Q-PCR (quantitative polymerase chain reaction) identification primer and kit for taro blight pathogenic bacteria and application of q-PCR identification primer and kit

Abstract

The invention discloses a q-PCR (quantitative polymerase chain reaction) identification primer and kit for taro blight pathogenic bacteria and application thereof, and belongs to the technical field of molecular biology. On one hand, the invention provides the q-PCR identification primer and the kit for the taro blight pathogenic bacteria, and on the other hand, the invention provides application of the identification primer and the kit. According to the invention, a q-PCR method is adopted to carry out quantitative analysis on the specific fragment of the pathogenic bacteria Phytophthora colocasiae of the taro blight, and the method can be directly used for establishing a rapid detection system of the field taro blight. The q-PCR rapid detection system established by the invention can be simply, conveniently and rapidly applied to the detection of the field taro blight.

Description

Technical Field

[0001] The invention belongs to the technical field of molecular biology, and specifically relates to a q-PCR identification primer for taro blight pathogen, a kit and applications thereof. Background Art

[0002] Disease outbreaks are the main limiting factor for large-scale taro cultivation. Taro blight is the main disease in taro production and storage. Phytophthora colocasia , which can cause a 25% to 30% reduction in taro yields, and in severe cases, a complete crop failure. The early symptoms of taro blight in the field are not obvious, making it difficult to determine the type of disease and guide the use of drugs early. It is urgent to establish early detection technology to achieve early identification of taro blight, guide scientific use of drugs, complete prevention and control in the early stages of the disease, and improve prevention and control efficiency.

[0003] Real-time fluorescence quantitative polymerase chain reaction (q-PCR) technology is widely used in gene variation detection, pathogen detection and molecular diagnosis due to its high sensitivity, high specificity, high accuracy and real-time advantages. It has been applied to the rapid detection of various pathogens such as corn stalk rot, strawberry wilt and anthracnose.

[0004] The invention utilizes q-PCR technology to establish a taro blight rapid identification method suitable for field application, including q-PCR amplification primers, amplification fragments, amplification system and amplification program. Summary of the invention

[0005] In view of the problems existing in the prior art, the object of the present invention is to design and provide a taro blight pathogen q-PCR identification primer, a kit and a technical solution for their application.

[0006] The present invention is specifically implemented by the following technical solutions: The first aspect of the present invention provides a taro blight pathogen q-PCR identification primer, which includes PC-YPT1-F1, PC-YPT1-R2 and PC-YPT1-Pb-FAM, the nucleotide sequence of PC-YPT1-F1 is shown in SEQ ID NO.7, the nucleotide sequence of PC-YPT1-R2 is shown in SEQ ID NO.8, and the nucleotide sequence of PC-YPT1-Pb-FAM is shown in SEQID NO.9.

[0007] The second aspect of the present invention provides a q-PCR identification kit for taro blight pathogens, which contains the above-mentioned identification primers.

[0008] The third aspect of the present invention provides the use of the above identification primers or the above kit in the identification of taro blight or the monitoring of taro blight pathogens.

[0009] A fourth aspect of the present invention provides a method for rapid identification of taro blight pathogens in the field, comprising the following steps: 1) Take the DNA of the crop tissue to be identified as a template; 2) performing q-PCR using the above-mentioned identification primers or the above-mentioned kit; 3) Based on the amplification effect, if the Ct value is <33, it is determined that the pathogen of taro blight is present.

[0010] Furthermore, the q-PCR reaction system in step 2) is: 2×5G buffer 10 uL, PC-YPT1-F1 with a concentration of 20 uM 0.2 uL, PC-YPT1-R2 with a concentration of 20 uM 0.2 uL, PC-YPT1-Pb-FAM with a concentration of 20 uM 0.1 uL, ddH2O 5.5 uL, and template 4 uL.

[0011] Furthermore, the q-PCR reaction program in step 2) is: 95°C 60s, 1 cycle; 95°C 1s, 58°C 5s, 45 cycles.

[0012] The taro blight pathogen amplified by the q-PCR method used in the present invention Phytophthora colocasia The specific fragment, whose sequence is shown in SEQ ID NO.25.

[0013] The present invention adopts q-PCR method to detect taro blight pathogen Phytophthora colocasia The quantitative analysis of specific fragments can be directly used to establish a rapid detection system for taro blight in the field. The q-PCR rapid detection system established by the present invention can be simply and quickly applied to the detection of taro blight in the field. DETAILED DESCRIPTION

[0014] The technical solutions in the embodiments of the present invention are described clearly and completely below. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0015] After preliminary research, the pathogen of taro blight was identified Phytophthora colocasia The specific fragment, whose specific sequence is shown in SEQ ID NO.25: TTTCAGATGAAGGGTCCTGTGAGGTTCAATTTCTATCAGGATTGCTGACTTGGTGGTATCTCTAGAAAATCCGTACGATCGAGTTGGACGGCAAGACCATCAAGCTCCAGATTGTAAGCAACCAAAGTTTAAGACTCGTCATCCACCTGAGTACTCTGGACTAATTAATGGTTGTGCCAACTCCCTTGTGCTCCTGTA.

[0016] Example 1: Primer screening Taro blight Phytophthora colocasia ) The pathogen was inoculated on potato dextrose agar (PDA) medium and cultured in a biochemical incubator at (28±2)℃ for 5 days. After the strain was fully sporulated, a small amount of hyphae of the taro blight pathogen on the PDA plate was scraped and suspended in 100μL 1×TE solution, shaken and mixed, and the bacterial suspension was aspirated as an amplification template. ddH2O was used as a template as a control. The reaction system is shown in Table 1. Primers were designed according to specific fragments. The primer sequences used are shown in Table 2 and were synthesized by Shanghai Shenggong Biotechnology Co., Ltd. The reaction program was: 95℃ 60s, 1 cycle; 95℃ 1s, 58℃ 5s, 45 cycles, using The data were analyzed by the method, and the results are shown in Table 3.

[0017] Table 1: q-PCR reaction system

[0018] Table 2: Primer sequences used in different treatments

[0019] Table 3: Ct values ​​obtained from q-PCR reactions with different treatments

[0020] Conclusion: This example screened out an effective primer set from different primer groups, namely treatment 3, and determined that the effective primers are: PC-YPT1-F1: TGCTGACTTGGTGGTATTCTC (SEQ ID NO.7); PC-YPT1-R2:AACTTTGGTTGCTTACAATCTGG (SEQ ID NO.8); PC-YPT1-Pb-FAM: ATCGAGTTGGACGGCAAGACCATC (SEQ ID NO. 9).

[0021] Example 2: Real-time fluorescence PCR sensitivity detection Taro blight Phytophthora colocasia ) The pathogen was inoculated on potato dextrose agar (PDA) medium and cultured in a biochemical incubator at (28±2)℃ for 5 days until the strain fully produced spores; 60-day-old healthy Yongkang Shun taro plants were selected, leaves without disease spots were wiped with sterile water and brushed lightly with a brush, and 1cm×1cm blocks of bacteria were cut and placed close to the treated taro leaf surface. The taro plants were kept in an environment with a temperature of (30±2)℃ and a humidity of (80±5)% until the disease occurred.

[0022] Treatment 1: 48 hours after the disease occurs on leaves, cut off the lesions, place them in 100 μL 1×TE solution, crush them, shake and mix, and absorb 4-5 μL of bacterial suspension as a template for amplification.

[0023] Treatment 2: 48 hours after the disease on leaves, cut off the lesions and suspend them in 1000μL 1×TE solution. Vortex to mix well and aspirate 4-5uL of bacterial suspension as a template for amplification.

[0024] Treatment 3: 48 hours after the disease on the leaves, cut off the lesions and suspend them in 2000μL 1×TE solution. Vortex to mix well and aspirate 4-5uL of bacterial suspension as a template for amplification.

[0025] Treatment 4: 48 hours after the disease occurs on leaves, cut off the lesions and suspend them in 4000 μL 1×TE solution. Vortex to mix well and aspirate 4 to 5 μL of bacterial suspension as a template for amplification.

[0026] Treatment 5: Cut healthy taro leaves with the same lesion size as in treatment 1, place them in 100 μL × TE solution, crush them, shake and mix them, and absorb 4 to 5 uL of bacterial suspension as an amplification template.

[0027] NTC: Absorb 4-5 μL ddH2O as amplification template.

[0028] The above 6 treated amplification templates were added to the amplification reaction solution, where Primer 1 was PC-YPT1-F1, Primer 2 was PC-YPT1-R2, and Primer 3 was PC-YPT1-Pb-FA. Applied Biosystems 7500 (LifeTechnologies, USA) was used for q-PCR reaction. The reaction system is shown in Table 1, and the reaction program is: 95°C 60s, 1 cycle; 95°C 1s, 58°C 5s, 45 cycles, using The data were analyzed by the method, and the results are shown in Table 4.

[0029] Table 4: Ct values ​​obtained from q-PCR reactions with different treatments

[0030] Conclusion: The results of this example roughly clarify the detection sensitivity that can be achieved by the q-PCR reaction system of the present invention in field disease detection.

[0031] Example 3: Real-time fluorescence PCR specific detection Taro blight Phytophthora colocasia ) The pathogen was inoculated on potato dextrose agar (PDA) medium and cultured in a biochemical incubator at (28±2)℃ for 5 days until the strain fully produced spores; 60-day-old healthy Yongkang Shun taro plants were selected, leaves without disease spots were wiped with sterile water and brushed lightly with a brush, and 1cm×1cm blocks of bacteria were cut and placed close to the treated taro leaves. The taro plants were kept in an environment with a temperature of (30±2)℃ and a humidity of (80±5)%, and the leaves were observed every 24 hours to see if they were diseased.

[0032] Taro anthracnose pathogen ( Colletotrichum truncatum ) were inoculated on potato dextrose agar (PDA) medium and cultured in a biochemical incubator at (28±2)℃ for 5 days until the strain fully produced spores.

[0033] The taro variety tested was Yongkang Shun taro.

[0034] Treatment 1: 48 hours after the disease occurs on the leaves, cut off the lesions, place them in 1×TE solution and crush them, shake and mix them, and absorb 4-5uL of bacterial suspension as an amplification template.

[0035] Treatment 2: Scrape the taro blight on the PDA plate ( Phytophthora colocasia ) Suspend a small amount of pathogenic bacteria hyphae in 100 μL 1×TE solution, shake and mix, and aspirate 4 to 5 μL of bacterial suspension as a template for amplification.

[0036] Treatment 3: Pipette 10 μL of TE suspension from treatment 2, dilute with 90 μL 1×TE solution, and then pipette 4-5 μL of bacterial suspension as amplification template.

[0037] Treatment 4: Pipette 10 μL of TE suspension from treatment 3, dilute with 90 μL 1×TE solution, and then pipette 4-5 μL of bacterial suspension as a template for amplification.

[0038] Treatment 5: Pipette 10 μL of TE suspension from treatment 4, dilute with 90 μL 1×TE solution, and then pipette 4-5 μL of bacterial suspension as a template for amplification.

[0039] Treatment 6: Scrape the taro anthracnose pathogen from the PDA plate ( Colletotrichum truncatum ) Suspend a small amount of mycelium in 100 μL 1×TE solution, shake to mix, and aspirate 4 to 5 μL of bacterial suspension as a template for amplification.

[0040] Treatment 7: Cut healthy taro leaves with the same size of lesions as those in treatment 1, place them in 1×TE solution and crush them, shake and mix them, and absorb 4-5uL of bacterial suspension as amplification template.

[0041] NTC: Absorb 4-5 μL ddH2O as amplification template.

[0042] A total of 8 treated amplification templates were added to the amplification reaction solution, wherein Primer 1 was PC-YPT1-F1, Primer 2 was PC-YPT1-R2, and Primer 3 was PC-YPT1-Pb-FA. Applied Biosystems 7500 (LifeTechnologies, USA) was used for q-PCR reaction. The reaction system is shown in Table 1. The reaction program was: 95°C 60s, 1 cycle; 95°C 1s, 58°C 5s, 45 cycles, using Method for data analysis.

[0043] Conclusion: The q-PCR system has a good detection effect; the Ct values ​​of treatment 1 to treatment 5 are between 23.12 and 32.64, indicating that pathogens were detected in the reaction Phytophthora colocasia The target fragment was detected in the reaction of treatment 6, treatment 7 and negative control NTC (Table 5), indicating that no pathogens were detected in the reaction. Phytophthora colocasia The target fragments were as follows (Table 5).

[0044] Table 5: q-PCR detection

[0045] Although embodiments of the present invention have been shown and described, it will be appreciated by those skilled in the art that various changes, modifications, substitutions and variations may be made to the embodiments without departing from the principles and spirit of the present invention, and that the scope of the present invention is defined by the appended claims and their equivalents.

Claims

1. A q-PCR identification primer for taro blight pathogen, characterized in that: It includes PC-YPT1-F1, PC-YPT1-R2 and PC-YPT1-Pb-FAM, the nucleotide sequence of PC-YPT1-F1 is shown in SEQ ID NO.7, the nucleotide sequence of PC-YPT1-R2 is shown in SEQ ID NO.8, and the nucleotide sequence of PC-YPT1-Pb-FAM is shown in SEQ ID NO.

9.

2. A q-PCR identification kit for taro blight pathogens, characterized in that: Contains the identification primer as claimed in claim 1.

3. Use of the identification primer according to claim 1 or the kit according to claim 2 in identifying taro blight or monitoring taro blight pathogens.

4. A method for rapid identification of taro blight pathogens in the field, characterized in that: The following steps are involved: 1) Take the DNA of the crop tissue to be identified as a template; 2) performing q-PCR using the identification primers described in claim 1 or the kit described in claim 2; 3) Based on the amplification effect, if the Ct value is <33, it is determined that the pathogen of taro blight is present.

5. A method for rapid identification of taro blight pathogens in the field as claimed in claim 4, characterized in that: The q-PCR reaction system in step 2) is: 10 uL of 2×5G buffer, 0.2 uL of 20 uM PC-YPT1-F1, 0.2 uL of 20 uM PC-YPT1-R2, 0.1 uL of 20 uM PC-YPT1-Pb-FAM, 5.5 uL of ddH2O, and 4 uL of template.

6. A method for rapid identification of taro blight pathogens in the field as claimed in claim 4, characterized in that: The q-PCR reaction program in step 2) is: 95°C 60s, 1 cycle; 95°C 1s, 58°C 5s, 45 cycles.

Images