Molecular marker of wheat TaREC2-6B gene and application of molecular marker
By developing a set of KASP marker primers to genotype the SNP8 site of the wheat TaREC2-6B gene, the TaREC2-6B-HapII type was identified. This solved the problem of the difficulty in using the TaREC2-6B gene to increase wheat yield in existing technologies, realized the development of an efficient breeding tool, and significantly improved wheat flag leaf width, thousand-grain weight, and yield per plant.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-03-17
- Publication Date
- 2026-04-14
AI Technical Summary
The effects of natural variations in the wheat TaREC2-6B gene on wheat yield and related molecular markers have not been reported in the current technology, making it difficult to effectively utilize this gene for wheat breeding to increase yield.
A set of KASP marker primers was developed, and the SNP8 site of the wheat TaREC2-6B gene was genotyped using competitive allele-specific PCR (KASP) technology. The fluorescence signal was analyzed using KlusterCaller, and two haplotypes of the TaREC2-6B gene, TaREC2-6B-HapI and TaREC2-6B-HapII, were identified for use in assisted breeding selection.
It provides efficient and low-cost breeding tools, significantly improves wheat flag leaf width, thousand-grain weight and yield per plant, shortens the breeding process, and provides new possibilities for the breeding of high-yield wheat varieties.
Smart Images

Figure CN121852609A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to molecular markers and their applications, specifically to molecular markers of the wheat TaREC2-6B gene and their application in assisted breeding, belonging to the field of crop selection and breeding technology. Background Technology
[0002] Wheat (Triticum aestivum) is an important global food crop, with a wide planting area, large trade volume, and a large population coverage, making it of great significance to increase wheat production.
[0003] The flag leaf is an important photosynthetic organ in wheat. Appropriate flag leaf size can improve photosynthetic efficiency and thus increase wheat yield. Flag leaf width is an important component of flag leaf morphology, closely related to thousand-grain weight and grain yield per plant, and has a profound impact on yield.
[0004] The wheat TaREC2-6B gene was previously mapped using a recombinant inbred line population constructed from Kenong 9204 and Jing 411 as research material. A major stable QTL controlling wheat flag leaf width, qFlw-6B, was located on chromosome 6B. Fine mapping of this QTL revealed it to be located within a 0.35 Mb interval between 670.48 and 670.83 Mb. Candidate gene analysis suggested that TraesCS6B03G1095300 might be a candidate gene for QTL qFlw-6B. Functional annotation showed that TraesCS6B03G1095300 is closely related to the establishment of chloroplast compartment volume in plant cells. This gene is homologous to the REC2 gene in Arabidopsis thaliana, hence the name TaREC2-6B.
[0005] The effects of natural variations in the wheat TaREC2-6B gene on wheat yield and related molecular markers have not yet been reported. Therefore, identifying haplotypes of the TaREC2-6B gene and developing usable molecular markers is of great significance for wheat molecular genetic improvement and yield enhancement. Summary of the Invention
[0006] The purpose of this invention is to provide a molecular marker for the TaREC2-6B gene, which is related to wheat flag leaf width, thousand-grain weight, and yield per plant, and its application in identifying wheat haplotypes, aiming to provide effective gene resources and molecular markers for crop genetic improvement and marker-assisted selection.
[0007] To achieve the above objectives, the present invention adopts the following technical solution: The application of molecular markers of the wheat TaREC2-6B gene in assisted breeding, wherein the molecular marker is a KASP marker, which can be amplified by a KASP marker primer set. The KASP marker primer set consists of two nucleotide sequences, as shown in SEQ ID NO: 1 and SEQ ID NO: 2, namely the front primer AlleleFAM and AlleleHEX, and one nucleotide sequence, as shown in SEQ ID NO: 3, namely the back primer Common. After KlusterCaller analysis of the fluorescence signal of the KASP marker, when the result is blue, the genotype of the wheat TaREC2-6B gene at SNP8 site is CC, and the haplotype is TaREC2-6B-HapI. When the result is red, the genotype of the wheat TaREC2-6B gene at SNP8 site is TT, and the haplotype is TaREC2-6B-HapII. Compared with the TaREC2-6B-HapI type, wheat of the TaREC2-6B-HapII type has a wider flag leaf width, a larger thousand-grain weight, and a higher yield per plant.
[0008] The advantages of this invention are: (1) The KASP molecular marker developed in this invention is derived from the genetic variation analysis of the TaREC2-6B gene in natural wheat populations, providing unique genetic information and a new tool for wheat breeding, which is of great significance for breeding high-yield wheat varieties; (2) By applying the KASP molecular marker developed in this invention, superior haplotypes of wheat can be identified in wheat strain selection, which not only saves costs but also greatly improves selection efficiency and accelerates the breeding process, providing new possibilities for efficient screening of superior alleles of TaREC2-6B gene and breeding high-yield wheat varieties. Attached Figure Description
[0009] Figure 1 This is a diagram showing the SNP variant sites and haplotype typing results of the wheat TaREC2-6B gene; Figure 2 This is a genotyping result diagram of the KASP marker for part of the wheat TaREC2-6B gene. In the diagram, blue represents the base C at the SNP8 site (genotype CC), red represents the base T at the SNP8 site (genotype TT), green represents the base heterozygous at the SNP8 site, and gray represents invalid results. Detailed Implementation
[0010] The present invention will now be described in detail with reference to the accompanying drawings and embodiments. Unless otherwise specified, the experimental methods used in the embodiments are conventional methods.
[0011] I. Obtaining the polymorphic site of the wheat TaREC2-6B gene The TaREC2-6B gene segment (2kb+ promoter, full-length gene, SEQ ID NO: 4) of wheat was selected, and sequence difference analysis was performed within the segment in the Wheat Genome Variation Joint Database (http: / / wheat.cau.edu.cn / WheatUnion / b_3 / ). 2789 samples were selected from the database, and the variation type was SNP.
[0012] Sequence differential analysis revealed nine SNP sites in the wheat TaREC2-6B gene, designated as SNP1, SNP2, SNP3, SNP4, SNP5, SNP6, SNP7, SNP8, and SNP9. The physical locations of these nine SNP variant sites in the Chinese spring wheat reference genome sequence RefSeq v2.1 are 670586611, 670587144, 670587705, 670588888, 670591430, 670591653, 670595220, 670596651, and 670597152.
[0013] II. Obtaining the wheat TaREC2-6B haplotype Sequence difference analysis within intervals was performed using the Wheat Genome Variation Joint Database (http: / / wheat.cau.edu.cn / WheatUnion / b_3 / ), selecting 2789 samples from the database to predict haplotypes. This was combined with laboratory resequencing data to determine gene sequence variations.
[0014] Sequence analysis revealed nine SNP variations in the wheat TaREC2-6B gene, including one SNP in the promoter region, one in the first intron region, one in the fifth exon region, one in the eleventh exon region, one in the eleventh intron region, one in the twentieth exon region, and three in the twenty-third exon region.
[0015] Based on the comprehensive variation types, KASP markers were developed and validated in a natural laboratory population, detecting a total of two haplotypes ( Figure 1 , Table 1): TaREC2-6B-HapI, TaREC2-6B-HapII.
[0016] Table 1. Results of differential sequence analysis of 2789 samples
[0017] III. Identification of wheat TaREC2-6B haplotypes Competitive allele-specific PCR (KASP) molecular marker-assisted selection breeding can select for target traits at the DNA level, which not only provides stable results and reduces the cost of phenotypic evaluation, but also improves the efficiency of wheat breeding.
[0018] To further validate and utilize the obtained SNP variant sites, KASP markers were developed. SNP8 was selected from SNP1, SNP2, SNP3, SNP4, SNP5, SNP6, SNP7, SNP8, and SNP9. Primer sequences were designed using WheatOmics (http: / / wheatomics.sdau.edu.cn / PrimerServer / ), evaluated using WheatOmics, and finally validated in 269 materials.
[0019] For SNP8, the designed primers consist of two front primers (Primer Allele X and Primer Allele Y) and one back primer (Common). To enable detection of the PCR amplification products using a microplate reader, the 5' end of the front primer Primer Allele X is labeled with the FAM fluorescent group, and the 5' end of the front primer Primer Allele Y is labeled with the HEX fluorescent group. The labeled primers are denoted as AlleleFAM and AlleleHEX, respectively. The nucleotide sequences of AlleleFAM, AlleleHEX, and Common are as follows: AlleleFAM: GAAGGTGACCAAGTTCATGCTATGGAAATCCTGGGAGGC (SEQ ID NO: 1); AlleleHEX:GAAGGTCGGAGTCAACGGATTCATGGAAATCCTGGGAGGT (SEQ ID NO: 2); Common: CACCTGCTTCCAACTCATTTCT (SEQ ID NO: 3).
[0020] The DNA of 269 common hexaploid wheat varieties (seedlings) listed in Tables 2-1 to 2-6 was subjected to PCR reaction using the primers AlleleFAM, AlleleHEX and Common.
[0021] (1) The PCR reaction system consists of: 2 μL DNA template (30 ng / μL), 2.5 μL KASP Master Mix (LGCGenomics, KBS-1016-002) and 0.08 μL primer working solution, which is then added to 5 μL with sterile ultrapure water. The primer working solution is prepared as follows: 12 μL of 100 μM AlleleHEX, 12 μL of 100 μM AlleleFAM and 30 μL of 100 μM Common are mixed and then diluted with distilled water to bring the total volume to 100 μL. (2) The PCR reaction was carried out in a Soellex water bath. The specific PCR reaction procedure is as follows: First stage: 95℃ pre-denaturation for 15 min; 95℃ denaturation for 20 s, 65℃-55℃ annealing for 60 s, 10 cycles, each cycle decreasing by 0.6℃; 95℃ denaturation for 20 s, 55℃ annealing for 60 s, 30 cycles; Second stage: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 20 s, 55℃ annealing for 60 s, 5 cycles.
[0022] After the PCR reaction, fluorescence intensity was scanned and detected on Araya. KlusterCaller software (LGC Genomics, Beverly, USA) was used to analyze and read the data. Genotyping was performed based on the fluorescence signal (red / blue / green / gray). The specific results are as follows: (i) When the KlusterCaller result is blue, the wheat TaREC2-6B gene has a base of C at SNP8, a genotype of CC, and a haplotype of TaREC2-6B-HapI; (ii) When the KlusterCaller result is red, the wheat TaREC2-6B gene has a base of T at SNP8, a genotype of TT, and a haplotype of TaREC2-6B-HapII; (iii) When the KlusterCaller result is green, the wheat TaREC2-6B gene is heterozygous at SNP8; (iv) When the result of KlusterCaller is grayed out, the result is invalid.
[0023] KlusterCaller analysis results for some wheat samples are shown below. Figure 2 The KASP marker genotyping results of the TaREC2-6B gene in all 269 wheat materials are shown in Tables 2-1, 2-2, 2-3, 2-4, 2-5 and 2-6.
[0024] Table 2-1 Typing results of wheat TaREC2-6B gene from Reference 1 to Reference 22
[0025] Table 2-2 Typing results of wheat TaREC2-6B gene from References 23 to 76
[0026] Table 2-3 Typing results of wheat TaREC2-6B gene from References 77 to 130
[0027] Table 2-4 Typing results of wheat TaREC2-6B gene from References 131 to 184
[0028] Table 2-5 Typing results of wheat TaREC2-6B gene from Reference 185 to Reference 238
[0029] Table 2-6 Genotyping results of wheat TaREC2-6B gene from References 239 to 269
[0030] The KASP marker genotyping results showed that the KASP marker genotyping results were completely consistent with the haplotype prediction results based on network data, indicating that the KASP marker genotyping results were good.
[0031] This indicates that the KASP marker has been successfully developed and can be further applied to the detection of breeding materials.
[0032] IV. Association Analysis of Wheat TaREC2-6B Gene Haplotype and Yield Trait Phenotypic data of wheat flag leaf width, thousand-grain weight, and yield per plant were collected for seven environments over three years (E1: Laishan, Yantai, 2020; E2: Shijiazhuang, Hebei, 2020; E3: Changyi, Weifang, 2020; E4: Zhifu, Yantai, 2021; E5: Laishan, Yantai, 2021; E6: Shijiazhuang, Hebei, 2021; E7: Laishan, Yantai, 2022). The best linear unbiased estimate (BLUE) for each trait across multiple environments was calculated using the R package lme4.
[0033] Statistical analysis of the data was performed using Excel software, and significance analysis was conducted using Student's t-test. The results of the association analysis of the wheat TaREC2-6B gene with multiple environmental agronomic traits (flag leaf width, thousand-grain weight, and yield per plant) are shown in Tables 3-1, 3-2, and 3-3.
[0034] Table 3-1 Results of multi-environmental flag leaf width association analysis of wheat TaREC2-6B gene
[0035] Note: * indicates P<0.05, ** indicates P<0.01, and ns indicates no significant difference.
[0036] Table 3-2 Results of multi-environmental thousand-grain weight association analysis of wheat TaREC2-6B gene
[0037] Note: * indicates P<0.05, ** indicates P<0.01, and ns indicates no significant difference.
[0038] Table 3-3 Results of multi-environmental yield association analysis of wheat TaREC2-6B gene in single plants
[0039] Note: * indicates P < 0.05, ** indicates P < 0.01, and ns indicates no significant difference.
[0040] In summary, the haplotype analysis results show that: (1) Compared with the TaREC2-6B-HapI type, the TaREC2-6B-HapII flag leaf width increased significantly by an average of 5.73%; (2) Compared with the TaREC2-6B-HapI type, the average thousand-grain weight of TaREC2-6B-HapII increased significantly by 7.24%; (3) Compared with the TaREC2-6B-HapI type, the yield per plant of TaREC2-6B-HapII increased significantly by 14.82%.
[0041] This shows that the two haplotypes of the wheat TaREC2-6B gene have a significant regulatory effect on traits such as flag leaf width, thousand-grain weight, and yield per plant.
[0042] Based on the comprehensive performance of various traits, wheat of the TaREC2-6B-HapII type exhibits superior agronomic traits and is a superior haplotype of wheat, possessing potential value in the breeding of high-yielding varieties.
[0043] In summary, the two haplotypes of the wheat TaREC2-6B gene identified in this invention are significantly associated with wheat flag leaf width, thousand-grain weight, and yield per plant, and have important application value for improving wheat yield traits.
[0044] It should be noted that the above embodiments are merely examples for clearly illustrating the present invention, and are not intended to limit the implementation of the present invention. Those skilled in the art can make other variations or modifications based on the above description. It is impossible to exhaustively list all possible implementations here. All obvious variations or modifications derived from the technical solutions of this invention are still within the scope of protection of this invention.
Claims
1. The application of molecular markers in wheat TaREC2-6B gene for assisted breeding, characterized by, The molecular marker is a KASP marker, which can be amplified by a KASP marker primer set. The KASP marker primer set consists of two front primers, AlleleFAM and AlleleHEX, with nucleotide sequences as shown in SEQ ID NO: 1 and SEQ ID NO: 2, and one back primer, Common, with a nucleotide sequence as shown in SEQ ID NO:
3. After KlusterCaller analysis, when the result is blue, the genotype of the wheat TaREC2-6B gene at SNP8 is CC, and the haplotype is TaREC2-6B-HapI. When the result is red, the genotype of the wheat TaREC2-6B gene at SNP8 is TT, and the haplotype is TaREC2-6B-HapII. Compared with the TaREC2-6B-HapI type, wheat of the TaREC2-6B-HapII type has a wider flag leaf width, a larger thousand-grain weight, and a higher yield per plant.
Citation Information
Patent Citations
Triticum aestivum L. flag leaf length quantitative trait locus (QTL) linked molecular marker and application thereof
CN110499387A
KASP-Flw-sau6198 molecular marker linked with wheat flag leaf width major QTL (quantitative trait locus) and application of KASP-Flw-sau6198 molecular marker
CN113817862A
Molecular marker closely linked with wheat flag leaf width major QTL and application of molecular marker in prediction of wheat flag leaf width
CN121046574A
Wheat comprising male fertility restorer alleles
US20210345575A1
Multiple KASP marker primer set for wheat plant height major genes and use thereof
US20250051861A1