Swine influenza virus detection reagent, detection kit and detection method

Abstract

The invention relates to the technical field of virus detection, and provides a swine influenza virus detection reagent, a swine influenza virus detection kit and a swine influenza virus detection method.The swine influenza virus detection reagent and the swine influenza virus detection kit comprise a pair of NASBA amplification primers, an NASBA amplification system and NASBA enzyme reaction liquid; according to the method, an NASBA isothermal amplification system and a Mango detection system are coupled in a tubular detection mode, detection can be carried out without adding a fluorescent group labeled probe, the detection cost is low, the sensitivity and accuracy are high, the specificity is good, the detection operation is simple, rapid and high in efficiency, and the method is suitable for rapid detection of the swine influenza virus.

Description

Technical Field

[0001] The present invention belongs to the technical field of virus detection, and in particular relates to a swine influenza virus detection reagent, a detection kit and a detection method. Background Art

[0002] Swine flu, also known as swine influenza, is an acute, contagious respiratory disease caused by swine influenza virus (SIV). SIV belongs to the genus Influenza A virus of the family Orthomyxoviridae. The virus particles are polymorphic and sensitive to heat and disinfectants, but have strong resistance under dry and low temperature conditions. Swine influenza virus can proliferate in a variety of animal cells and chicken embryos and has hemagglutination activity, but there is no obvious difference in antigenicity between different strains. The current epidemic status of swine influenza virus and the progress of vaccine research show that SIV occurs worldwide, causing serious harm to the pig industry and may pose a threat to human health.

[0003] In my country, swine influenza virus is one of the infectious animal pathogens that poses a greater threat to the pig industry. It not only affects the health of pigs, but may also delay the time for fattening pigs to be put on the market, increase feeding costs, and thus cause significant economic losses to the pig industry. Early rapid detection and typing of swine influenza virus is a very important topic in the prevention of animal diseases. In terms of diagnostic technology, a variety of detection methods have been established, including traditional virus isolation methods, ELISA methods, immunofluorescence technology, RT-PCR methods, and fluorescent quantitative PCR methods. In recent years, isothermal amplification technology has attracted attention in the field of molecular diagnosis because of its simple operation and the lack of complex instruments and equipment. Isothermal amplification technology includes loop-mediated isothermal amplification (LAMP), recombinase polymerase amplification (RPA), and nucleic acid sequence-based amplification (NASBA). These methods can perform nucleic acid amplification at a constant temperature without the need for special instruments and are suitable for on-site detection.

[0004] However, the application of this method in the rapid diagnosis of swine flu virus on site is immature. In addition, the conventional NASBA method has problems such as repeated opening of the lid, easy contamination, and false positives during the detection process, which affects the accuracy of the on-site detection results. Summary of the invention

[0005] The purpose of the present invention is to provide a convenient, fast and highly accurate swine influenza virus detection reagent, detection kit and detection method.

[0006] To achieve the above purpose, the technical solution adopted by the present invention is as follows:

[0007] A swine influenza virus detection reagent, comprising NASBA amplification primers, wherein the NASBA amplification primers include:

[0008] Forward primer siv-M1-1F: CTTCCTCTCTCTCTCTCCTCT CTGCAGCGTAGACGCTTTGT;

[0009] Reverse primer siv-M1-1R: AATTCTAATACGACTCACTATAGGG CATGTTGTTCGGGTCCCCAT.

[0010] Furthermore, it also includes a NASBA amplification system and a NASBA enzyme reaction solution;

[0011] The NASBA amplification system comprises:

[0012] 30-60 mM Tris-HCl;

[0013] 60-80 mM KCl;

[0014] 10-30 mM MgCl2;

[0015] 0.5-2 mM dNTPs;

[0016] 0.5-2 mM NTPs;

[0017] 5-20 mM dithiothreitol;

[0018] 5-20% (v / v) DMSO;

[0019] 1-5 µM Thiazole Orange TO1;

[0020] The NASBA enzyme reaction solution comprises:

[0021] T7 RNA polymerase 40-80 U;

[0022] AMV reverse transcriptase 2-10 U;

[0023] RNaseH 0.05-0.15 U;

[0024] BSA 0.5-5 µg.

[0025] Furthermore, the NASBA amplification primers include 0.25-0.5 mM forward primer siv-M1-1F and 0.25-0.5 mM reverse primer siv-M1-1R.

[0026] The present invention also provides a swine influenza virus detection kit prepared using any of the above swine influenza virus detection reagents.

[0027] The present invention also provides a method for detecting swine influenza virus, which uses any of the above swine influenza virus detection reagents for detection, comprising the following steps:

[0028] S1, extract sample RNA;

[0029] S2, adding sample RNA and ultrapure water as a negative control into different NASBA amplification systems, and adding NASBA amplification primers;

[0030] S3, denatured at 65°C and then cooled to 41°C;

[0031] S4, adding NASBA enzyme reaction solution to perform isothermal amplification reaction;

[0032] S5, fluorescence detection of amplification products every 5-30 min during isothermal amplification reaction;

[0033] S6, comparing the fluorescence detection result of the sample RNA amplification product with the fluorescence detection result of the negative control amplification product to determine whether swine influenza virus is contained.

[0034] Further, in step S6, when the fluorescence intensity of the sample RNA amplification product is higher than 1.5 times that of the negative control, it is judged as swine influenza virus positive; when the fluorescence intensity of the sample RNA amplification product is lower than 1.2 times that of the negative control, it is judged as swine influenza virus negative; when the fluorescence intensity of the sample RNA amplification product is higher than the negative control by 1.2-1.5 times, the detection and judgment of steps S1-S6 are performed again.

[0035] Furthermore, the amplification reaction and fluorescence detection in steps S2-S5 are both performed in the same detection container.

[0036] Furthermore, the fluorescence detection conditions are: using a multi-well ELISA plate as a detection container, and using an ELISA reader for detection, exciting with a light source with a wavelength of 480 nm, and detecting the fluorescence emitted at a wavelength of 560 nm.

[0037] Further, in step S3, denaturation was performed at 65°C for 5 min, and the temperature was lowered to 41°C for annealing for 2 min;

[0038] In steps S4 and S5, the isothermal amplification reaction is carried out at 41° C. and the reaction time is ≤120 min.

[0039] Furthermore, the amount of sample RNA added was 2 μL.

[0040] Compared with the prior art, the present invention has the following beneficial effects:

[0041] 1. The present invention takes the NASBA isothermal RNA amplification system and the Mango nucleic acid aptamer fluorescence detection system as the core, and successfully couples the two to achieve rapid diagnosis of swine influenza virus. Specifically, the reverse complementary sequence CTTCCTCTCCTCTCCTCTCCTCT of the Mango aptamer sequence is introduced at the front end of the forward primer siv-M1-1F, and the connected Mango aptamer is amplified while the target RNA is amplified by NASBA; the fluorescent dye thiazole orange TO1 is added to the NASBA amplification system, so that the amplified Mango aptamer combines with the fluorescent dye thiazole orange TO1 to form a Mango-TO1 complex with very high fluorescence intensity, and the amplification of the target RNA can be determined by fluorescence detection, thereby determining whether the swine influenza virus is infected. The reagent and detection method have high sensitivity and accuracy, good specificity, and rapid detection.

[0042] 2. The reagents and methods of the present invention do not require the synthesis and addition of additional expensive fluorescent labeling probes, and the detection cost is low.

[0043] 3. Fluorescence detection can be performed while NASBA amplification is in progress, and a positive result can be determined in as little as 30 minutes, without having to wait until the reaction is completed in 120 minutes.

[0044] 4. The reagents and methods of the present invention can be used for one-tube amplification and detection. There is no need to repeatedly open the cover during the detection process, which makes the detection more convenient and quicker. It can also effectively avoid the contamination caused by repeated opening of the cover during the conventional NASBA method detection, thereby effectively preventing the generation of false positives. BRIEF DESCRIPTION OF THE DRAWINGS

[0045] In order to more clearly illustrate the embodiments of the present application or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present application. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0046] Figure 1 This is the fluorescence curve obtained for Verification Example 1.

[0047] Figure 2 This is a bar graph of the fluorescence detection results of Verification Example 2.

[0048] Figure 3 This is the fluorescence curve obtained for Verification Example 3. DETAILED DESCRIPTION

[0049] In the following, only some exemplary embodiments are briefly described. As those skilled in the art will appreciate, the described embodiments may be modified in various ways without departing from the spirit or scope of the present invention. Therefore, the drawings and descriptions are considered to be exemplary and non-restrictive in nature.

[0050] The embodiments of the present invention are described in detail below with reference to the accompanying drawings.

[0051] Example 1

[0052] A swine influenza virus detection reagent comprises NASBA amplification primers which are designed and synthesized for the M1 protein toxin gene of swine influenza disease and include a forward primer siv-M1-1F and a reverse primer siv-M1-1R.

[0053] Among them, the forward primer siv-M1-1F is: CTTCCCTTCCTCTCCTCTCCTCTCTGCAGCGTAGACGCTTTGT; the reverse primer siv-M1-1R is: AATTCTAATACGACTCACTATAGGGCATGTTGTTCGGGTCCCCAT.

[0054] The front end of the forward primer siv-M1-1F is designed to be connected with the reverse complementary sequence of the Mango adaptor sequence: CTTCCCTTCCTCTCCTCTCCTCT; the reverse primer siv-M1-1R contains the specific promoter sequence recognized by T7 RNA polymerase: TAATACGACTCACTATAGGG.

[0055] Furthermore, the swine influenza virus detection reagent also includes a NASBA amplification system and a NASBA enzyme reaction solution.

[0056] The NASBA amplification system includes:

[0057] 30-60 mM Tris-HCl;

[0058] 60-80 mM KCl;

[0059] 10-30 mM MgCl2;

[0060] 0.5-2 mM dNTPs;

[0061] 0.5-2 mM NTPs;

[0062] 5-20 mM dithiothreitol;

[0063] 5-20% (v / v) DMSO;

[0064] 1-5 µM Thiazole Orange TO1.

[0065] The NASBA enzyme reaction solution includes:

[0066] T7 RNA polymerase 40-80 U;

[0067] AMV reverse transcriptase 2-10 U;

[0068] RNaseH 0.05-0.15 U;

[0069] BSA 0.5-5 µg.

[0070] Preferably, when performing the swine influenza virus detection reagent test, the amount of NASBA amplification primers added includes 0.25-0.5 mM of the forward primer siv-M1-1F and 0.25-0.5 mM of the reverse primer siv-M1-1R.

[0071] Example 2

[0072] Provided is a swine influenza virus detection kit prepared using the swine influenza virus detection reagent described in Example 1.

[0073] Example 3

[0074] A method for detecting swine influenza virus, using the swine influenza virus detection reagent as described in Example 1 for detection, the method for detecting swine influenza virus comprising the following steps:

[0075] S1, extract and obtain sample RNA.

[0076] For example, nasal swabs from live pigs to be tested, or lung and tracheal secretions from dead pigs are collected as initial samples, and RNA kits are used for extraction to obtain sample RNA for testing.

[0077] S2, adding the RNA extracted in step S1 into the NASBA amplification system, and adding NASBA amplification primers; setting a negative control, adding ultrapure water as a negative control into the NASBA amplification system, and adding NASBA amplification primers.

[0078] S3, the mixed amplification system of step S2 is subjected to heating denaturation and cooling annealing, specifically, denaturation at 65°C for 5 minutes, cooling to 41°C for annealing for 2 minutes.

[0079] S4, adding NASBA enzyme reaction solution to the amplification system after annealing in step S3, and performing isothermal amplification reaction. The isothermal amplification reaction condition is 41°C.

[0080] S5, during the isothermal amplification reaction, the amplification product is subjected to fluorescence detection every 5-30 minutes, and the amplification reaction time does not exceed 120 minutes. That is, if the amplification reaction continues for 120 minutes and no swine influenza virus is detected, it is judged as negative and the amplification reaction is terminated.

[0081] S6, comparing the fluorescence detection result of the sample RNA amplification product with the fluorescence detection result of the negative control amplification product to determine whether swine influenza virus is contained.

[0082] Preferably, in the above steps S2-S5, the amplification reaction and fluorescence detection of the sample and / or the control are performed in the same detection container. That is, the amplification reaction and fluorescence detection are completed in one reaction system, and there is no need to aspirate the amplification product for signal amplification before detection, which can effectively avoid contamination caused by repeated opening of the cover during the operation, and further effectively prevent the generation of false positives.

[0083] Further preferably, a multi-well ELISA plate is used as the detection container, such as a 96-well or 384-well ELISA plate, etc., and an ELISA reader is used for detection, with a light source of 480 nm wavelength exciting and the fluorescence emitted at 560 nm wavelength being detected. Multiple samples can be detected simultaneously at one time, with fast detection and low cost.

[0084] The specific judgment standard of the test result is as follows: the fluorescence detection result of the sample RNA amplification product is compared with the fluorescence detection result of the negative control amplification product. When the fluorescence detection result of the sample RNA amplification product is higher than 1.5 times the detection result of the negative control (ultrapure water), it is judged as swine influenza virus positive; when the fluorescence intensity of the sample RNA amplification product is lower than 1.2 times that of the negative control, it is judged as swine influenza virus negative; when the fluorescence intensity of the sample RNA amplification product is higher than that of the negative control by 1.2-1.5 times, the detection and judgment of steps S1-S6 are repeated until it is judged to be positive or negative.

[0085] This method is based on the NASBA isothermal RNA amplification system and the Mango nucleic acid aptamer fluorescence detection system. The two are coupled to achieve rapid, sensitive and accurate detection, which can realize the rapid diagnosis of swine influenza virus. In addition, this method is a one-tube amplification and detection method. There is no need to open the lid repeatedly during the detection process. The detection is convenient and fast, which can effectively avoid the contamination caused by repeated opening of the lid during the conventional NASBA method detection process and effectively prevent the generation of false positives.

[0086] Verification Example 1

[0087] (1) Set up a sample group (SIV-RNA), a positive control group (Positive sample), a negative sample control group (Negative sample), and a negative control group (Control). Among them, the sample of the positive control group (Positive sample) contains the RNA fragment of the swine influenza virus M1 protein obtained by in vitro transcription; the sample of the negative sample control (Negative sample) is a clinical sample collected from pigs that does not contain swine influenza virus; the sample of the negative control group (Control) is ultrapure water.

[0088] (2) Select a live pig nasal swab as the starting sample (the lungs, tracheal secretions, etc. of dead pigs can also be selected as samples), and use an RNA extraction reagent / kit to extract the target gene RNA, which will be used as the sample RNA of the sample group to be tested (SIV-RNA).

[0089] (2) In a 384-well ELISA plate, take 2 μL of the prepared samples (including the RNA of the sample to be tested, the sample of the positive control group, the sample of the negative sample control group, and ultrapure water), add them to 15 μL of NASBA amplification system, and add 0.5 mM forward primer siv-M1-1F and 0.5 mM reverse primer siv-M1-1R. Set up 3 replicates for each group.

[0090] The 15 μL NASBA amplification system included: 40 mM Tris-HCl (pH 8.0); 70 mM KCl; 20 mM MgCl2; 1 mM dNTPs (deoxyribonucleoside triphosphates); 1 mM NTPs (ribonucleoside triphosphates); 10 mM dithiothreitol; 10% (v / v) DMSO (dimethyl sulfoxide); and 3 μM thiazole orange TO1.

[0091] (3) Denature the mixed amplification system at 65°C for 5 min, then cool to 41°C and anneal for 2 min.

[0092] (4) Add 7 μL of NASBA enzyme reaction solution to the annealed amplification system, seal with a transparent film, and perform isothermal amplification reaction at 41°C for 120 min.

[0093] Among them, 7 μL NASBA enzyme reaction solution includes: T7 RNA polymerase 60 U; AMV reverse transcriptase 8 U; RNaseH 0.1U; BSA (bovine serum albumin) 2 μg.

[0094] (5) During the isothermal amplification reaction, the ELISA plate was placed in an ELISA reader every 30 minutes, excited with a light source of 480 nm, and the fluorescence emitted at a wavelength of 560 nm was detected to obtain a fluorescence curve, such as Figure 1 shown.

[0095] (6) By comparing the fluorescence detection results of the sample RNA amplification product with the fluorescence detection results of the negative control amplification product, it can be determined whether the sample contains swine influenza virus.

[0096] The judgment criteria are: when the fluorescence detection result of the sample RNA amplification product is 1.5 times higher than the negative control (ultrapure water) detection result, it is judged as swine influenza virus positive; when the fluorescence intensity of the sample RNA amplification product is lower than 1.2 times that of the negative control, it is judged as swine influenza virus negative; when the fluorescence intensity of the sample RNA amplification product is between 1.2-1.5 times higher than that of the negative control, the detection and judgment of steps S1-S6 are repeated.

[0097] according to Figure 1 The results show that the fluorescence intensity of the sample group (SIV-RNA) and the positive control group (Positive sample) is more than 1.5 times higher than that of the negative control group (Control), indicating that the method is accurate and the RNA of the sample group is positive for swine influenza virus. Figure 1 It can be seen that at 30 minutes, the fluorescence intensity of the sample group (SIV-RNA) was more than 1.5 times higher than that of the negative control group (Control), indicating that the positive result of the sample can be determined at about 30 minutes of isothermal amplification reaction.

[0098] Verification Example 2

[0099] The groups were set as swine influenza virus group (SIV), bovine diarrhea virus group (BVDV), porcine reproductive and respiratory syndrome virus group (PRRSV), pseudorabies virus group (PRV), porcine parvovirus group (PPV), porcine circovirus group (PCV2) and negative control group (Control).

[0100] RNA extraction reagents were used to extract total RNA from virus-infected cell lysates of swine influenza virus SIV, bovine diarrhea virus BVDV, porcine blue ear virus PRRSV, pseudorabies virus PRV, porcine parvovirus PPV, and porcine circovirus PCV2, and used as sample RNA for swine influenza virus group (SIV), bovine diarrhea virus group (BVDV), porcine blue ear virus group (PRRSV), pseudorabies virus group (PRV), porcine parvovirus group (PPV), and porcine circovirus group (PCV2) for testing. The negative control group (Control) sample was ultrapure water.

[0101] Each group was set up with 3 replicates. The reagents and detection conditions were the same as those in Example 1. Fluorescence detection was performed 90 min after the isothermal amplification reaction. The detection results were as follows: Figure 2 shown.

[0102] according to Figure 2 The results showed that the Mango-NASBA system did not detect bovine diarrhea virus BVDV, porcine blue ear virus PRRSV, pseudorabies virus PRV, porcine parvovirus PPV and porcine circovirus PCV2, indicating that the detection method has good specificity for the detection of swine influenza virus.

[0103] Verification Example 3

[0104] The RNA solution of the in vitro synthesized SIV M1 protein segment was obtained by using an in vitro transcription reagent. The copy number concentration was calculated based on the measured concentration, and the sample was diluted to 7.9×10 6 , 7.9×10 5 , 7.9×10 4 , 7.9×10 3 , 7.9×10 2 , 7.9×10 1 , 7.9×10 0 copies / μL concentration.

[0105] The above gradient concentration samples were tested, and a negative control group (Control) with ultrapure water as the sample was set up. Each group was set up with 3 replicates. The detection reagents and detection conditions were the same as those in Verification Example 1. Finally, the fluorescence curve was obtained, as shown in Figure 3 shown.

[0106] according to Figure 3 The results showed that when the RNA copy concentration was as low as 7.9×10 0 copies / μL, it can also well detect and judge the positive results of swine influenza virus, indicating that the detection method has high sensitivity in the detection of swine influenza virus.

Claims

1. A swine influenza virus detection reagent, characterized in that: The method comprises a NASBA amplification primer comprising: Forward primer siv-M1-1F: CTTCCTCTCTCTCTCTCCTCT CTGCAGCGTAGACGCTTTGT; Reverse primer siv-M1-1R: AATTCTAATACGACTCACTATAGGG CATGTTGTTCGGGTCCCCAT.

2. The swine influenza virus detection reagent according to claim 1, characterized in that: Also included are a NASBA amplification system and a NASBA enzyme reaction solution; The NASBA amplification system comprises: 30-60 mM Tris-HCl; 60-80 mM KCl; 10-30 mM MgCl2; 0.5-2 mM dNTPs; 0.5-2 mM NTPs; 5-20 mM dithiothreitol; 5-20% (v / v) DMSO; 1-5 µM Thiazole Orange TO1; The NASBA enzyme reaction solution comprises: T7 RNA polymerase 40-80 U; AMV reverse transcriptase 2-10 U; RNaseH 0.05-0.15 U; BSA 0.5-5 µg.

3. The swine influenza virus detection reagent according to claim 2, characterized in that: The NASBA amplification primers include 0.25-0.5 mM forward primer siv-M1-1F and 0.25-0.5 mM reverse primer siv-M1-1R.

4. A swine influenza virus detection kit prepared using the swine influenza virus detection reagent according to any one of claims 1 to 3.

5. A method for detecting swine influenza virus, characterized in that: The method of using the swine influenza virus detection reagent according to any one of claims 1 to 3 for detection comprises the following steps: S1, extract sample RNA; S2, adding sample RNA and ultrapure water as a negative control into different NASBA amplification systems, and adding NASBA amplification primers; S3, denatured at 65°C and then cooled to 41°C; S4, adding NASBA enzyme reaction solution to perform isothermal amplification reaction; S5, fluorescence detection of amplification products every 5-30 min during isothermal amplification reaction; S6, comparing the fluorescence detection result of the sample RNA amplification product with the fluorescence detection result of the negative control amplification product to determine whether swine influenza virus is contained.

6. The method for detecting swine influenza virus according to claim 5, characterized in that: In step S6, when the fluorescence intensity of the sample RNA amplification product is higher than 1.5 times that of the negative control, it is judged as swine influenza virus positive; when the fluorescence intensity of the sample RNA amplification product is lower than 1.2 times that of the negative control, it is judged as swine influenza virus negative; when the fluorescence intensity of the sample RNA amplification product is higher than the negative control by 1.2-1.5 times, the detection and judgment of steps S1-S6 are repeated.

7. The method for detecting swine influenza virus according to claim 5, characterized in that: The amplification reaction and fluorescence detection in steps S2-S5 are all performed in the same detection container.

8. The method for detecting swine influenza virus according to claim 5 or 7, characterized in that: The fluorescence detection conditions are as follows: a multi-hole ELISA plate is used as a detection container, and an ELISA reader is used for detection, a light source with a wavelength of 480 nm is used for excitation, and fluorescence emitted at a wavelength of 560 nm is detected.

9. The method for detecting swine influenza virus according to claim 5, characterized in that: In step S3, denaturation was performed at 65°C for 5 min, and the temperature was lowered to 41°C for annealing for 2 min; In steps S4 and S5, the isothermal amplification reaction is carried out at 41° C. and the reaction time is ≤120 min.

10. The method for detecting swine influenza virus according to claim 5, characterized in that: The amount of sample RNA added was 2 μL.

Images