SNP-T4096C Related to Wheat Grain Weight and Its Application
By discovering the SNP-T4096C site related to grain weight in wheat, the problem of difficulty in applying existing QTL is solved, effective identification and regulation of wheat grain weight is achieved, and new breeding methods and gene resource tools are provided.
Patent Information
- Application Number
- CN202411626629.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-11-14
- Publication Date
- 2025-07-01
- Estimated Expiration
- 2044-11-14
AI Technical Summary
The existing wheat 100-grain weight-related QTLs are difficult to effectively apply to the genetic improvement of wheat grain weight, mainly because the phenotype contribution rate of most QTLs is small and the repetition is poor between different interannual and environments.
A SNP site (SNP-T4096C) related to wheat grain weight was discovered and verified. There are two genotypes: T/T and C/C. The genotype identification was carried out through this SNP site to construct a molecular regulatory pathway for wheat grain weight, and screen and regulate it in breeding.
By detecting the SNP-T4096C site, it can effectively identify wheat with a height of 1000 grains, providing a new molecular marker-assisted selection and breeding method, expanding the wheat's genetic resource tool, and having good application potential.
Smart Images

Figure CN119193912B_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the technical field of molecular biology, in particular to SNP-T4096C related to wheat grain weight and its application. Background Art
[0002] Wheat (Triticum aestivum L) is one of the most important food crops in the world and in China. Improving wheat yield per unit area is an important way to meet the increasing food demand in recent years, and it is also a strategic goal to ensure food security. Thousand-grain weight is one of the three major elements constituting the yield per plant of wheat and is an important index for judging the yield of wheat varieties. Therefore, exploring excellent allelic variations regulating thousand-grain weight and developing functional markers have important application values in wheat high-yield breeding.
[0003] At present, a large number of QTLs regulating thousand-grain weight have been mapped. Meng et al. finely mapped stable quantitative trait loci (QTLs) of thousand-grain weight and identified their candidate genes in a recombinant inbred line (RIL) population derived from the cross of Kenong 9204 (KN9204) and Jing 411 (J411). Li et al. genotyped 198 8672 × Keyi 5214 DH populations using a wheat 55K gene chip, and performed QTL mapping by combining the thousand-grain weight phenotypes of two years. A total of 3 stable genetic wheat thousand-grain weight QTLs located on chromosomes 2D and 6A were identified. Yu et al. used the RIL population created by H307 / Zhengmai 9023 as the material, and mapped 6 thousand-grain weight QTLs to chromosomes 1D, 2B, 3D, 6D and 7A, which could explain 4.54 - 13.14% of the phenotypic variation. Krishnappa et al. detected 5 thousand-grain weight QTLs, QTkw.iari-1A, QTkw.iari-2A, QTkw.iari-2B, QTkw.iari-5B and QTkw.iari-7A, using the RIL population constructed by WH542 and a synthetic variety. Fa et al. mapped 17 thousand-grain weight QTLs using three RIL populations of Doumai / Shi4185, Gaocheng 8901 / Zhoumai 16 and Linmai 2 / Zhong 892, which were located on chromosomes 2AS, 2BS, 3AL, 3B, 3DL, 4AL, 4BS(2), 4DS(2), 5AL(2), 5DL, 6AL, 6BL, 7AL and 7BL respectively. Cao et al. used an F2 population, and 5 were thousand-grain weight QTLs, distributed on chromosomes 1B, 5A, 5B, 5D and 7B, which could explain 8.9 - 10.9% of the phenotypic variation.
[0004] Although a large number of QTLs related to the thousand-kernel weight of wheat have been mapped so far, most of these QTLs have a small phenotypic contribution rate and poor repeatability across different years and environments. Therefore, these QTLs are difficult to apply to the genetic improvement of wheat thousand-kernel weight. Summary of the Invention
[0005] The technical problem to be solved by the present invention is to provide an SNP locus related to wheat grain weight, and at the same time, to construct and expand the technical path for its potential applications in theoretical research related to wheat grain weight and in wheat molecular breeding, agricultural yield increase, etc.
[0006] To solve the above technical problems, the technical solutions adopted by the present invention are as follows.
[0007] An SNP locus related to wheat grain weight, the SNP locus corresponds to the 4096th base from the 5' end of the sequence shown in SEQ ID NO.1. When this locus is homozygous for T / T, the corresponding genotype is A; when this locus is homozygous for C / C, the corresponding genotype is B; the grain weight is as follows: the wheat homozygous for genotype B is greater than or potentially greater than the wheat homozygous for genotype A.
[0008] The present invention also includes the use of the above wheat SNP locus, and the use is to conduct theoretical research on the principle of wheat grain weight development based on the SNP locus, and / or to conduct research on the molecular regulation pathway of wheat grain weight development based on the SNP locus; including: based on the SNP locus, confirming, identifying, and / or distinguishing the downstream associated effector molecules through the differences in locus genotypes, and constructing a molecular regulation pathway for wheat grain weight; the effector molecules include but are not limited to messenger RNA, protein, associated biological enzymes, various molecular regulation components, and various molecular signal components; further, on the basis of constructing the molecular regulation pathway for wheat grain weight, identifying and confirming the major or key regulatory nodes and their corresponding biological macromolecules or small molecule components.
[0009] The present invention also includes another use of the above SNP locus, and the use is to screen or assist in screening the wheat grain weight phenotype in the early stage of marker-assisted selection breeding.
[0010] The present invention also includes another use of the above wheat SNP locus, and the use is to regulate the wheat grain weight according to production requirements in the agricultural industry based on the SNP locus, including: increasing the wheat grain weight based on genotype B and decreasing the wheat grain weight based on genotype A; the potential application scenarios for increasing the wheat grain weight are: improving wheat quality, and high-quality wheat is used for high-end food manufacturing or high-end beverage brewing; the potential application scenarios for decreasing the wheat grain weight are: increasing the total wheat yield, and high-yield wheat is used for the livestock feed industry.
[0011] The present invention also includes a gene detection kit for detecting the SNP locus described in claim 1. The gene detection kit contains a PCR amplification specific primer combination corresponding to the SNP locus, as well as template DNA, buffer, dNTPs and other necessary components for gene detection.
[0012] As a preferred technical solution of the present invention, the PCR amplification specific primer combination includes: primer pair 1F and 1R composed of SEQ ID NO.2 and SEQ ID NO.3, and primer pair 2F and 2R composed of SEQ ID NO.4 and SEQ ID NO.5.
[0013] The present invention also includes a method for early identification or assisted identification of wheat grain weight. Based on the SNP locus, at the early stage of marker-assisted selection breeding, primers are designed to perform PCR amplification on any DNA fragment containing the SNP locus in the genomic DNA of the wheat to be tested. The genotype of wheat is identified by digesting the PCR amplification product with enzymes, and the identification or assisted identification of the wheat grain weight phenotype is carried out based on the following correlation between genotype and phenotype: the wheat with the genotype of B has a higher grain weight than the wheat with the genotype of A.
[0014] As a preferred technical solution of the present invention, the DNA fragment amplified by PCR is 3498 - 4483bp at the 5' end of SEQ ID NO.1; the specific primer pairs for PCR amplification are primer pair 1F and 1R composed of SEQ ID NO.2 and SEQ ID NO.3 and primer pair 2F and 2R composed of SEQ ID NO.4 and SEQ ID NO.5; the digestion is carried out using the restriction endonuclease HinfI.
[0015] As a preferred technical solution of the present invention, the digestion includes the following steps: using wheat genomic DNA as a template, amplifying a PCR product with primer pair 1F and 1R as primers; diluting this PCR product by 20 - 50 times, using it as a template, and amplifying a PCR product with primer pair 2F and 2R as primers; digesting the PCR product with the restriction endonuclease HinfI; if the PCR product can be cut, the nucleotide polymorphism locus is T / T and the genotype is A; if the PCR product cannot be cut, the nucleotide polymorphism locus is C / C and the genotype is B; the grain weight is: the wheat homozygous for genotype B is greater than or candidate greater than the wheat homozygous for genotype A.
[0016] The present invention also includes a primer combination for detecting the SNP locus, including: primer pair 1F and 1R composed of SEQ ID NO.2 and SEQ ID NO.3, and primer pair 2F and 2R composed of SEQ ID NO.4 and SEQ ID NO.5.
[0017] The beneficial effects of adopting the above technical solution are as follows: Through the genetic variation analysis of the genes in the natural wheat variation population, the research team of the present invention found a SNP corresponding to the 4096th position from the 5' end of the sequence shown in SEQ ID NO.1. This SNP has two genotypes: genotype A (T) and genotype B (C). Through association analysis, it was proved that among the homozygous types of these two genotypes, the thousand-grain weight is as follows: the wheat with homozygous genotype B is greater than or potentially greater than the wheat with homozygous genotype A. The present invention also provides a dCAPS marker for detecting the said SNP. Experiments have proved that by detecting the said SNP, wheat with a higher thousand-grain weight can be found. The present invention provides a new method for molecular marker-assisted selection breeding of wheat, which is of great significance in cultivating high-yield wheat varieties or research. This SNP locus not only expands the gene resource tools of wheat, but also has been verified by our scientific research experiments and data statistics to have good and extensive application potential.
[0018] Description of the Drawings
[0019] Figure 1 It is a schematic diagram of the gene structure pattern and the SNP locus;
[0020] Figure 2 It is the electrophoresis detection result of the enzyme digestion product of the dCAPS marker developed for the SNP of the present invention; among them, M is the molecular weight standard; lane T is the band cut by HinfI, and lane C is the band that cannot be cut by HinfI;
[0021] Figure 3 It is a schematic diagram of the association analysis result between the gene polymorphism locus in the natural population and the thousand-grain weight;
[0022] Figure 4 It is a schematic diagram of the gene SNP locus and genotyping in the wheat population material. Detailed Embodiment
[0023] The following examples illustrate the present invention in detail. All kinds of raw materials and equipment used in the present invention are conventional commercially available products and can be directly obtained through market purchase. The materials, reagents, etc. used in the following examples can be obtained from commercial channels without special instructions.
[0024] It should be understood that when used in the specification of the present application and the appended claims, the term "comprising" indicates the presence of the described features, wholes, steps, operations, elements and / or components, but does not exclude the presence or addition of one or more other features, wholes, steps, operations, elements, components and / or their combinations. It should also be understood that the term "and / or" used in the specification of the present application and the appended claims refers to any combination and all possible combinations of one or more of the related listed items, and includes these combinations.
[0025] As used in the specification of this application and the appended claims, the term "if" may be construed, depending on the context, as "when", or "once", or "in response to determining", or "in response to detecting". Similarly, the phrase "if determined" or "if [the described condition or event] is detected" may be construed, depending on the context, to mean "once determined", or "in response to determining", or "once [the described condition or event] is detected", or "in response to detecting [the described condition or event]".
[0026] In addition, in the description of the specification of this application and the appended claims, the terms "first", "second", "third", etc. are used only for distinguishing descriptions and cannot be construed as indicating or implying relative importance. The reference to "one embodiment" or "some embodiments" etc. described in the specification of this application means that a specific feature, structure, or characteristic described in connection with that embodiment is included in one or more embodiments of this application. Thus, statements such as "in one embodiment", "in some embodiments", "in some other embodiments", "in still other embodiments" etc. that appear in different places in this specification do not necessarily all refer to the same embodiment, but mean "one or more but not all embodiments", unless otherwise specifically emphasized in other ways. The terms "comprise", "include", "have" and their variants all mean "include but not limited to", unless otherwise specifically emphasized in other ways.
[0027] Example 1: SNP related to thousand-grain weight of wheat and its PCR-restriction fragment length polymorphism detection
[0028] As Figure 1 shown, 1 SNP was found on the wheat gene, corresponding to the 4096th position from the 5' end of Sequence Listing 1; there are two genotypes at this locus in the wheat natural variation population:
[0029] Genotype A: T
[0030] Genotype B: C
[0031] According to the sequence differences of different wheat genomes, specific primers were designed for PCR amplification of DNA fragments respectively containing this SNP locus:
[0032] F1: ACTATCAGTGAACGGACCATCGAC (SEQ ID NO: 2);
[0033] R1: GAGCCAGCCATTTGCCTCGAAC (SEQ ID NO: 3);
[0034] F2: CCGGGTGACGAGCTGCGGCCGGGAC (SEQ ID NO: 4);
[0035] R2: GCCGGCATGGCCGCCATCAGCAG (SEQ ID NO: 5);
[0036] The target sequence amplified by PCR using F1 and R1 as primers is the sequence at positions 3498 - 4483 shown in Sequence 1 of the Sequence Listing; the target sequence amplified by PCR using F2 and R2 as primers is the sequence at positions 4071 - 4190 shown in Sequence 1 of the Sequence Listing. Restriction analysis shows that this polymorphism can be recognized by HinfI respectively.
[0037] 2. Establishment of PCR - restriction fragment length polymorphism (RFLP) detection and genotyping method
[0038] 1) Extract the genomic DNA of the wheat to be tested;
[0039] 2) Using the genomic DNA in step 1) as a template, perform PCR amplification with primers F1 and R1. The PCR amplification system (10 μL) is: ddH2O μL, 10×PCR Buffer 1 μL, primers F1 (5 μmol / L) and R1 (5 μmol / L) each 0.3 μL, dNTP (2.5 μmol / L) 0.6 μL, Taq enzyme 0.1 μL, template (20 ng / μL) 0.5 μL.
[0040] The PCR amplification conditions are: 94°C for 4 min; 94°C for 30 s, 56°C for 30 s, 72°C for 30 s, 32 cycles; 72°C for 10 min, and store at 16°C.
[0041] 3) Dilute the PCR product in step 2) by 20 - 50 times. Using it as a template, perform PCR amplification with primers F2 and R2. The PCR amplification system (10 μL) is: ddH2O μL, 10×PCR Buffer 1 μL, primers F2 (5 μmol / L) and R2 (5 μmol / L) each 0.3 μL, dNTP (2.5 μmol / L) 0.6 μL, Taq enzyme 0.1 μL, template (20 ng / μL) 0.5 μL.
[0042] The PCR amplification conditions are: 94°C for 4 min; 94°C for 30 s, 56°C for 30 s, 72°C for 10 s, 32 cycles; 72°C for 10 min, and store at 16°C.
[0043] 4) Digest the PCR product obtained in step 3) with HinfI to obtain the digested product, perform 4% agarose gel electrophoresis detection, record whether the PCR product is cut into two fragments, and judge and record the situation of the wheat to be tested at the said site according to the following method:
[0044] If the restriction enzyme digestion product is a 100 bp fragment (low), the wheat to be tested is homozygous for T at the locus (denoted as T / T) ( Figure 2 in lane T of
[0045] If the restriction enzyme digestion product is a 120 bp fragment (high), the wheat to be tested is homozygous for C at the locus (denoted as C / C) ( Figure 2 in lane C of
[0046] According to the results of step 4), the wheat is divided into two types, I and II, in the following situations at the locus:
[0047] I: T / T (i.e., homozygous for genotype A);
[0048] II: C / C (i.e., homozygous for genotype B);
[0049] Before the " / ", it is the situation on one homologous chromosome, and after the " / ", it is the situation on the other homologous chromosome.
[0050] 3. Use dCAPs markers to genotype the natural population and perform association analysis with the grain weight trait
[0051] As Figure 4 shown, each wheat in a natural population consisting of 320 hexaploid wheats was used as the wheat to be tested, genotyped according to the method of step 2, and the amplification products of some wheats were randomly sequenced for verification. The results are shown in Table 1.
[0052] Table 1 Situations of the polymorphic locus in the wheat natural population
[0053]
[0054]
[0055]
[0056]
[0057]
[0058] Example 2. Association analysis study on the relationship between gene polymorphic loci in the natural population and the thousand-grain weight
[0059] Our technical team carried out exon capture sequencing on 385 materials and performed specific genotyping on these materials. Among them, the genotyping included two situations: homozygous for genotype A T / T and homozygous for genotype B C / C. As Figure 4, among all 385 materials, a total of 379 materials could be clearly classified as homozygous T / T of genotype A or homozygous C / C of genotype B, and the remaining 6 materials could not be genotyped.
[0060] In addition, 320 of these 385 materials had agronomic trait data for multiple years and multiple locations, while the remaining 65 materials could not meet the requirements for subsequent analysis due to insufficient data. Therefore, as shown in Table 2 and Figure 3 as follows, only these 320 data were used when conducting the association analysis between the gene polymorphism loci and the number of spikes per plant in the natural population.
[0061] In 2018, the above natural population of wheat was planted in dry-hot and dry fields, and water-hot and water fields at the Luancheng Experimental Station of the Institute of Agricultural Resources, Chinese Academy of Sciences (Luancheng, Hebei). In 2019, it was planted in water and dry fields at the Hengshui Experimental Farm of the Institute of Agricultural Resources, Chinese Academy of Sciences (Hengshui, Hebei). In 2020, it was planted in dry-hot and dry fields, and water-hot and water fields at the Crop Science Research Institute of the Chinese Academy of Agricultural Sciences (Zhao County Experimental Station). The thousand-grain weight of each wheat variety was investigated, and the association analysis between the thousand-grain weight and the polymorphism loci was carried out using Tassel 2.1 software. The mixed linear model + population structure (MLM+(Q+K)) method was selected for the analysis, with P<0.05 as the significance level. The results are shown in Table 2 and Figure 3 as follows.
[0062] Table 2 Results of the association analysis between the gene polymorphism loci and the thousand-grain weight in the natural population
[0063]
[0064] The association analysis results in Table 2 show that the differences in the thousand-grain weight between the two types formed by the natural population of 320 hexaploid wheats shown in Table 1 both reached a significant level (P<0.05). Among them, the thousand-grain weight of type II wheat was higher than that of type I wheat. In several environments, the thousand-grain weight of type II wheat materials was 2.46, 2.98, 1.78, 1.32, 3.1, 3.35, 3.55, 2.65, 2.35, and 2.19 grain weights higher than that of type I wheat respectively. The study of the natural population shows that type II is an excellent genotype for increasing the thousand-grain weight of wheat.
[0065] Although the embodiments of the present invention have been shown and described, for those of ordinary skill in the art, it can be understood that various changes, modifications, substitutions, and variations can be made to these examples without departing from the principles and spirit of the present invention. The scope of the present invention is defined by the appended claims and their equivalents.
[0066] In the above embodiments, the descriptions of the respective embodiments have their own focuses. For the parts not described in detail or recorded in a certain embodiment, reference may be made to the relevant descriptions of other embodiments.
[0067] The above-described embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit them. Although the present invention has been described in detail with reference to the foregoing embodiments, those of ordinary skill in the art should understand that they can still modify the technical solutions described in the foregoing embodiments or perform equivalent replacements for some of the technical features. These modifications or replacements do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions of the respective embodiments of the present invention and should all be included within the protection scope of the present invention.
Claims
1. The use of wheat SNP loci, characterized in that: The SNP site corresponds to the 4096th base from the 5' end of the sequence shown in SEQ ID NO.
1. When the site is T / T homozygous, the corresponding genotype is A; when the site is C / C homozygous, the corresponding genotype is B; the grain weight is: the wheat homozygous for genotype B is larger or is a candidate for being larger than the wheat homozygous for genotype A; The use is to screen or assist in screening wheat grain weight phenotype in the early stage of molecular marker-assisted selection breeding.
2. The use of wheat SNP loci, characterized in that: The SNP site corresponds to the 4096th base from the 5' end of the sequence shown in SEQ ID NO.
1. When the site is T / T homozygous, the corresponding genotype is A; when the site is C / C homozygous, the corresponding genotype is B; the grain weight is: the wheat homozygous for genotype B is larger or is a candidate for being larger than the wheat homozygous for genotype A; The use is to regulate the wheat grain weight in the agricultural industry according to production needs based on the SNP site, including: increasing the wheat grain weight based on the B genotype and reducing the wheat grain weight based on the M genotype; the potential application scenarios of increasing wheat grain weight are: improving wheat quality, and using high-quality wheat for high-end food manufacturing or high-end beverage brewing; the potential application scenarios of reducing wheat grain weight are: increasing the total wheat yield, and using high-yield wheat for the livestock feed industry.
3. The use of a gene detection kit, characterized in that: The gene detection kit comprises a PCR amplification specific primer combination corresponding to the SNP site of claim 1 or 2, as well as template DNA, buffer, dNTPs and other necessary components for gene detection; The use is to identify or assist in identifying wheat grain weight by detecting the single nucleotide polymorphism of the following SNP site in the wheat genome; the SNP site corresponds to the 4096th base from the 5' end of the sequence shown in SEQ ID NO.1, when the site is T / T homozygous, the corresponding genotype is A; when the site is C / C homozygous, the corresponding genotype is B; the grain weight is: wheat homozygous for genotype B is greater than or is a candidate to be greater than wheat homozygous for genotype A.
4. The use according to claim 3, characterized in that: The PCR amplification specific primer combination includes: a primer pair 1F and 1R consisting of SEQ ID NO.2 and SEQ ID NO.3, and a primer pair 2F and 2R consisting of SEQ ID NO.4 and SEQ ID NO.
5.
5. A method for identifying or assisting in identifying wheat grain weight in the early stages of breeding, characterized in that: Based on the SNP site described in claim 1, in the early stage of molecular marker-assisted selection breeding, primers are designed to perform PCR amplification on any DNA fragment containing the SNP site in the wheat genomic DNA to be tested, the wheat genotype is identified by enzyme digestion of the PCR amplification product, and the wheat grain weight phenotype is identified or assisted in identification based on the correlation between genotype and phenotype described in claim 1.
6. The method according to claim 5, characterized in that: The DNA fragment amplified by PCR is 3498-4483bp at the 5' end of SEQ ID NO.1; the specific primer pairs for PCR amplification are primer pair 1F and 1R composed of SEQ ID NO.2 and SEQ ID NO.3 and primer pair 2F and 2R composed of SEQ ID NO.4 and SEQ ID NO.5; the restriction endonuclease HinfI is used for enzyme digestion.
7. The method according to claim 5, characterized in that: The enzyme digestion comprises the following steps: using wheat genomic DNA as a template and primers 1F and 1R as a primer pair to amplify to obtain a PCR product; diluting the PCR product by 20-50 times, using it as a template and primers 2F and 2R as a primer pair to amplify to obtain a PCR product; using restriction endonuclease HinfI to digest the PCR product; if the PCR product can be cut, the nucleotide polymorphic site is T / T and the genotype is A; if the PCR product cannot be cut, the nucleotide polymorphic site is C / C and the genotype is B; the grain weight is: wheat homozygous for genotype B is greater than or a candidate is greater than wheat homozygous for genotype A.
8. Use of a primer combination, characterized in that: The primer combination is a primer pair 1F and 1R consisting of SEQ ID NO.2 and SEQ ID NO.3 in the sequence list, and a primer pair 2F and 2R consisting of SEQ ID NO.4 and SEQ ID NO.5; The use is to identify or assist in identifying wheat grain weight by detecting the single nucleotide polymorphism of the following SNP site in the wheat genome; the SNP site corresponds to the 4096th base from the 5' end of the sequence shown in SEQ ID NO.1, when the site is T / T homozygous, the corresponding genotype is A; when the site is C / C homozygous, the corresponding genotype is B; the grain weight is: wheat homozygous for genotype B is greater than or is a candidate to be greater than wheat homozygous for genotype A.