was the same as SEQ ID No. 6, i.e., the Del-78554 genotype) were identified. After two rounds of genotyping identification, 13 sorghum varieties were finally identified as resistant varieties. The identification method developed by the invention has an accuracy rate of 100% in identifying sorghum anthracnose resistance.

[0105] Table 2. Phenotypic results of sorghum anthracnose in 266 sorghum varieties and genotypic results of InDel78535 and InDel78554

[0106]

[0107] The present invention has been described in detail above. For those skilled in the art, without departing from the purpose and scope of the present invention, and without the need to carry out unnecessary experimental conditions, the present invention can be implemented in a wide range under equivalent parameters, concentrations and conditions. Although the present invention provides specific embodiments, it should be understood that the present invention can be further improved. In a word, according to the principles of the present invention, the application is intended to include any changes, uses or improvements to the present invention, including departure from the disclosed scope in the application, and changes made with conventional techniques known in the art.

Claims

1. A method for identifying the resistance of sorghum varieties to sorghum anthracnose, characterized in that: The following steps are involved: Detecting whether the genomic DNA of the sorghum to be identified contains InDel molecular marker 1 and InDel molecular marker 2, the sorghum anthracnose resistance of the sorghum to be identified whose genomic DNA does not contain the InDel molecular marker 1 and molecular marker 2 is stronger or higher than that of the sorghum to be identified whose genomic DNA contains the InDel molecular marker 1 and molecular marker 2; The InDel molecular marker 1 is a double-stranded DNA molecule whose nucleotide sequence on one strand is positions 43 to 50 of SEQ ID No. 1; The InDel molecular marker 2 is a double-stranded DNA molecule whose nucleotide sequence on one strand is SEQ ID No.

5.

2. The method according to claim 1, characterized in that The following steps are involved: (1) using the genomic DNA of the sorghum to be identified as a template and using identification primer set 1 to perform PCR amplification to obtain PCR product 1; (2) identifying the resistance of sorghum to sorghum anthracnose according to whether the PCR product 1 contains the InDel molecular marker 1 described in claim 1, and obtaining the sorghum preliminary screening variety to be identified with strong resistance; (3) using the genomic DNA of the sorghum variety to be identified obtained in (2) as a template, and performing PCR amplification using identification primer set 2 to obtain PCR product 2; (4) identifying the resistance of sorghum to sorghum anthracnose according to whether the PCR product 2 contains the InDel molecular marker 2 described in claim 1, and obtaining the sorghum to be identified with strong resistance, that is, a sorghum variety with resistance to sorghum anthracnose; The sorghum to be identified whose PCR product 1 does not contain the InDel molecular marker 1 described in claim 1 has a higher or candidate higher resistance to sorghum anthracnose than the sorghum to be identified whose PCR product contains the InDel molecular marker 1 described in claim 1; The sorghum to be identified whose PCR product 2 does not contain the InDel molecular marker 2 described in claim 1 has a higher or candidate higher resistance to sorghum anthracnose than the sorghum to be identified whose PCR product contains the InDel molecular marker 2 described in claim 1; The identification primer set 1 is composed of a forward primer and a reverse primer, wherein the forward primer is a single-stranded DNA that specifically binds to the upstream of the InDel molecular marker 1 in the sorghum genomic DNA, and the reverse primer is a single-stranded DNA that specifically binds to the downstream of the InDel molecular marker 1 in the sorghum genomic DNA; The identification primer set 2 consists of a forward primer and a reverse primer, wherein the forward primer is a single-stranded DNA that specifically binds to the upstream of the InDel molecular marker 2 in the sorghum genomic DNA, and the reverse primer is a single-stranded DNA that specifically binds to the downstream of the InDel molecular marker 2 in the sorghum genomic DNA.

3. The method according to claim 2, characterized in that: The identification primer set 1 consists of primer F and primer R, the nucleotide sequence of primer F is SEQ ID No.3, and the nucleotide sequence of primer R is SEQ ID No.4; the identification primer set 2 consists of primer F1 and primer R1, the nucleotide sequence of primer F1 is SEQ ID No.7, and the nucleotide sequence of primer R1 is SEQ ID No.

8.

4. The identification primer set 1 and identification primer set 2 in the method according to claim 3 or 4.

5. Use of InDel molecule markers or detection of substances marked with InDel molecules, characterized in that: The InDel molecular markers are the InDel molecular markers 1 and InDel molecular markers 2 described in claim 1; and the application is any one of the following: 1) Use of InDel molecular markers or substances for detecting the InDel molecular markers in identifying or assisting in identifying the resistance of sorghum to sorghum anthracnose, 2) Application of InDel molecular markers or substances for detecting the InDel molecular markers in sorghum breeding.

6. The use according to claim 1, characterized in that: The material contains PCR primers for amplifying a sorghum genomic DNA fragment containing the InDel molecular marker 1 and the InDel molecular marker 2.

7. The use according to claim 6, characterized in that: The PCR primers are identification primer set 1 and identification primer set 2, the identification primer set 1 consists of a forward primer and a reverse primer, the forward primer is a single-stranded DNA that specifically binds to the upstream of the InDel molecular marker 1 in the sorghum genomic DNA, and the reverse primer is a single-stranded DNA that specifically binds to the downstream of the InDel molecular marker 1 in the sorghum genomic DNA; The identification primer set 2 consists of a forward primer and a reverse primer, wherein the forward primer is a single-stranded DNA that specifically binds to the upstream of the InDel molecular marker 2 in the sorghum genomic DNA, and the reverse primer is a single-stranded DNA that specifically binds to the downstream of the InDel molecular marker 2 in the sorghum genomic DNA.

8. The use according to claim 7, characterized in that: The identification primer set 1 consists of primer F and primer R, the nucleotide sequence of primer F is SEQ ID No.3, and the nucleotide sequence of primer R is SEQ ID No.4; the identification primer set 2 consists of primer F1 and primer R1, the nucleotide sequence of primer F1 is SEQ ID No.7, and the nucleotide sequence of primer R1 is SEQ ID No.

8.

9. The method according to any one of claims 1 to 3, or the use according to any one of claims 5 to 8, characterized in that: The sorghum is a sorghum variety or a sorghum inbred line.

10. A method for breeding sorghum, comprising selecting a sorghum whose genomic DNA does not contain the InDel molecular marker 1 of claim 1 and does not contain the InDel molecular marker 2 as a parent for breeding.

Images