A Streptococcus suis antigen protein, its screening method, and its application

By screening for highly immunogenic proteins located in the cell wall and extracellular space of Streptococcus suis that are not homologous to the host, the problem of poor cross-protection efficacy of existing Streptococcus suis vaccines has been solved, and effective immune protection against multiple serotypes has been achieved.

CN119219752BActive Publication Date: 2026-04-03HUAZHONG AGRI UNIV
View PDF 1 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-09-12
Publication Date
2026-04-03

AI Technical Summary

Technical Problem

Due to the large number of serotypes and rapid mutation rate of existing streptococcal vaccines, it is difficult to develop subunit vaccines with good cross-immune protection.

Method used

By constructing a pan-genome of Streptococcus suis, we screened out highly immunogenic proteins located in the cell wall and extracellular space that are not homologous to the host. We then used reverse vaccinology to screen candidate antigen proteins, which were expressed and purified. Subsequently, we conducted Western blotting and mouse challenge experiments to verify their protective effects.

Benefits of technology

The selected antigen proteins provided good cross-immune protection, significantly reduced the bacterial load of Streptococcus suis type 2 and 9 strains in mouse tissues, improved survival rate and reduced the immune protection effect in mice after infection.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119219752B_ABST
    Figure CN119219752B_ABST
Patent Text Reader

Abstract

This invention discloses a Streptococcus suis antigen protein, its screening method, and its applications. Through reverse vaccinology and comparative genomics analysis, this invention screens antigens that meet the criteria of conservation, surface localization, and immunogenicity, and evaluates their reactivity with convalescent sera from different Streptococcus suis serotypes, ultimately identifying three antigens. Mice were immunized with the three antigen proteins, and challenge experiments with Streptococcus suis were conducted. The results showed that all three antigen proteins provided some protection against infections caused by Streptococcus suis serotypes 2 and 9. The antigen proteins disclosed in this invention have promising applications in the research of novel subunit vaccines against Streptococcus suis and in the diagnosis of Streptococcus suis infections.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biomedicine, specifically involving three suicidal streptococcal antigen proteins with cross-protective effects and their applications. Background Technology

[0002] Streptococcus suis is an important zoonotic pathogen. Infection of pigs with this bacterium can cause a variety of diseases such as meningitis, endocarditis, and septicemia. The infection rate and mortality rate are both high, making it one of the pathogenic bacteria that endanger the pig industry and public health.

[0003] Control of streptococcal disease in swine relies primarily on antibiotics and vaccines. However, with the increasing prevalence of drug resistance in Streptococcus suis, vaccines have become the most economical and effective means of prevention. Although commercially available vaccines exist, the large number of serotypes, rapid mutation rate, and the diverse range of diseases caused by Streptococcus suis make the development of highly effective and safe vaccines crucial. Subunit vaccines, due to their high safety profile and ability to provide cross-immune protection, have become a promising type of vaccine. However, the high diversity of Streptococcus suis strains presents significant challenges in developing subunit vaccines with good cross-immune protection.

[0004] Reverse vaccinology is based on the genome sequences of pathogenic microorganisms. Using amino acid or nucleotide sequence analysis tools, it screens the pathogen genome to select genes that express candidate antigens that meet certain criteria. The selected antigen proteins are then expressed and purified, and their protective efficacy is evaluated. Antigens with better protective effects can be used for further vaccine design. Currently, thousands of whole genome sequences of Streptococcus suis are available in publicly available databases, providing a solid foundation for screening candidate vaccine antigen proteins. Summary of the Invention

[0005] The purpose of this invention is to screen a new streptococcal vaccine antigen protein with cross-protective effects, and then evaluate the protective effect of the screened candidate antigen.

[0006] To achieve the above objectives, the technical solution of the present invention is as follows:

[0007] Based on the whole genome sequences of 944 Streptococcus suis strains from diseased pigs, a pan-genome of Streptococcus suis was constructed using software such as Prokka and Panaroo. Genes present in 99% of Streptococcus suis strains were classified as the core genome. Further bioinformatics tools such as PSORTb, TMHMM, BLAST, and Vaxijen were used to perform subcellular localization analysis, homology analysis with host proteins, and prediction and analysis of their immunogenicity. Highly immunogenic proteins located on the surface of Streptococcus suis and not homologous to those in the host were screened.

[0008] Using the genome of Streptococcus suis SC19 strain as a template and pET-28a plasmid as a vector, a prokaryotic expression recombinant plasmid was constructed. IPTG was added to a final concentration of 0.5 mM, and expression was induced at 16℃ for 14 h. Soluble proteins were selected, and Western blotting was performed using convalescent serum collected from piglets infected with Streptococcus suis serotypes 2 and 9 to detect their reactivity. It was found that antigen protein 1, antigen protein 2, and antigen protein 3 all reacted with serotype 2 and 9 positive sera, indicating good reactivity.

[0009] Three proteins, antigen protein 1 (SEQ ID NO. 1), antigen protein 2 (SEQ ID NO. 2), and antigen protein 3 (SEQ ID NO. 3), were purified using Ni-NTA affinity chromatography. Five-week-old SPF-grade female KM mice were randomly divided into five groups: Group 1 was the negative control group (injected with PBS); Group 2 was immunized with antigen protein 1; Group 3 with antigen protein 2; Group 4 with antigen protein 3; and Group 5 was immunized with a commercially available Streptococcus suis subunit vaccine. After immunization, the mice in each group were challenged with Streptococcus suis type 2 and 9, respectively. The results showed that after challenge with a lethal dose of type 2 strain, the survival rate of the unimmunized negative control group was 55%, while the survival rates of the antigen protein 1 immunization group, the antigen protein 2 immunization group, the antigen protein 3 immunization group, and the commercially available vaccine group were 100%, 88%, 87%, and 100%, respectively. Following infection with a lethal dose of strain 9, the survival rate of mice in the unimmunized negative control group was 33%, while the survival rates of mice immunized with antigen protein 1, antigen protein 2, antigen protein 3, and the commercial vaccine group were 55%, 88%, 62%, and 75%, respectively. Colonization experiments showed that the tissue bacterial load in mice immunized with the commercial vaccine, as well as those immunized with antigen protein 1, antigen protein 2, and antigen protein 3, was lower than that in the negative control group, demonstrating that the candidate antigens screened in this study can provide a certain degree of immune protection.

[0010] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0011] 1. The method for screening candidate antigens according to the present invention includes the following steps: First, based on the whole genome sequences of a large number of Streptococcus suis strains from diseased pigs, a pan-genome of Streptococcus suis is constructed and a core genome is selected; further, reverse vaccinology analysis is performed on the core genes, including subcellular localization analysis, and proteins located in the cell wall and extracellular space of Streptococcus suis are selected as secreted proteins; then, transmembrane topology analysis is used to improve the accuracy and reliability of screening; then, homology analysis with host proteins and prediction and analysis of their immunogenicity are performed, and non-homologous proteins with per identity <35% are selected.

[0012] 2. According to the screening method proposed in this invention, a highly immunogenic protein located on the surface of Streptococcus suis and not homologous to the host can be obtained. Moreover, the candidate antigen protein can have good cross-immunoprotective effect and can provide certain immune protection against multiple Streptococcus suis serotypes, resulting in a significant reduction in the bacterial load of Streptococcus suis type 2 and 9 strains in various tissues of mice after challenge infection. Attached Figure Description

[0013] Figure 1 Flowchart for screening candidate antigens for Streptococcus suis subunit vaccines;

[0014] Figure 2 The results of candidate antigen expression

[0015] Figure 3 The images show the Western Blot results of the reaction between the antigen protein and positive sera of Streptococcus suis type 2 and 9. In the images, A represents the reaction results with positive sera of Streptococcus suis type 2; and B represents the reaction results with positive sera of Streptococcus suis type 9.

[0016] Figure 4 The image shows the results of antigen protein purification, where A. antigen protein 1; B. antigen protein 2; C. antigen protein 3;

[0017] Figure 5 This image shows the immunoprotective effect of Streptococcus suis type 2 after challenge with the strain. A. Survival curve of Streptococcus suis type 2 after challenge with a lethal dose; B. Bacterial load in mouse tissues after challenge with a sublethal dose of Streptococcus suis type 2. Group 1: Negative control group; Group 2: Commercial vaccine group; Group 3: Antigen protein 1 immunization group; Group 4: Antigen protein 2 immunization group; Group 5: Antigen protein 3 immunization group; “*” indicates a significant difference between groups (P<0.05); “**” indicates a significant difference between groups (P<0.01); “***” indicates a significant difference between groups (P<0.001).

[0018] Figure 6The graph shows the immunoprotective effect of Streptococcus suis serotype 9 after challenge. A represents the survival curve after challenge with a lethal dose of Streptococcus suis serotype 9; B represents the bacterial load in mouse tissues after challenge with a sublethal dose of Streptococcus suis serotype 9. Group 1: Negative control group; Group 2: Commercial vaccine group; Group 3: Antigen protein 1 immunization group; Group 4: Antigen protein 2 immunization group; Group 5: Antigen protein 3 immunization group; "*" indicates a significant difference between groups (P < 0.05); "**" indicates a significant difference between groups (P < 0.01); "***" indicates a significant difference between groups (P < 0.001). Detailed Implementation

[0019] The present invention will be described below with reference to specific embodiments. Those skilled in the art will understand that these embodiments are for illustrative purposes only and do not limit the scope of the invention in any way.

[0020] Example 1: Reverse Vaccination Screening of Candidate Antigens

[0021] (1) Based on the whole genome sequences of 944 Streptococcus suis strains from diseased pigs, a pan-genome consisting of 6,500 genes was constructed using software such as Prokka and Panaroo. Genes appearing in 99%-100% of the strains were defined as conserved genes, and a total of 1,492 core genes were found in these strains.

[0022] (2) The conserved gene sequences in FASTA format obtained in step (1) are translated in batches into protein amino acid sequences and input into PSORTb version 3.0.3 (https: / / www.psort.org / psortb / index.html) to predict the protein localization in bacterial cells. The organism type is selected as Bacteria, and Gramstain is selected as Positive, thus screening out proteins from Gram-positive bacteria. Other options use system presets. PSORTb provides predicted subcellular localization for each protein. Based on the PSORTb prediction results, proteins are divided into different subcellular localization groups. Proteins located in the cell wall and extracellular space of Streptococcus suis are screened as secretory proteins.

[0023] (3) Select candidate proteins whose PSORTb analysis results are "Unknown" and "Cytoplasmic Membrane" for topological analysis of transmembrane structures. The "Cytoplasmic Membrane" category in the PSORTb prediction results includes: a) Transmembrane proteins: proteins that span the cell membrane. b) Membrane-associated proteins: proteins that are attached to the membrane surface but do not completely span it.

[0024] The FASTA-format amino acid sequences were input into Phobius (https: / / phobius.sbc.su.se / ), TMHMM-2.0 (https: / / services.healthtech.dtu.dk / services / TMHMM-2.0 / ), and HMMTOP (http: / / www.enzim.hw / hmmtop / index.html). Proteins with more than 100 amino acids located outside the membrane were identified as surface proteins. Proteins identified as surface proteins by both Phobius and TMHMM-2.0 were screened, with the HMMTOP results used as a reference. Meanwhile, relevant literature was reviewed to identify already screened proteins, excluding candidate proteins already identified as intracellular proteins. Through this step, proteins located in the cell wall and extracellular space of Streptococcus suis obtained in step (2) can be identified as potential surface proteins, and the accuracy and reliability of the screening can be improved through various methods and standards.

[0025] (4) Using the BLASTp module on the NCBI website (https: / / www.ncbi.nlm.nih.gov / ), the amino acid sequences collected in step (3) were compared with the whole genome amino acid sequences of pigs (taxid: 9823) in the database for homology. Proteins with per-identity < 35% were defined as non-homologous proteins. In biology, the percentage of identity in the BLAST result is used as the criterion for determining whether two amino acid sequences are homologous. Here, it is stipulated that a percentage greater than 35% indicates that the candidate antigen protein being screened has high homology with the pig species. If it is used as a candidate antigen protein to design a vaccine, it will lead to a severe autoimmune reaction in pigs. Therefore, this study needs to screen for proteins with a per-identity of less than 35%, which are called non-homologous proteins.

[0026] (5) Immunogenicity analysis of the proteins was performed using the Vaxijen (https: / / www.ddg-pharmfac.net / vaxijen / VaxiJen / VaxiJen.html) immunogenicity analysis website. The amino acid sequences of the non-homologous proteins collected in step (4) were entered. The TARGET ORGANISM was set to Bacteria (target organism type is bacteria), and THRESHOLD was set to >0.5. THRESHOLD is a numerical limit used to distinguish proteins predicted as antigens and non-antigens. The amino acid sequences of the candidate proteins were compared with the amino acid sequences of the whole genome of Streptococcus suis (taxid: 1307) using BLASTp, and annotated. Based on the annotation information, relevant papers were consulted to complete the gene information, including the gene function, immunogenicity score, subcellular location, and size.

[0027] Table 1

[0028]

[0029]

[0030]

[0031]

[0032] Through the above steps, as Figure 1 The screening process shown obtained 83 candidate antigens according to the analysis method in Example 1. The amino acid sequence of the candidate antigen for preparing the Streptococcus suis vaccine was selected.

[0033] Experimental expression of candidate antigen proteins and their immune reaction with positive sera

[0034] The GenBank accession number for the Streptococcus suis SC19 strain used in this embodiment is NZ_CP020863.1.

[0035] The amino acid sequence of the candidate antigen for preparing the Streptococcus suis vaccine selected in Example 1 was compared and annotated with the amino acid sequence of the Streptococcus suis SC19 strain genome. The position of the amino acid sequence with high homology to the candidate antigen protein in the genome was located, thereby determining the gene that controls the encoding of this amino acid sequence, which is the target gene, and used as a template for the construction of recombinant plasmids.

[0036] (1) Extract the above-mentioned target gene from the genome of Streptococcus suis SC19 (gene bank number NZ_CP020863.1), use it as a template to design primers, and amplify the target gene;

[0037] Using pET-28a plasmid as a template, the vector fragment was amplified using the upstream primer pET28a-F (CTTTAAGAAGGAGATATACCATG) shown in SEQ ID NO.4 and the downstream primer pET28a-R (GTGGTGGTGGTGGTGGTGCTCGAG) shown in SEQ ID NO.5.

[0038] (2) The target gene fragment and the vector were ligated using homologous recombinase. The ligation product was then transformed into E. coli DH5α competent cells and cultured overnight at 37°C. Colony PCR amplification was performed using universal primers pET Upstream Primer (ATGCGTCCGGCGTAGA) as shown in SEQ ID NO.6 and T7 Terminator Primer (GCTAGTTATTGCTCAGCGG) as shown in SEQ ID NO.7 to screen and identify positive clones. Recombinant plasmids were extracted using a plasmid miniprep kit and finally DNA sequencing was performed to identify the recombinant plasmids.

[0039] (3) Select E. coli ClearColi BL21(DE3) cells transformed with the recombinant plasmid and culture them overnight at 37°C with shaking. The next day, transfer them to 20 mL of LB medium at a ratio of 1:100 and continue to culture at 37°C until OD. 600nm Adjust the pH to 0.6-0.8, add IPTG to a final concentration of 0.5 mM, and incubate overnight at 16°C. Prepare the supernatant and whole-cell samples after disruption, add protein loading buffer, and boil. Take 10 μL for SDS-PAGE gel electrophoresis. After electrophoresis, stain the SDS-PAGE gel in Coomassie Brilliant Blue solution for at least 4 hours, and destain until the target bands are clearly visible.

[0040] (4) Transfer the protein strip to a PVDF membrane at 25V 400mA for 25min. After the transfer is complete, add 10mL of blocking buffer and block overnight at 4℃ for about 14h. Wash three times with pre-cooled TBST for 5min each time.

[0041] (5) The PVDF membrane was incubated with 10 mL of 1:1000 diluted anti-Streptococcus suis type 2 antiserum and 1:500 diluted anti-Streptococcus suis type 9 antiserum at room temperature for 2 h, and then rinsed three times with pre-cooled TBST for 5 min each time. A 1:5000 diluted goat anti-swine secondary antibody was added and incubated at room temperature for 1 h, followed by three rinses with pre-cooled TBST for 5 min each time. A 1:1 developing solution was added, and the membrane was developed in the dark for 3 min. The membrane was then developed in a chemiluminescence analyzer for Western blotting to identify the immunoreactivity of the protein.

[0042] After obtaining 83 candidate antigens, a portion of the antigens were selected for trial expression using steps (1), (2), and (5). The soluble proteins expressed were then subjected to reaction-probability testing (Western blot), and finally, three antigen proteins that met the criteria were obtained: antigen protein 1: TroA is 34.2 kDa (as shown in SEQ ID NO.1), antigen protein 2: YckB is 31.8 kDa (as shown in SEQ ID NO.2), and antigen protein 3: Gap is 35.8 kDa (as shown in SEQ ID NO.3).

[0043] Example 2: Purification of candidate antigen proteins

[0044] (1) Pick Escherichia coli ClearColi BL21(DE3) cells transformed with the recombinant plasmid in Example 2 and culture them overnight at 37°C with shaking. The next day, transfer them to 2L LB medium at a ratio of 1:100 and continue to culture at 37°C until OD. 600nm Adjust the pH to 0.6-0.8, add IPTG to a final concentration of 0.5 mM, and incubate overnight at 16°C. After centrifugation, discard the supernatant and collect the bacterial cells.

[0045] (2) Resuspend the bacterial cells in PBS and lyse them using a pressure lysate. Centrifuge to remove any undamaged cells and cell debris, and collect the supernatant.

[0046] (3) The bacterial lysis supernatant was mixed with Ni affinity resin, and then the antigen protein was purified in a protein purification instrument in a buffer with gradient imidazole concentrations.

[0047] (4) After dialysis of the antigen protein in PBS, it was concentrated using an ultrafiltration tube and stored at -80°C.

[0048] The three antigen proteins screened in Example 1 were purified by Ni-NTA affinity chromatography, yielding single, strong bands that corresponded to the expected molecular weights of the antigen proteins. Figure 3 As shown.

[0049] Example 3 Evaluation of the protective effect of vaccine candidate antigens

[0050] (1) Five-week-old female SPF-grade KM mice provided by the Experimental Animal Center of Huazhong Agricultural University were divided into five groups. The first group was the negative control group (injected with PBS). The second group was immunized with commercially available Streptococcus suis subunit vaccine. The third group was immunized with immunogenic protein 1, the fourth group with immunogenic protein 2, and the fifth group with immunogenic protein 3. The dosage of the three antigens was 0.25 mg / mL. The second immunization was performed 14 days after the first immunization. On the 7th day after the second immunization, the mice in each group were challenged with Streptococcus suis type 2 and type 9 strains, respectively.

[0051] Clinical symptoms and survival rates of mice were observed. Results showed that after challenge with a lethal dose of strain 2, the survival rate of unimmunized negative control mice was 55%, while the survival rates of mice immunized with antigen protein 1, antigen protein 2, antigen protein 3, and the commercial vaccine group were 100%, 88%, 87%, and 100%, respectively. After infection with a lethal dose of strain 9, the survival rate of unimmunized negative control mice was 33%, while the survival rates of mice immunized with antigen protein 1, antigen protein 2, antigen protein 3, and the commercial vaccine group were 55%, 62%, 88%, and 75%, respectively.

[0052] (2) Each group was challenged with sublethal doses of Streptococcus suis type 2 and 9 strains. Mice were sacrificed 6 h and 12 h after infection. Four organs, namely heart, liver, spleen and kidney, were collected, ground and plate colony counts were performed. The results showed that the tissue bacterial load of mice in the commercial vaccine immunization group, as well as the antigen protein 1 immunization group, antigen protein 2 immunization group and antigen protein 3 immunization group, was lower than that in the negative control group, proving that the candidate antigens screened in this study can provide certain immune protection.

Claims

1. The application of an antigen protein in the preparation of a subunit vaccine for the prevention of Streptococcus suis infection, characterized in that, The antigen protein is selected from one or more of the following proteins. (a) Antigen protein 1, consisting of the amino acid sequence shown in SEQ ID NO.

1. (b) Antigen protein 2, consisting of the amino acid sequence shown in SEQ ID NO.

2. (c) Antigen protein 3 consisting of the amino acid sequence shown in SEQ ID NO. 3; The Streptococcus suis strain is either type 2 or type 9.

Citation Information

Patent Citations

  • Preparation method and application of mycoplasma hyopneumoniae multi-epitope genetic engineering subunit vaccine based on reverse vaccinology technology

    CN114288402A