An SNP locus related to the flower color trait of Xanthoceras sorbifolium and its application

Through genome-wide correlation analysis, SNP sites related to the color of the Wenguan Fruit were screened, and PCR amplification and enzyme cleavage and electrophoresis were used to identify the color of the Wenguan Fruit was solved, and early efficient breeding was achieved.

CN119193910BActive Publication Date: 2025-07-22COTTON RES INST HEBEI ACAD OF AGRI & FOREST SCI
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202411602377.4
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-11-11
Publication Date
2025-07-22
Estimated Expiration
2044-11-11

AI Technical Summary

Technical Problem

The prior art cannot identify the characteristics of the color of the vermistor fruit in the early stage, resulting in long breeding years and low efficiency.

Method used

The SNP sites related to the color traits of the vermistor fruit were screened by whole-genome association analysis, and the color traits were identified by dCAPS molecular labeling technology using PCR amplification and restriction enzyme digestion, and specific primer pairs were designed for electrophoresis detection.

Benefits of technology

It has achieved early efficient, low-cost and high-throughput identification of Wenguan Fruit Flowers, greatly shortening the breeding cycle and improving breeding efficiency.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119193910B_ABST
    Figure CN119193910B_ABST
Patent Text Reader

Abstract

The present invention relates to the technical field of molecular markers, and provides an SNP locus related to the flower color trait of Xanthoceras sorbifolium and its application. An SNP locus related to the flower color trait of Xanthoceras sorbifolium, the SNP locus is located at the 332nd base of the nucleotide sequence shown in SEQ ID NO: 1, corresponding to the base mutation at the 13469119th position on chromosome 14 of the Xanthoceras sorbifolium genome. The base N of the SNP locus is G or A. Xanthoceras sorbifolium plants with the base G have white flowers, and Xanthoceras sorbifolium plants with the base A have red flowers. Through the above technical solution, the problem in the related art that the flower color trait of Xanthoceras sorbifolium cannot be identified at an early stage is solved.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the technical field of molecular markers, and in particular to a SNP site related to flower color traits of Xanthoceras sorbifolia and an application thereof. Background Art

[0002] Xanthoceras sorbifolia has a beautiful appearance and dense flowers. It can be used for greening barren hills and gardens. According to the color of the petals, Xanthoceras sorbifolia can be divided into white-flowered trees and red-flowered trees. White-flowered trees have white petals, while red-flowered trees have red petals. White-flowered trees are the most common type, while red-flowered trees are less common and have a higher ornamental value.

[0003] Genome-wide association study (GWAS) is a method used to identify associations between variation and phenotypes across the entire genome. This method uses hundreds or tens of millions of genetic variations in the genomes of each sample in a natural population to find variant sites that are significantly associated with the target phenotype. Derivative amplified polymorphism markers (dCAPS) can convert SNP sites into sites that can be cleaved by enzymes by artificially introducing mismatched bases for electrophoresis detection. It has the characteristics of simple operation, rapid detection, low cost, and no reliance on precision instruments.

[0004] Xanthoceras sorbifolia seeds can only bloom and bear fruit two years after germination. Therefore, studying a SNP site related to the flower color trait of Xanthoceras sorbifolia can be used to identify whether the tested plants have red or white flowers in the early stage of Xanthoceras sorbifolia growth and development, which is of great significance for greatly shortening the breeding period of Xanthoceras sorbifolia and improving breeding efficiency. Summary of the invention

[0005] The present invention proposes a SNP site related to the flower color trait of Xanthoceras sorbifolia and an application thereof, which solves the problem in the related art that the flower color trait of Xanthoceras sorbifolia cannot be identified at an early stage.

[0006] The technical solution of the present invention is as follows:

[0007] The present invention proposes a SNP site associated with the flower color trait of Xanthoceras sorbifolia, wherein the SNP site is located at the 332nd base of the nucleotide sequence shown in SEQ ID NO: 1, corresponding to the 13469119th base mutation on chromosome 14 of the Xanthoceras sorbifolia genome, the base N of the SNP site is G or A, the Xanthoceras sorbifolia plants with the base G bloom white flowers, and the Xanthoceras sorbifolia plants with the base A bloom red flowers.

[0008] As a further technical solution, N in the nucleotide sequence is the 332nd position of the SEQ ID NO:1 sequence.

[0009] The present invention also proposes the use of the SNP site associated with the flower color trait of Xanthoceras sorbifolia in identifying the flower color trait of Xanthoceras sorbifolia.

[0010] As a further technical solution, the flower color traits of Xanthoceras sorbifolium are identified at the seedling stage.

[0011] The present invention also provides a dCAPS molecular marker for SNP sites related to the flower color traits of Xanthoceras sorbifolium, and the primer pair includes a first primer pair and a second primer pair;

[0012] The nucleotide sequences of the first primer pair and the second primer pair are as follows:

[0013] F1: GGCTAGGGCTTGGGCTAATA, as shown in SEQ ID NO:2;

[0014] R1: TGGACGTGCAACCTGATACTG, as shown in SEQ ID NO:3;

[0015] F2: GATCAACTTGGGCTAGGGCTT, as shown in SEQ ID NO:4;

[0016] R2: tttttttttttttttttttttttttttttttttttttTGTTGAGGACCTAGTTCTGGATC, as shown in SEQ ID NO:5.

[0017] As a further technical solution, the upstream primer F1 and the downstream primer R1 of the first primer pair are subjected to PCR amplification to obtain a specific band containing SNPs; the upstream primer F2 and the downstream primer R2 of the second primer pair introduce mismatched bases through PCR amplification.

[0018] The present invention also provides the application of the dCAPS molecular marker in identifying the flower color traits of Xanthoceras sorbifolium.

[0019] The present invention also provides a method for screening SNP sites related to the flower color traits of Xanthoceras sorbifolium, including the following steps:

[0020] S1. After extracting the DNA of the Xanthoceras sorbifolium sample, whole-genome resequencing is performed to obtain the original sequencing data;

[0021] S2. The original sequencing data is quality-controlled and aligned with the Xanthoceras sorbifolium reference genome to obtain SNPs across the genome;

[0022] S3. Through genome-wide association analysis, SNP sites related to the flower color traits of Xanthoceras sorbifolium are determined.

[0023] The SNP sites related to the flower color traits of Xanthoceras sorbifolium screened by genome-wide association analysis, and the genotype of this site is significantly correlated with the flower color traits of Xanthoceras sorbifolium.

[0024] The present invention also provides a method for identifying the flower color trait of Xanthoceras sorbifolium Bunge based on the dCAPS molecular marker technology, which includes the following steps:

[0025] A1. Extract the genomic DNA of Xanthoceras sorbifolium Bunge;

[0026] A2. Perform PCR amplification using the first primer pair and the second primer pair;

[0027] A3. Electrophorese the final product obtained by PCR amplification after digestion with a restriction endonuclease;

[0028] A4. Result judgment: If an electrophoretic band of 301 bp is obtained by electrophoresis, the genotype of the SNP locus of Xanthoceras sorbifolium Bunge is GG and the flower color is white; if an electrophoretic band of 361 bp is obtained by electrophoresis, the genotype of the SNP locus of Xanthoceras sorbifolium Bunge is AA and the flower color is red.

[0029] As a further technical solution, in step A2, when performing PCR amplification using the first primer pair, the amplification program is 98°C for 30 s; 98°C for 10 s, 62°C for 5 s, 72°C for 3 s, for a total of 35 cycles; 72°C for 1 min, and store at 4°C;

[0030] When performing PCR amplification using the second primer pair, the amplification program is 98°C for 30 s; 98°C for 10 s, 62°C for 5 s, 72°C for 1 s, for a total of 35 cycles; 72°C for 1 min, and store at 4°C.

[0031] As a further technical solution, when performing PCR amplification using the first primer pair, the PCR amplification system is 10 μL of 2×Phanta Flash Master Mix (Dye Plus), 1 μL of each of the upstream and downstream primers, 1 μL of the DNA template, and make up to 20 μL with ddH2O;

[0032] When performing PCR amplification using the second primer pair, the PCR amplification system is 10 μL of 2×Phanta Flash Master Mix (Dye Plus), 1 μL of each of the upstream and downstream primers, 1 μL of the DNA template, and make up to 20 μL with ddH2O.

[0033] As a further technical solution, in step A3, the restriction endonuclease is BamHI.

[0034] The present invention also provides a kit for identifying the flower color trait of Xanthoceras sorbifolium Bunge, and the kit includes the primer pair.

[0035] The working principle and beneficial effects of the present invention are as follows:

[0036] The present invention discloses an SNP locus affecting the flower color trait of Xanthoceras sorbifolium. Based on the characteristics of this SNP locus, the early identification of the flower color of Xanthoceras sorbifolium can be completed at low cost, with high throughput, quickly and efficiently, greatly shortening the breeding cycle, and having important theoretical and practical significance for the breeding of Xanthoceras sorbifolium with different flower colors. BRIEF DESCRIPTION OF THE DRAWINGS

[0037] The present invention will be further described in detail below in conjunction with the drawings and specific embodiments.

[0038] Figure 1 It is the Manhattan plot of the GWAS association results of the flower color of Xanthoceras sorbifolium in Example 1 of the present invention;

[0039] Figure 2 It is the electrophoresis diagram after BamHI digestion of the amplified red and white flower Xanthoceras sorbifolium by dCAPS molecular marker in Example 3 of the present invention. SPECIFIC EMBODIMENTS

[0040] The technical solutions in the embodiments of the present invention will be clearly and completely described below in conjunction with the embodiments of the present invention. Obviously, the described embodiments are only a part of the embodiments of the present invention, rather than all of the embodiments. All other embodiments obtained by those of ordinary skill in the art based on the embodiments of the present invention without making creative efforts fall within the scope of the present invention.

[0041] The experimental methods used in the following examples are all conventional methods, and the instruments and equipment used are all conventional laboratory instruments and equipment; the reagents involved are all commercially available conventional reagents without special instructions; 203 Xanthoceras sorbifolium materials are taken from 103 in Handan, Hebei Province, 28 in Zhangjiakou, 26 in Chengde, 25 in Shijiazhuang, 12 in Xingtai, and 9 in Tangshan.

[0042] Example 1

[0043] A screening method for an SNP locus related to the flower color trait of Xanthoceras sorbifolium, comprising the following steps:

[0044] S1. Extraction of total DNA:

[0045] Collect the natural population of 203 Xanthoceras sorbifolium materials, preserve the young leaf samples of each plant, extract the DNA of all samples, and construct a high-throughput sequencing library for sequencing analysis;

[0046] S2. Genome alignment and detection of variant sites:

[0047] 1) Filter the original sequencing data to obtain clean reads;

[0048] 2) Align the clean reads of each sample to the Xanthoceras sorbifolium reference genome;

[0049] 3) Sort the comparison results;

[0050] 4) Remove duplicates;

[0051] 5) Detect and filter population SNPs;

[0052] S3, Genome-wide association analysis:

[0053] Perform an association analysis on the flower color phenotypes (white flowers and red flowers) of 203 Xanthoceras sorbifolium materials and the obtained SNPs. Use the assoc adjust method to calculate the p-values of all SNP loci. Subsequently, draw a Manhattan plot based on -log10(p-value) and the positions of SNPs on each chromosome. It is observed that there are significant SNP loci on its chromosome 14, such as Figure 1 shown, Figure 1 showing that the SNP molecular markers screened in the present invention are located on chromosome 14. The point indicated by the arrow is the SNP molecular marker of the present invention, which is the 332nd base of the nucleotide sequence shown in SEQ ID NO:1;

[0054] The nucleotide sequence shown in SEQ ID NO:1 is as follows:

[0055] AATTCGGTTCTTCTTGCAATTTCGCTTGTGAGATCAACTTGGGCTAGGGCTTGGGCTAATAACCTAAGAACTAGAGAGCAAGGGATTCCCTAAAAAGGTAACTAAGCTCAAAATTTATCTACATTGTTTTAATTTGTGTTGGGTGTTGTTTATTTGGTTATTAGTGAAGTTAGGATTGTGGATTTGTGTTGATTTCGGGATTAATTGAAGTTTGAGTGTGTTATTGTGTTAATTTGGGAAATTAAGGTTTATGGGTGTTTGTAATTTGGGGCTAAATTGAAGTTAGGGTTGAATTGGATTGTTAATTGATAGAGTAGTTAGGTTTGTTGTTN(G / A)GATTTAGAACTAGGTCCTCAACATATTAATTTCTTATTACATTAATATCAAGTTGTACATCCACAGGTGGCTTGTTATGTTTTAACCTTGGTGGCAAAACTTTATCTTACTGTTTGACTTTCAGGCTGTCAATTAGTAAGGCTTGGTGACAAAACTTTATCTCACCGTTTGACTTTCAGGCTAACATTAGTTTCTTATTACATTAATATCAAGTTGTACATCCACACGCGGCTTGTTATGTTTTAACCTTGGTGGTAAAACTTTATCTTACTGTTTGACTTTCAGGCTGTTAATTAGTTCCACATTACATCAGTATCAGGTTGCACGTCCA。

[0056] At the 332nd base of the above sequence, N is G or A, and this mutation causes polymorphism in the above sequence.

[0057] Example 2

[0058] Development of a dCAPS molecular marker related to the flower color trait of Xanthoceras sorbifolium

[0059] 2.1 Primer design

[0060] According to the Xanthoceras sorbifolium genome sequence, specific primers were designed to PCR amplify the DNA fragment containing this SNP site:

[0061] F1: GGCTAGGGCTTGGGCTAATA, as shown in SEQ ID NO:2;

[0062] R1: TGGACGTGCAACCTGATACTG, as shown in SEQ ID NO:3;

[0063] The target sequence amplified by PCR using F1 and R1 as primers is as shown in SEQ ID NO:1.

[0064] 2.2 Design of dCAPS primers

[0065] Design dCAPS primers according to the SNP locus obtained in Example 1. The specific steps are as follows:

[0066] Select a restriction endonuclease (BamHI) and introduce a mismatched base (TT→CC) at positions 336-337 of the sequence shown in SEQ ID NO:1;

[0067] The finally obtained primer sequences are as follows:

[0068] F2: GATCAACTTGGGCTAGGGCTT, as shown in SEQ ID NO:4;

[0069] R2: tttttttttttttttttttttttttttttttttttttTGTTGAGGACCTAGTTCTGGATC, as shown in SEQ ID NO:5.

[0070] Use F1 and R1 as primers to obtain a specific band containing SNP by PCR amplification. Subsequently, use F2 and R2 as primers to introduce mismatched bases by PCR amplification, and further digest the amplified product with BamHI. When digested, a specific band of 301bp appears, and the tested material can be judged as white-flowered Xanthoceras sorbifolium. When not digested and only a specific band of 361bp appears, the tested material can be judged as red-flowered Xanthoceras sorbifolium.

[0071] Example 3

[0072] Application of molecular markers

[0073] Use the molecular marker primers obtained in Example 2 to identify 8 randomly selected red-flowered and 8 white-flowered materials that have not undergone GWAS sequencing, including the following steps:

[0074] A1. Extract DNA from young leaves of Xanthoceras sorbifolium. The DNA extraction kit is (FastPure Plant DNA IsolationMini Kit-DC104) (Nanjing Novoprotein Biological Technology Co., Ltd.);

[0075] A2. Using the genomic DNA obtained in A1 as a template, perform the first PCR amplification with the first primer pair F1 and R1 to obtain a preliminary amplification product. The reaction system for the first PCR amplification is as follows: 10 μL of 2×Phanta Flash Master Mix (DyePlus), 1 μL of each of the upstream and downstream primers, 1 μL of the DNA template, and make up to 20 μL with ddH2O.

[0076] The conditions for the first PCR amplification are 98°C for 30 s; 98°C for 10 s, 62°C for 5 s, 72°C for 3 s, for a total of 35 cycles; 72°C for 1 min, and store at 4°C.

[0077] Dilute the preliminary amplification product in A2 by 100 times. Using it as a template, perform the second PCR amplification with the second primer pair F2 and R2 to obtain the final PCR amplification product. The reaction system for the second PCR amplification is as follows: 10 μL of 2×Phanta Flash MasterMix (Dye Plus), 1 μL of each of the upstream and downstream primers, 1 μL of the DNA template, and make up to 20 μL with ddH2O.

[0078] The conditions for the second PCR amplification are 98°C for 30 s; 98°C for 10 s, 62°C for 5 s, 72°C for 1 s, for a total of 35 cycles; 72°C for 1 min, and store at 4°C.

[0079] A3. Digest the final PCR amplification product in A2 with the restriction endonuclease BamHI (R3136S) (New England Biolabs). The digestion system is as follows: 10 μL of the PCR amplification final product, 1 μL of the restriction endonuclease, 3 μL of the restriction endonuclease buffer, and make up to 30 μL with ddH2O.

[0080] The digestion reaction conditions are: incubate at 37°C for 3 h; inactivate at 65°C for 20 min.

[0081] Perform agarose gel electrophoresis on the above digestion product, take a photo with a gel imaging system. The electrophoresis conditions are: 3.0% agarose gel (3 g of agarose dissolved in 100 mL of buffer), voltage: 120 V, time: 60 min.

[0082] A4. Result judgment: If an electrophoresis band of 301 bp is obtained, the genotype of the SNP site of Xanthoceras sorbifolium is GG, and the flower color is white; if an electrophoresis band of 361 bp is obtained, the genotype of the SNP site of Xanthoceras sorbifolium is AA, and the flower color is red.

[0083] The results are as Figure 2As shown, all 8 randomly selected white-flowered Xanthoceras sorbifolium Bunge materials could be digested by enzymes, with a band of 301 bp, and all 8 red-flowered Xanthoceras sorbifolium Bunge materials could not be digested by enzymes, with a band of 361 bp. The results show that the molecular marker polymorphism shown in SEQ ID NO:1 is significantly correlated with the flower color trait of Xanthoceras sorbifolium Bunge and can be used for the breeding of the flower color trait of Xanthoceras sorbifolium Bunge.

[0084] The above are only the preferred embodiments of the present invention and are not intended to limit the present invention. Any modifications, equivalent replacements, improvements, etc. made within the spirit and principle of the present invention shall be included in the protection scope of the present invention.

Claims

1. An SNP molecular marker related to the flower color trait of Xanthoceras sorbifolium, characterized in that, The SNP molecular marker is as shown in SEQ ID NO:

1. The base N at the SNP locus is G or A. Xanthoceras sorbifolium plants with the base G have white flowers, and Xanthoceras sorbifolium plants with the base A have red flowers.

2. Use of the SNP molecular marker according to claim 1 in identifying the flower color trait of Xanthoceras sorbifolium.

3. A method for identifying the flower color trait of Xanthoceras sorbifolium Bunge using the SNP molecular marker described in claim 1, characterized in that, It includes the following steps: A1. Extract the genomic DNA of Xanthoceras sorbifolium; A2. Perform PCR amplification using the first primer pair and the second primer pair; A3. Electrophorese the final product obtained by PCR amplification after digestion with a restriction endonuclease; A4. Result judgment: If an electrophoresis band of 301 bp is obtained, the genotype of the SNP locus of Xanthoceras sorbifolium is GG, and the flower color is white; if an electrophoresis band of 361 bp is obtained, the genotype of the SNP locus of Xanthoceras sorbifolium is AA, and the flower color is red; In step A3, the restriction endonuclease is BamHI; The nucleotide sequence of the upstream primer F1 of the first primer pair is as shown in SEQ ID NO:2; The nucleotide sequence of the downstream primer R1 of the first primer pair is as shown in SEQ ID NO:3; The nucleotide sequence of the upstream primer F2 of the second primer pair is as shown in SEQ ID NO:4; The nucleotide sequence of the downstream primer R2 of the second primer pair is as shown in SEQ ID NO:

5.

4. The method for identifying the flower color trait of Xanthoceras sorbifolium Bunge by SNP molecular markers according to claim 3, wherein In step A2, when performing PCR amplification using the first primer pair, the amplification program is 98°C for 30 s; 98°C for 10 s, 62°C for 5 s, 72°C for 3 s, for a total of 35 cycles; 72°C for 1 min, and store at 4°C; When performing PCR amplification using the second primer pair, the amplification program is 98°C for 30 s; 98°C for 10 s, 62°C for 5 s, 72°C for 1 s, for a total of 35 cycles; 72°C for 1 min, and store at 4°C.

Citation Information

Patent Citations

  • Xanthoceras sorbifolia bunge drought-resistant gene, SNP and application thereof

    CN113736796A

  • SNP (Single Nucleotide Polymorphism) site related to xanthoceras sorbifolia leaf wax thickness and application

    CN117248058A