Trichoderma asperellum strain and application thereof

Abstract

The invention relates to a Trichoderma asperellum strain and application thereof, the Trichoderma asperellum strain is named as Trichoderma asperellum TA-1, the Trichoderma asperellum strain is preserved in the China Center for Type Culture Collection (CGTCC), and the preservation number is CGTCC NO.M20232562; the Trichoderma asperellum TA-1 disclosed by the invention has an excellent inhibition effect on the tobacco target leaf spot, and particularly, the inhibition effect on tobacco leaves can be up to 60% or above. The Trichoderma asperellum TA-1 disclosed by the invention has the advantages that the Trichoderma asperellum TA-1 has relatively strong activity of antagonizing pathogenic bacteria of tobacco target leaf spot, is lasting and stable in antibacterial effect, has a huge potential of developing a novel, efficient and broad-spectrum biocontrol bactericide, and has a certain growth promoting effect on plants.

Description

Technical Field

[0001] The invention relates to the technical field of microorganisms, and in particular to a Trichoderma acanthosporium strain and application thereof. Background Art

[0002] Tobacco target spot disease is caused by the standard fusion group AG-3 of Rhizoctonia solani. Tobacco target spot disease can occur from the seedling stage to the maturity of tobacco leaves, infecting both leaves and stems. The infected leaves are initially circular water-soaked spots. If the temperature is high, the humidity is high, and the leaves are moist for a long time, the lesions will expand rapidly to form irregular spots with a diameter of 2-20 cm, with concentric rings, forming chlorotic halo dead spots, and the necrotic part of the lesions is fragile and perforated, resembling the hole left on the target after a bullet is shot, so it is called target spot disease. When the humidity is high, the mycelium of the fungus and the hymenium and basidiospores of the sexual generation are often produced on the edge of the lesions on the lower surface of the leaves. It brings serious economic losses. In recent years, the damage of tobacco target spot disease has become more and more serious year by year.

[0003] The main control methods for tobacco target spot disease include agricultural, chemical and biological control. Agricultural control is cumbersome and costly. Chemical control is widely used, but the problems of pesticide residues and resistance are gradually becoming prominent. When chemical agents are used for control, there will be pesticide residues, which seriously pollute the environment and are harmful to humans and animals. In addition, long-term use of the same chemical pesticide will cause the plants to develop certain resistance, and the control effect will be greatly reduced. Biological control will not pollute the environment, will not harm the health of humans and animals, and can effectively prevent the spread of the disease. Therefore, finding an efficient and safe biological control method has become one of the research hotspots for the prevention and control of tobacco target spot disease in recent years.

[0004] Therefore, how to provide a Trichoderma aspergillus strain and application thereof is a technical problem that those skilled in the art need to solve urgently. Summary of the invention

[0005] The purpose of the present invention is to provide a Trichoderma aspergillus strain and application thereof to solve the above problems.

[0006] The scheme of the present invention is

[0007] A Trichoderma asperellum strain, the Trichoderma asperellum strain is named Trichoderma asperellum TA-1, deposited in China Center for Type Culture Collection on December 14, 2023, with a deposit number of CCTCCNO: M20232562. The deposit address is Wuhan University, Wuhan, China, and the taxonomic name is Trichoderma spp.TA-1.

[0008] As a preferred technical solution, after the strain of Trichoderma TA-1 grows on a PDA plate for 3 days, white flocculent hyphae grow in the PDA plate. After 5 days, green conidia appear in the PDA plate. The color and quantity gradually become darker and increase with the increase of culture time until the entire PDA plate is covered.

[0009] The invention also discloses application of a Trichoderma aculeatus strain in preventing and treating tobacco target spot disease.

[0010] As a preferred technical solution, the Trichoderma asperellum TA-1 bacteria and fermentation liquid have a preventive and therapeutic effect on tobacco target spot pathogens.

[0011] The invention also discloses an application of Trichoderma aculeatus in preparing a microbial preparation for antagonizing tobacco target spot pathogens.

[0012] The invention also discloses a microbial preparation for antagonizing tobacco target spot pathogens. The microbial preparation comprises Trichoderma asperellum TA-1.

[0013] Advantages of the present invention:

[0014] The bacterial body and fermentation liquid of Trichoderma asperellum TA-1 of the present invention have good antagonistic effects on tobacco brown spot disease, pepper white rot, wheat head blight and rice blast, and have excellent inhibitory effects on tobacco target spot disease, especially the inhibitory effect on tobacco leaves can reach more than 60%.

[0015] The Trichoderma asperellum TA-1 of the present invention has strong antagonistic activity against tobacco target spot pathogens, and has a long-lasting and stable antibacterial effect, and has great potential for developing new, efficient, broad-spectrum biocontrol fungicides, and has a certain growth-promoting effect on plants. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on the provided drawings without paying creative work.

[0017] Figure 1This is a diagram showing the results of the confrontation culture between the strain screened from the soil and the tobacco target spot pathogen in Example 1 of the present invention; wherein a is the tobacco target spot pathogen ck, b is the confrontation effect of TA-1, c is the confrontation effect of TA-2, d is the confrontation effect of TA-3, and e is the confrontation effect of TA-4;

[0018] Figure 2 This is a result diagram of the confrontation culture between TA-1 and tobacco target spot disease provided in Example 2 of the present invention; wherein the left side shows the tobacco target spot disease pathogen ck, and the right side shows the antagonistic effect of TA-1 on the tobacco target spot disease pathogen ck;

[0019] Figure 3 This is a graph showing the antibacterial effect of the fermentation liquid of Trichoderma aspergillus TA-1 on tobacco target spot pathogen provided in Example 2 of the present invention; wherein a is the tobacco target spot pathogen ck, b is the inhibitory effect of 10% TA-1 fermentation liquid, c is the inhibitory effect of 15% TA-1 fermentation liquid, and d is the inhibitory effect of 20% TA-1 fermentation liquid;

[0020] Figure 4 The strain morphology of Trichoderma aspergillus TA-1 provided in Example 2 of the present invention;

[0021] Figure 5 It is a phylogenetic tree result diagram of Trichoderma aspergillus TA-1 provided in Example 2 of the present invention;

[0022] Figure 6 is the antagonistic effect of Trichoderma aspergillus TA-1 on the tested pathogens in Example 2 of the present invention; wherein, a is tobacco brown spot pathogen ck, b is the antagonistic effect of TA-1 on tobacco brown spot pathogen, c is pepper white rot ck, d is the antagonistic effect of TA-1 on pepper white rot, e is rice blast pathogen ck, f is the antagonistic effect of TA-1 on rice blast pathogen, g is wheat fusarium ck, and h is the antagonistic effect of TA-1 on wheat fusarium rust;

[0023] Figure 7 This is a light microscopic image of the parasitic effect of Trichoderma aspergillus TA-1 on the sclerotia of tobacco target spot pathogen provided in Example 2 of the present invention; wherein a is the sclerotia ck of tobacco target spot pathogen, b is the parasitic effect of TA-1 on the sclerotia of tobacco target spot pathogen, and the marked part is the spore of TA-1;

[0024] Figure 8 This is an electron microscopic image of the parasitic effect of Trichoderma aspergillus TA-1 on the sclerotia of tobacco target spot pathogen provided in Example 2 of the present invention; wherein a is the sclerotia ck of tobacco target spot pathogen, and b is the destructive effect of TA-1 on the sclerotia of tobacco target spot pathogen, and it can be seen at the marked position that the surface structure of the sclerotia is destroyed;

[0025] Fig. 9This is a graph showing the control effect of Trichoderma aspergillus TA-1 on tobacco target spot in vitro test provided in Example 3 of the present invention; wherein, a is the tobacco target spot in vitro test ck, and b is the in vitro test effect of TA-1 on tobacco target spot. DETAILED DESCRIPTION

[0026] In order to make the technical means, creative features, objectives and effects achieved by the present invention easy to understand, the present invention is further described below in conjunction with specific embodiments.

[0027] Materials, reagents and instruments used in the following examples:

[0028] Rhizosphere soil of tobacco-rice integrated planting areas: Rhizosphere soil of healthy tobacco columns and rice plants were collected from tobacco-rice integrated planting areas in Hunan tobacco-growing areas.

[0029] Tobacco variety: K326

[0030] Rice variety: Nipponbare

[0031] The test strains: tobacco target spot pathogen (Rhizoctonia solani), pepper white rot pathogen (Sclerotium rolfsii), rice blast pathogen (Magnaporthe oryzae), wheat fusarium (Fusarium graminearum) and tobacco brown spot pathogen (Alternaria alternate) were preserved in the Pathology Laboratory of the College of Plant Protection, Hunan Agricultural University.

[0032] Culture medium and reagents

[0033] Potato glucose agar medium: Wash and peel 200g potatoes, boil them in 1L distilled water, filter the potato pieces through gauze, add 20g glucose and 18g agar powder, stir with a glass rod until the drugs are dissolved, then make up to 1L with distilled water and divide into 500ml conical flasks, add 250ml to each bottle, sterilize at 121℃ in a high-pressure steam sterilizer for 30min, and cool for use.

[0034] Potato glucose culture medium: Wash and peel 200g potatoes and boil them in 1L distilled water. Filter the potato pieces through gauze, add 20g glucose, stir with a glass rod until the drug is dissolved, make up to 1L with distilled water, and distribute into 250ml conical flasks, adding 100ml to each bottle. Sterilize in the same way as above.

[0035] Medicament: glucose, agar powder,

[0036] Experimental instruments

[0037] 2L measuring cylinder, glass rod, 15ml centrifuge tube, pipette, disposable culture dish, high pressure steam sterilizer, clean workbench, 28℃ constant temperature box.

[0038] Embodiment 1:

[0039] Rhizosphere soil was collected from diseased fields in tobacco-rice rotation areas such as Changsha, Hengyang, Chenzhou, and Yongzhou in Hunan. On a sterile operating table in the laboratory, 10 g of soil sample was weighed and added to a triangular flask containing 990 mL of sterile water and sterile glass beads. The soil sample was shaken on an oscillator for 30 min to evenly disperse the soil sample in the diluent to make 10 -2 Soil suspension.

[0040] Use a sterile pipette to draw 1 mL of soil suspension and inject it into a test tube containing 9 mL of sterile water. Shake it to make 10 -3 Soil suspension, prepared in the same way as 10 -4 Soil suspension. Prepare a plate with sterilized PDA medium. After the plate cools down, place 10 -4 After smearing the plate, observe the morphology of the fungus and culture it. Invert it in a constant temperature incubator at 28°C and culture it for 5 to 7 days. Observe the growth of the strains, select strains with different morphologies, separate and purify them 3 to 4 times, and then store them at 4°C.

[0041] The obtained strains were selected for confrontation culture with tobacco strong pathogenic bacteria. The test method was: inoculate tobacco target spot pathogen cakes in the center of the PDA plate, and inoculate three obtained biocontrol bacteria cakes at equal distances from it to observe whether there is an antagonistic effect. Figure 1 As shown in Table 1, the strain TA-1 with better inhibitory effect was selected for subsequent experiments.

[0042] Table 1 Inhibition rate of different strains on tobacco target spot

[0043]

[0044] Embodiment 2:

[0045] Taking tobacco target spot as the target, it was cultured against the strain TA-1 in Example 1. The specific steps were: using a 5 mm puncher to punch a bacterial cake on the edge of a PDA plate covered with tobacco target spot, and placing it on one side of a fresh PDA plate; then using the same method to take a fresh bacterial cake of Trichoderma strain TA-1 and place it on the other side of the PDA plate, with the two bacterial cakes 2.5 cm apart.

[0046] The PDA plate inoculated with only the test pathogen cake was used as the control, and each was repeated three times. After culturing at 28°C for 5 days, the growth of the pathogen and strain TA-1 was observed. The diameter of the pathogen hyphae in the control group and the treatment group was measured with a vernier caliper using the cross method and the inhibition rate was calculated. The inhibition rate of strain TA-1 on pathogens was calculated using the following formula.

[0047] Inhibition rate (%) = (control colony diameter - treated colony diameter) / (control colony diameter - bacterial cake diameter) × 100.

[0048] After calculation, strain TA-1 had a significant inhibition rate against both pathogens. After 72 hours of confrontation treatment, the inhibition rates were 49.08% and 55.57%, respectively. Figure 2 , Table 2).

[0049] Table 2: Inhibitory effect of strain TA-1 on tobacco target spot pathogens

[0050]

[0051] Antibacterial rate of TA-1 fermentation broth

[0052] Use a 5mm puncher to punch the bacterial cakes on the edge of the PDA plate covered with strain TA-1, and inoculate them into PDB culture medium. Inoculate 8-10 bacterial cakes into each bottle of culture medium. After 5 days of shaking culture at 28℃ and 120r / min, obtain the TA-1 fermentation liquid, centrifuge at 8000r / min for 15min, aspirate the supernatant, and filter with a 0.22μm bacterial filter to obtain the sterile fermentation liquid of TA-1. Add the sterile fermentation liquid to PDA cooled to about 55℃ at different concentrations of 10%, 15%, and 20%, mix well, and pour the plate. Inoculate the tobacco target spot pathogen into the center of the PDA plate mixed with sterile fermentation liquid. Repeat each treatment 3 times. The plate without sterile fermentation liquid was inoculated with pathogens as a control and cultured at 28℃ for 5d. Observe the mycelial growth morphology and measure the mycelial diameter of the pathogen, and calculate the inhibition rate of different concentrations of fermentation liquid on the pathogen.

[0053] Results Figure 3 ,Table 3,The results show that different concentrations of TA-1 fermentation broth have inhibitory effects on tobacco target spot pathogens, and when the concentration reaches 20%, the inhibitory effect is the best, which is 74.84%.

[0054] Table 3: Inhibitory effect of the fermentation broth of strain TA-1 on two pathogens

[0055]

[0056] Identification of strain TA-1

[0057] Morphological observation

[0058] The isolated and purified TA-1 was inoculated in the center of a 90 mm diameter PDA culture medium and cultured at 28°C for 3 days. The colony morphology and growth rate were observed. Figure 4, refer to the "Handbook of Fungal Identification" for preliminary morphological identification of TA-1. After 3 days of growth, TA-1 grows white flocculent hyphae on the plate, and after 5 days, green conidia appear on the plate. The color and number gradually become darker and increase with the growth of culture time, until the entire plate is covered.

[0059] Molecular identification of TA-1

[0060] Scrape fresh fungal hyphae and extract DNA using the CTAB method, using three pairs of different primers:

[0061] ITS1:TCCGTAGGTGAACCTGCGG

[0062] ITS4:TCCTCCGCTTATTGATATGC;

[0063] CAL-228:GAGTTCAAGGAGGCCTTCTCCC

[0064] CAL-737R:CATCTTTCTGGCCATCATGG; EF1-728F:CATCGAGAAGTTCGAGAAGG

[0065] EF1-986R:TACTTGAAGGAACCCTACC)

[0066] PCR amplification was performed with the following reaction system (25 μL): dd H2O (10.5 μL); Mix (12.5 μL); Primer F (0.5 μL); Primer R (0.5 μL); DNA template (1 μL).

[0067] The reaction procedure was as follows: 94℃ pre-denaturation for 5min; 94℃ denaturation for 30s; 55℃ (ITS) or 52℃ (CAL and EF1) annealing for 45s; 72℃ extension for 1min; 72℃ extension for 10min; 4℃ storage. After the reaction procedure, the PCR product was sent to Shanghai Sangon Biotechnology (Shanghai) Co., Ltd. for sequencing. The obtained sequences were compared by BLAST nucleic acid homology on NCBI. The phylogenetic tree was established using MEGA10.0 to determine the taxonomic status of the strain.

[0068] The ITS, CAL, and EF1 sequences of the strain were amplified by PCR, and the products were subjected to agarose gel electrophoresis. The results showed that the PCR product band sizes were about 606, 502, and 354 bp, respectively. The obtained sequences were compared by BLAST on NCBI, and the results showed that the strain had a high sequence similarity with Trichoderma asperellum.

[0069] The phylogenetic tree of strain TA-1 was constructed with Trichoderma viride, Trichoderma rogersonii, and Trichodermatomentosum as outgroups, respectively. Figure 5 It was found that the strain in the ITS branch was on the same branch as Trichoderma sp., and the strain in the CAL and EF1 branches was on the same branch as Trichoderma asperellum. Therefore, it can be preliminarily determined that the strain is Trichoderma asperellum.

[0070] Patent procedure deposit: The strain is deposited in China Center for Type Culture Collection with the deposit number CCTCCM20232562. The deposit address is Wuhan University, Wuhan, China. The taxonomic name is Trichoderma asperellum TA-1.

[0071] Determination of the Inhibitory Spectrum of Biocontrol Bacteria

[0072] The broad-spectrum antibacterial ability of Trichoderma strains was tested using other pathogens preserved in the laboratory and the mycelial growth was observed. Figure 6 It was found that it had good inhibitory effects on tobacco brown spot disease, pepper white rot, wheat scab and rice blast, with inhibition rates of 65.31%, 58.11%, 61.61% and 64.41% respectively, among which the best inhibitory effect was on tobacco brown spot disease. Table 4 shows that strain TA-1 has a broad spectrum of antibacterial activity.

[0073] Table 4: Antibacterial spectrum of strain TA-1

[0074]

[0075] Determination of the decomposition effect of biocontrol bacteria strains on the sclerotia of tobacco target spot pathogens

[0076] Cultivate tobacco target spot pathogen at 28℃ for 5-7 days, take sclerotia, soak them in 75% alcohol for 30 seconds for surface sterilization, wash them with sterile water for 5-7 times, and place them on a double layer of sterile lens paper, which is placed in a 90mm culture dish. Take a fresh suspension of Trichoderma spores, the spore count of which is higher than 1.0×10 7 / ml, 40μL of spore suspension was added to each sclerotium, and 40μL of double distilled water was added to each sclerotium in the control group, and three replicates were added to each group. The cells were placed in a 28℃ incubator, and the observation period was 0-72h, and the observation was made every 24h.

[0077] Take the sclerotium sample after 72 hours of culture, cut the sclerotium into two halves, and observe the appearance and internal changes of the sclerotium under an insect dissecting microscope and a scanning electron microscope. The processing process of observing the sclerotium under the scanning electron microscope is: fixation, drying, metal spraying, and observation on the machine. The scanning electron microscope is: hitachi SU81003.00kVx1.00k

[0078] Figure 7 ,The results of optical microscopy showed that after 72 h of immersion, the spore suspension of Trichoderma had grown on the surface of sclerotia.

[0079] Figure 8 , The surface and interior of sclerotia were observed by scanning electron microscopy. The tissue on the surface of sclerotia was destroyed and entangled with TA-1 mycelium. The surface of the cell wall of some pathogenic fungi had signs of destruction.

[0080] Embodiment 3:

[0081] Evaluation of the control effect of biocontrol fungus Trichoderma against tobacco target spot in vitro

[0082] Take healthy leaves and place them in a plate. The tobacco variety is K326. Use a 5mm puncher to punch the edge of the PDA plate covered with tobacco target spot to get a bacterial cake and connect it to the leaves. Spray 20ml of sterile fermentation liquid of Trichoderma on each tobacco leaf in the treatment group, and only spray sterile water on the CK group. Place the leaves in a 28℃ greenhouse and moisturize them once every 24 hours. Repeat three times for each group.

[0083] After 5 days, the leaves were taken out to measure the lesion size and take photos for record. Inhibition rate = (CK lesion diameter - treatment group lesion diameter) / CK lesion diameter × 100.

[0084] Table 5: Pot test of strain TA-1 against two pathogens

[0085]

[0086] See Fig. 9 ,Table 5,In vitro experiments showed that TA-1 spore suspension had an inhibitory effect on tobacco target spot disease, and the inhibitory effect on tobacco leaves could reach 63.48%.

[0087] Embodiment 4:

[0088] Evaluation of the growth-promoting effect of biocontrol fungus Trichoderma on tobacco and rice

[0089] On January 15, 2024, healthy tobacco and rice plants were selected for transplantation. The tobacco variety was Yunyan 87 and the rice variety was Nipponbare. Three days after transplantation, 20 ml of TA-1 spore suspension was applied to each pot. The spore concentration of the suspension was 1×10 7spores / ml, 10 plants per group, three replicates, CK only applied water. After 60 days, 7 tobacco seedlings were randomly selected to measure plant height, fresh weight, dry weight, number of leaves, maximum leaf length and width, and stem base diameter, and took photos and recorded them. 7 rice seedlings were measured for plant height, root length, fresh weight and dry weight, and took photos and recorded them.

[0090] The results of tobacco growth promotion are shown in Table 6:

[0091] Table 6: Growth-promoting effect of strain TA-1 on tobacco

[0092]

[0093] The results of rice growth promotion are shown in Table 7:

[0094] Table 7: Effect of strain TA-1 on rice growth promotion

[0095]

[0096] The results of the growth promotion experiment showed that the biomass of tobacco seedlings and rice seedlings treated with TA-1 was higher than that of the group treated with only water, and it is believed that the biocontrol bacteria has a certain growth-promoting effect on plants. The above shows and describes the basic principles, main features and advantages of the present invention. Those skilled in the art should understand that the present invention is not limited to the above embodiments. The above embodiments and descriptions are only illustrative of the principles of the present invention. Without departing from the spirit and scope of the present invention, the present invention may have various changes and improvements, and these changes and improvements all fall within the scope of the present invention to be protected. The scope of protection claimed by the present invention is defined by the attached claims and their equivalents.

Claims

1. A strain of Trichoderma aspergillus, characterized in that: The Trichoderma asperellum strain is named as Trichoderma asperellum TA-1, which is deposited in China Center for Type Culture Collection with a deposit number of CGTCC NO.M20232562.

2. A Trichoderma as claimed in claim 1, characterized in that: After the strain of Trichoderma aculeatus TA-1 grows on the PDA plate for 3 days, white flocculent hyphae grow in the PDA plate. After 5 days, green conidia appear in the PDA plate. The color and quantity gradually become darker and increase with the increase of culture time until the entire PDA plate is covered.

3. Use of the Trichoderma aspergillus strain according to any one of claims 1 or 2 in preventing and controlling tobacco target spot disease.

4. The use of a Trichoderma aspergillus strain in preventing and treating tobacco target spot disease as claimed in claim 3, characterized in that: The bacterial bodies and fermentation liquid of Trichoderma asperellum TA-1 have a preventive and therapeutic effect on tobacco target spot pathogens.

5. Use of the Trichoderma as claimed in any one of claims 1 or 2 in the preparation of a microbial preparation antagonistic to tobacco target spot pathogens.

6. A microbial preparation for antagonizing tobacco target spot pathogens, characterized in that: The microbial preparation includes Trichoderma asperellum TA-1.

Images