Two Porcine Epidemic Diarrhea Virus Monoclonal Neutralizing Antibodies of Whole Swine Origin and Their Uses

Abstract

The present invention discloses two porcine epidemic diarrhea virus (PEDV) monoclonal antibodies C62 and N19 of all porcine origin, belonging to the field of genetic engineering. The monoclonal antibodies include heavy chain, light chain variable regions and heavy chain, light chain constant regions. The amino acid sequences of the heavy chain variable regions of C62 and N19 are shown as SEQ ID NO: 1 and SEQ ID NO: 3 respectively, and the amino acid sequences of the light chain variable regions of C62 and N19 are shown as SEQ ID NO: 2 and SEQ ID NO: 4 respectively. The monoclonal antibodies provided by the present invention are real antibodies obtained from pigs by using single B cell antibody technology and have high neutralizing activity against PEDV.

Description

Technical Field

[0001] The present invention belongs to the field of genetic engineering and relates to two all - porcine PEDV monoclonal antibodies with neutralizing activity. Background Art

[0002] Porcine epidemic diarrhea (PED) is an acute and highly contagious disease caused by porcine epidemic diarrhea virus (PEDV), and its main symptoms are vomiting, watery diarrhea and dehydration. According to phylogenetic analysis, PEDV can be divided into two major categories, genotype GI (classical strain) and genotype GII (high - virulence strain). With the research, development and marketing of GII genotype vaccines, although the infection rate of PEDV has been reduced, the epidemic of PEDV has not been stopped, and the mortality rate of piglets is still very high. Although vaccination is the main strategy for preventing and controlling PEDV infection, the currently available PEDV vaccines cannot provide complete protection for pigs infected with high - virulence strains, which urgently requires us to cooperate with other prevention and control measures to prevent PEDV.

[0003] PEDV mainly infects the digestive tract and is transmitted through the fecal - oral route. At present, there is no specific treatment method for PEDV except symptomatic treatment and supportive treatment. For digestive tract pathogen infections, orally administering specific neutralizing antibodies or antibody derivatives to animals is an effective prevention and treatment method because neutralizing antibodies can neutralize the virus and inhibit the infection of intestinal cells by the virus. Currently, the main techniques for preparing monoclonal neutralizing antibodies are hybridoma cell technology, phage display technology and single B - cell antibody technology. The antibodies prepared by hybridoma cell technology are murine antibodies, and there are problems such as poor homogeneity and immune rejection in their application; the antibodies prepared by phage display are usually single - chain antibodies, and the pairing of heavy and light chains is random (non - natural pairing), and the antibody affinity is unstable; the antibodies prepared by single B - cell antibody technology have naturally paired heavy and light chains and can be specific for a particular species, avoiding immune rejection reactions, which makes single B - cell antibody technology an important method for screening neutralizing antibodies.

[0004] Most of the reported PEDV monoclonal neutralizing antibodies are murine antibodies, and only one strain, PC10, is a whole-porcine antibody (Fu F, Li L, Shan L, et al. A spike-specific whole-porcine antibody isolated from a porcine B cell that neutralizes both genogroup 1 and 2 PEDV strains. [J]. Veterinary Microbiology, 2017:99-105.), and there are also three porcine single-chain antibodies. Compared with the single-chain antibody composed only of the variable regions of the heavy and light chains, the complete antibody is composed of two heavy chains and two light chains, and both the heavy and light chains include variable regions and constant regions. According to the differences in the constant regions of the heavy chains, antibodies can be divided into five types: IgA, IgG, IgM, IgD, and IgE, and the light chains can be divided into two types, Kappa and Lambda, according to sequence characteristics. IgG antibodies play an important role in humoral immunity, and currently many antibody drugs are IgG antibodies. The variable region of the antibody contains three hypervariable regions, CDR1, CDR2, and CDR3, where the amino acids in these three regions change greatly and are the key regions for binding antigens. The complete antibody has an Fc fragment, which is more stable in the body and has an Fc-mediated antiviral function in addition to neutralizing activity (Fc binds to complement to form a membrane attack complex, causing lysis of target cells; Fc can also bind to Fc receptors on the surface of effector cells, mediating the killing of target cells by effector cells). The only previously reported whole-porcine antibody, PC10 (with a Kappa-type light chain), has a good neutralizing effect on GI-type PEDV strains but has a poor neutralizing effect on highly virulent (GII-type) strains. However, the currently prevalent strains are mainly highly virulent (GII-type) strains, which urgently requires us to develop neutralizing antibodies against GII-type virus strains and develop antibody biologics to supplement the role of vaccines.

[0005] Based on this, we used the PEDV-S1 protein as a bait antigen and prepared multiple whole-porcine highly reactive antibodies using the single B cell antibody technology. Among them, three strains were named B5 (patent applied for), C62, and N19. Among the three antibodies, C62 and N19 (both with Lambda-type light chains, different from PC10) are two whole-porcine neutralizing antibodies against highly virulent PEDV strains, and the development of this neutralizing antibody has laid a foundation for the prevention and treatment of PEDV. Summary of the Invention

[0006] The purpose of the present invention is to provide two whole-porcine PEDV antibodies, which can not only react with the PEDV-S1 protein but also neutralize PEDV, especially highly virulent strains, and thus can be used for the diagnosis, prevention, and treatment of PEDV.

[0007] The present invention is implemented as follows:

[0008] The applicant used the PEDV-S1 protein as a screening antigen and applied the single B cell antibody technology to conduct high-throughput screening of antibodies from pigs. During this process, multiple single B cells with functional diversity were obtained. Using the cDNA of these single B cells as templates, two rounds of PCR amplification were carried out to obtain the variable region genes of the heavy and light chains of the antibody and sequence them. Then, the variable region sequences of these heavy and light chains were optimized and synthesized and inserted into expression vectors containing the porcine IgG1 heavy chain constant region or the porcine lambda light chain constant region respectively to obtain complete heavy and light chain vectors expressing the antibody. Finally, the complete heavy and light chain vectors were co-transfected into host cells for expression, and multiple monoclonal antibodies with functional diversity were finally obtained through purification.

[0009] The applicant named two of the antibodies C62 and N19 respectively. They are both monoclonal antibodies against PEDV that actually exist in pigs. Since these antibodies all include the heavy chain, light chain variable regions and heavy chain, light chain constant regions, they are different from the existing single-chain antibodies. Since the variable region sequences of these antibodies are different from the existing all-porcine-source antibodies, there are significant differences in various aspects such as reactivity and neutralizing activity. Experiments have proved that the antibodies C62 and N19 screened by the present invention have strong neutralizing activity against PEDV and can be better used for the prevention and treatment of PEDV epidemic strains, namely GII type virulent strains.

[0010] A more specific scheme is as follows:

[0011] Two all-porcine-source PEDV monoclonal antibodies C62 and N19, the monoclonal antibodies include heavy chain, light chain variable regions and heavy chain, light chain constant regions, and the amino acid sequences of the heavy chain variable regions of C62 and N19 are shown as SEQ ID NO: 1 and SEQ ID NO: 3 respectively, and the amino acid sequences of the light chain variable regions of C62 and N19 are shown as SEQ ID NO: 2 and SEQ ID NO: 4 respectively.

[0012] Preferably, the heavy chain constant region of the monoclonal antibodies C62 and N19 is of IgG1 type and the light chain constant region is of lambda type.

[0013] The present invention further provides DNA fragments encoding the two all-porcine-source PEDV monoclonal antibodies C62 and N19.

[0014] The DNA fragments encoding the complete heavy chains of C62 and N19 are shown as SEQ ID NO: 7 and SEQ ID NO: 11 respectively; the DNA fragments encoding the complete light chains of C62 and N19 are shown as SEQ ID NO: 9 and SEQ ID NO: 13 respectively.

[0015] The present invention also provides an expression vector and a host cell containing the DNA fragment, which can be used to produce the monoclonal antibodies C62 and N19.

[0016] A specific embodiment of the present invention verified the reactivity of the monoclonal antibodies C62 and N19 with the PEDV-S1 protein and PEDV strains. Therefore, the monoclonal antibodies C62 and N19 obtained in the present invention can be used for the detection of PEDV and its antigenic proteins. Based on this, the present invention provides the use of the monoclonal antibodies C62 and N19 in the preparation of a PEDV detection kit.

[0017] A specific embodiment of the present invention also verified the neutralizing activity of the monoclonal antibodies C62 and N19 with PEDV strains. Based on this, the present invention also provides the use of the monoclonal antibodies C62 and N19 in the preparation of PEDV prevention and treatment biological agents. Specifically, the monoclonal antibodies C62 and N19 have neutralizing activity against PEDV virus, can bind to the PEDV surface antigen, thereby resisting the porcine epidemic diarrhea caused by the invasion of PEDV virus, especially the highly virulent strain of genotype GII.

[0018] For more detailed technical solutions, please refer to the specific embodiments. Brief Description of the Drawings

[0019] Figure 1 : Gel electrophoresis diagram for the identification of antibodies C62 and N19.

[0020] Figure 2 : ELISA detection results for the reactivity of antibodies C62 and N19.

[0021] Figure 3 : Indirect immunofluorescence detection results for the reactivity of antibodies C62 and N19.

[0022] Figure 4 : Sequence alignment of the variable regions of antibodies B5, C62, and N19, and the results show that there are significant differences in the sequences of the hypervariable regions CDR1, CDR2, and CDR3. Detailed Description of the Embodiments

[0023] The following further describes the present invention in detail with reference to specific embodiments. Obviously, the described embodiments are only a part of the embodiments of the present invention, not all of them. Based on the embodiments of the present invention, other alternative solutions obtained by those skilled in the art without creative efforts fall within the protection scope of the present invention.

[0024] The applicant used the PEDV-S1 protein as a screening antigen and applied the single B cell antibody technology to conduct high-throughput screening of antibodies from pigs. During this process, multiple single B cells and monoclonal antibodies with diverse functions were obtained. Among them, one antibody, B5, applied for a Chinese invention patent on October 14, 2022, with the application number 202211259289X and the publication number CN116217714A. Monoclonal antibody B5 can specifically recognize the S1 protein, is a reactive antibody, and has no neutralizing activity against PEDV. The applicant screened a specific antigenic epitope peptide on PEDV using monoclonal antibody B5.

[0025] The other two antibodies (C62 and N19) in this application were also screened using the same method. These two antibodies, like B5, are real anti-PEDV antibodies in pigs, but their properties are very different from those of B5 before. They can not only react with the S1 protein but also have a high level of PEDV neutralizing activity. And the applicant also compared them with another known all-porcine PEDV monoclonal antibody PC10. The results showed that C62 and N19 have higher neutralizing activity against PEDV and can be used to prepare therapeutic antibodies against highly virulent PEDV strains of genotype GII.

[0026] Key material description:

[0027] CH-pcDNA3.4 vector containing the porcine IgG1 heavy chain constant region and CL-pcDNA3.4 vector containing the porcine lambda light chain constant region: Optimized and synthesized by Genewiz Biotechnology Co., Ltd.

[0028] WHLL, HNAY, HNXX strains: All are highly virulent PEDV strains of genotype GII preserved in this laboratory. The NCBI database sequence number of HNXX is MK124712.1; the NCBI database sequence number of HNAY is MK111633.1; the NCBI database sequence number of WHLL is MN037494.1.

[0029] All-porcine monoclonal antibody PC10: Gifted by Teacher Liu Pinghuang from the College of Veterinary Medicine, China Agricultural University.

[0030] Biological materials or reagents not described in the text are all conventional materials in this field or the same materials as those in CN116217714A.

[0031] Example 1 Preparation of PEDV-specific monoclonal antibodies

[0032] 1. Screening of single B cells

[0033] Using the PEDV-S1 protein as a screening antigen, pigs were immunized with a PEDV vaccine. Porcine peripheral blood was collected to isolate PBMCs, and specific B cells recognizing the PEDV-S1 protein were further obtained by flow sorting. The specific screening method was the same as that of B5 (CN116217714A), which is briefly described as follows: porcine anticoagulated blood was collected to isolate peripheral blood mononuclear cells (PBMCs). After staining with biotin-labeled antigen PEDV-S1-biotin, anti-pig IgM-PE-Cy7 antibody, anti-pig IgG-FITC antibody, and anti-pig-CD3-PE antibody, the unbound antigen and antibody were washed away. Then, anti-biotin-APC antibody was used to bind to the antigen PEDV-S1-biotin. After washing, the lymphocyte population that was double negative for anti-pig IgM-PE-Cy7 and anti-pig-CD3-PE was sorted by flow cytometry. Subsequently, antigen-specific B cells that were double positive for anti-pig IgG-FITC and PEDV-S1-APC were further screened.

[0034] In this experiment, multiple antigen-specific single B cells were obtained. The variable region sequences of the heavy and light chains of the B5 antibody were obtained by nested PCR amplification and sequencing of one of the B cells.

[0035] 2. Amplification of monoclonal antibody variable region genes

[0036] Another two specific single B cells obtained in the laboratory were added to a 96-well PCR plate containing 10 μL of lysis buffer (one cell per well). The lysis buffer was reverse transcribed, and primers were designed based on the antibody variable region gene reference sequences in the IMGT database for nested PCR amplification to obtain the antibody variable region genes. The method was the same as that of CN116217714A, which is specifically as follows:

[0037] The amplification of the antibody variable region used nested PCR. First, in the first round, the reverse-transcribed cDNA was used as a template, and H / L-Out-F and H / L-Out-R were used for amplification respectively. In the second round of PCR, the product of the first round of PCR was used as a template, and nested primers H / L-In-F and H / L-In-R were used for amplification. After amplification, the variable region genes of the heavy and light chains of the antibody could be obtained.

[0038] Primers for amplifying the variable region of the heavy chain:

[0039] H-Out-F: GTTTCGGCTGAACTGGGTGGTC;

[0040] H-Out-R: GGTCACTGRCTCGGGGAAGTAGC;

[0041] H-In-F: GGTGGAGTSTGGRGGAGGCCTG;

[0042] H-In-R: CAGGGGGCCAGAGGGTAGACC;

[0043] Primers for amplifying the light chain variable region:

[0044] L-Out-F: ATGGCCTGGACGGTGCTTCTGATC

[0045] L-Out-R: CCTCCAGGTCACSGTCACG

[0046] L-In-F: TCTCAGACTGTGATCCAGGAG

[0047] L-In-R: GTCACTTATTAGACACACCAGGGTG

[0048] The first-round amplification system:

[0049]

[0050] The first-round amplification program: 95°C for 5 min; 95°C for 30 s, 56°C for 50 s, 72°C for 1 min, 34 cycles; 72°C for 10 min.

[0051] The second-round amplification system:

[0052]

[0053] The second-round amplification program: 95°C for 5 min; 95°C for 30 s, 60°C for 50 s, 72°C for 1 min, 35 cycles; 72°C for 10 min.

[0054] The amplified products were sequenced to obtain the heavy chain variable region (VH) gene sequence of antibody C62, encoding the amino acid sequence shown in SEQ ID NO:1; the light chain variable region (VL) gene sequence, encoding the amino acid sequence shown in SEQ ID NO:2. The heavy chain variable region (VH) gene sequence of antibody N19, encoding the amino acid sequence shown in SEQ ID NO:3; the light chain variable region (VL) gene sequence, encoding the amino acid sequence shown in SEQ ID NO:4.

[0055] 3. Construction of complete plasmids for heavy and light chains

[0056] After obtaining the variable region sequences of the heavy and light chains of C62 and N19, they were respectively optimized and synthesized by gene codons, and then the variable region of the heavy chain was inserted into the CH-pcDNA3.4 vector containing the constant region of the porcine IgG1 heavy chain through the NotI and BbvCI restriction sites to construct a vector plasmid expressing the complete heavy chain of the antibody; the variable region of the light chain was inserted into the CL-pcDNA3.4 vector containing the constant region of the porcine lambda light chain through the NotI and AleI to construct a vector plasmid expressing the complete light chain of the antibody. The recombinant expression plasmid was transformed into DH5α competent cells to amplify the plasmid, and the plasmid was extracted using an endotoxin-free plasmid extraction kit, and the operation steps were carried out according to the kit instructions.

[0057] Among them, the amino acid sequence of the constant region of the porcine IgG1 heavy chain (CH) is as shown in SEQ ID NO: 5; the amino acid sequence of the constant region of the porcine lambda light chain (CL) is as shown in SEQ ID NO: 6.

[0058] The nucleotide sequence of the complete heavy chain of the monoclonal antibody C62 is as shown in SEQ ID NO: 7, and the amino acid sequence is as shown in SEQ ID NO: 8; the nucleotide sequence of the complete light chain of the monoclonal antibody C62 is as shown in SEQ ID NO: 9, and the amino acid sequence is as shown in SEQ ID NO: 10. The nucleotide sequence of the complete heavy chain of the monoclonal antibody N19 is as shown in SEQ ID NO: 11, and the amino acid sequence is as shown in SEQ ID NO: 12; the nucleotide sequence of the complete light chain of the monoclonal antibody N19 is as shown in SEQ ID NO: 13, and the amino acid sequence is as shown in SEQ ID NO: 14.

[0059] 4. Antibody expression and purification

[0060] The expression and purification of C62 and N19 were carried out in the same way as that of B5. The complete heavy chain plasmid and the complete light chain plasmid were co-transfected into CHO cells at a ratio of 1:1 to express the antibody and then purified and identified. The specific operations are as follows:

[0061] (1) Cell culture. After counting the CHO cells, they were centrifuged and adjusted to a density of 2×10 7 cells / mL with fresh medium. 10 mL of the cell suspension was transferred to a 125 mL shake flask and then returned to the incubator. After shaking culture for 1 h, it was taken out of the incubator for transfection.

[0062] (2) Cell transfection. Add 85 μg of light chain plasmid and 85 μg of heavy chain plasmid to CHO cells and mix well. Then add 350 μL of transfection reagent (TA-CHO) while mixing. After thorough mixing, place the cells back into the incubator and culture for 6 h. After culturing for 6 h in the incubator, add 20 mL of fresh culture medium to dilute the transfected cells and continue culturing in the incubator. After 24 h of transfection, add 360 μL of KE-CHO (CHO cell protein expression enhancer) and 600 μL of KT-Feed (transient recombinant protein expression plant peptone nutritional additive), and transfer to a 32 °C incubator for low-temperature expression. Supplement 300 μL of glucose on the second day, 600 μL of glucose and 600 μL of KT-Feed on the third day, 600 μL of glucose on the fourth and fifth days respectively, and collect the cell supernatant at 12000 rpm / 30 min on the sixth day.

[0063] (3) Antibody purification and identification. After filtering the expressed supernatant with a 0.22 μm filter, purify the antibody using a pre-packed column of 1 mL Protein A from Huiyan Biotech. The operation is as follows: Assemble the Huiyan Protein A column, first rinse with ultrapure water at a flow rate of 1 mL / min for 5 column volumes, equilibrate with PBS for 20 column volumes, then load the filtered cell supernatant at a flow rate of 0.2 mL / min. After loading, wash with 10 column volumes of PBS at a flow rate of 1 mL / min, and finally elute with elution buffer for 10 column volumes. Wash with ultrapure water for 5 column volumes and store the column with 20% ethanol. Replace the purified antibody into PBS using an ultrafiltration tube and store at -20 °C. Take 40 μL of the antibody, add 10 μL of 5× protein reducing loading buffer, boil the sample at 100 °C for 10 min, and identify the expression by SDS-PAGE protein electrophoresis.

[0064] After protein electrophoresis of the antibody (abbreviated as C62 and N19 in the figure), two bands appeared. One band was around 55 KD, which was the heavy chain, and the other band was around 25 KD, which was the light chain ( Figure 1 ).

[0065] Example 2 Activity Verification of the Whole Porcine Monoclonal Antibody

[0066] 1. ELISA Detection of Antibody Reactivity

[0067] Coat the ELISA plate overnight at 4°C with the purified and expressed PEDV-S1 protein at a concentration of 2 μg / mL; after washing 5 times with PBST, add 5% skim milk powder and block at 37°C for 2 h; after washing 5 times with PBST, add the whole swine-derived antibody diluted in a 2-fold serial dilution and incubate at 37°C for 1.5 h; wash 5 times with PBST, add the anti-swine IgG-HRP antibody diluted 1:5000 and incubate at 37°C for 0.5 h; after washing 5 times with PBST, add the chromogenic solution, incubate at 37°C for 10 min, then add the stop solution, and read the OD630nm value with an ELISA reader.

[0068] The results showed that both antibodies C62 and N19 specifically bound to the PEDV-S1 protein ( Figure 2 ).

[0069] 2. Detection of antibody reactivity by indirect immunofluorescence

[0070] Inoculate different PEDV strains (WHLL, HNAY, HNXX strains) into 24-well plates. When typical syncytia appear in the cells after virus inoculation; wash 3 times with PBS, fix with 4% paraformaldehyde for 10 min; wash 3 times with PBS, add 0.2% Triton X-100 and permeabilize for 10 min; wash 3 times with PBS, add the antibody at 10 μg / mL and incubate at 37°C for 1.5 h; wash 3 times with PBS, add the anti-swine IgG-FITC antibody diluted 1:100 and incubate at 37°C for 0.5 h; wash 3 times with PBS, add DAPI diluted 1:5000; wash 3 times with PBS, add 1 mL PBS, and observe and take pictures with an inverted fluorescence microscope.

[0071] The results showed that antibodies C62 and N19 reacted with the PEDV strains, showing specific green fluorescence ( Figure 3 ).

[0072] 3. Verification of antibody neutralizing activity by neutralization test

[0073] To compare the neutralizing effects of C62, N19, and PC10 on highly virulent strains, we mixed the two-fold serially diluted antibodies (concentrations ranging from 1.95 μg / mL to 500 μg / mL) with an equal volume of 200 TCID50 virus solution and incubated them at 37°C for 1 h. After washing the 96-well cell culture plates three times with PBS and draining them, we transferred 100 μL of the antibody-virus mixture into the 96-well plates. At the same time, virus control groups with 200 TCID50, 20 TCID50, 2 TCID50, and 0.2 TCID50 were set up. Then, 100 μL of DMEM containing 20 μg / mL of trypsin was added, and the plates were placed in an incubator at 37°C for 2 - 3 days to observe the experimental results. The results were expressed as IC50. IC50 represents the half-maximal inhibitory concentration, with the unit of μg / mL. The lower the IC50 value, the stronger the neutralizing ability of the antibody. The IC50 value of 50 μg / mL was used as the critical value for neutralization. Antibodies with IC50 > 50 μg / mL were determined as non-neutralizing active antibodies.

[0074] Table 1 Determination of IC50 for the neutralizing activity of monoclonal antibodies against highly virulent PEDV strains

[0075]

[0076] In the present invention, multiple strains of fully porcine-derived antibodies were expressed through single B cell antibody technology. Three highly reactive antibodies, named B5 (patent applied for), C62, and N19, were further screened by ELISA. By comparing the variable region sequences of these three antibodies, significant differences were found in the hypervariable regions CDR1, CDR2, and CDR3 of the antibodies ( Figure 4 ). Indirect immunofluorescence was used to detect the reactivity of C62 and N19 antibodies with different highly virulent PEDV strains, and specific reactions were found with multiple PEDV strains. To verify the neutralization effects of the two antibodies on highly virulent strains, we used three different GII-type PEDV strains and compared them with B5 and PC10 simultaneously. The results showed that the neutralizing activities of C62 and N19 antibodies against GII-type highly virulent strains were superior to those of the previously reported B5 and PC10. These results indicate that these two neutralizing antibodies can play an important role in the development of biological reagents for the prevention, diagnosis, and treatment of PEDV.

[0077] Appendix: Sequence Listing Description

[0078] SEQ ID NO: 1: Amino acid sequence of the variable region of the heavy chain (VH) of monoclonal antibody C62;

[0079] SEQ ID NO: 2: Amino acid sequence of the variable region of the light chain (VL) of monoclonal antibody C62;

[0080] SEQ ID NO: 3: Amino acid sequence of the variable region of the heavy chain (VH) of monoclonal antibody N19;

[0081] SEQ ID NO: 4: Amino acid sequence of the variable region of the light chain (VL) of monoclonal antibody N19;

[0082] SEQ ID NO: 5: Amino acid sequence of the constant region of the heavy chain (CH) of monoclonal antibody;

[0083] SEQ ID NO: 6: Amino acid sequence of the constant region of the light chain (CL) of monoclonal antibody;

[0084] SEQ ID NO: 7: Nucleotide sequence of the optimized full-length heavy chain of monoclonal antibody C62;

[0085] SEQ ID NO: 8: Amino acid sequence of the full-length heavy chain of monoclonal antibody C62;

[0086] SEQ ID NO: 9: Nucleotide sequence of the optimized full-length light chain of monoclonal antibody C62;

[0087] SEQ ID NO: 10: Amino acid sequence of the full-length light chain of monoclonal antibody C62;

[0088] SEQ ID NO: 11: Nucleotide sequence of the optimized full-length heavy chain of monoclonal antibody N19;

[0089] SEQ ID NO: 12: Amino acid sequence of the full-length heavy chain of monoclonal antibody N19;

[0090] SEQ ID NO: 13: Nucleotide sequence of the optimized full-length light chain of monoclonal antibody N19;

[0091] SEQ ID NO: 14: Amino acid sequence of the full-length light chain of monoclonal antibody N19.

Claims

1. Two porcine epidemic diarrhea virus (PEDV) monoclonal antibodies C62 or N19 of whole porcine origin, characterized in that: The monoclonal antibody comprises a heavy chain, a light chain variable region, a heavy chain constant region and a light chain constant region. The amino acid sequences of the heavy chain variable regions of C62 and N19 are shown in SEQ ID NO: 1 and SEQ ID NO: 3 respectively, and the amino acid sequences of the light chain variable regions of C62 and N19 are shown in SEQ ID NO: 2 and SEQ ID NO: 4 respectively.

2. The two whole porcine origin PEDV monoclonal antibodies C62 or N19 according to claim 1, characterized in that: The heavy chain constant region is of IgG1 type and the light chain constant region is of lambda type.

3. A DNA fragment encoding the two whole porcine origin PEDV monoclonal antibodies C62 or N19 according to claim 1 or 2.

4. The DNA fragment according to claim 3, characterized in that: It includes a DNA fragment encoding the complete heavy chain of the monoclonal antibody and a DNA fragment encoding the complete light chain. The DNA fragments encoding the complete heavy chains of C62 and N19 are shown in SEQ ID NO: 7 and SEQ ID NO: 11 respectively; the DNA fragments encoding the complete light chains of C62 and N19 are shown in SEQ ID NO: 9 and SEQ ID NO: 13 respectively.

5. An expression vector and a host cell containing the DNA fragment according to claim 3.

6. Use of the two whole porcine origin PEDV monoclonal antibodies C62 or N19 according to claim 1 in the preparation of a PEDV detection kit.

7. Use of the two whole porcine origin PEDV monoclonal antibodies C62 or N19 according to claim 1 in the preparation of a PEDV prevention and treatment biological agent.

8. The use according to claim 7, characterized in that: The monoclonal antibody C62 or N19 has neutralizing activity against the PEDV virus, can bind to the PEDV surface antigen, thereby resisting porcine epidemic diarrhea caused by the invasion of the PEDV virus, especially the highly virulent strain of genotype GII.

9. A PEDV detection kit containing the two whole porcine origin PEDV monoclonal antibodies C62 or N19 according to claim 1.

10. A PEDV prevention and treatment biological agent containing the two whole porcine origin PEDV monoclonal antibodies C62 or N19 according to claim 1.

Images