Gene for positively regulating Chinese cabbage leaf margin cracking and application thereof

Abstract

The invention discloses a gene BrRCO for forward regulation and control of Chinese cabbage leaf margin cracking and application thereof, and belongs to the field of plant molecular biology and plant genetic engineering. The nucleotide sequence of the gene is as shown in SEQ ID NO. 1, and the coded amino acid sequence is as shown in SEQ ID NO. 2. Through a gene editing means, the BrRCO gene of the leaf-split cabbage is knocked out, and the leaf margin split of the mutant plant disappears; the BrRCO gene is introduced into the round-leaf Chinese cabbage, and the leaf margin of the mutant plant is split and carved. The Chinese cabbage BrRCO gene provided by the invention has a definite function in regulating and controlling leaf margin cleavage of the Chinese cabbage, lays a foundation for further cultivating, screening or constructing leaf cleavage type Chinese cabbage varieties, and provides a theoretical support for molecular breeding and improvement of the adaptability of such crop varieties.

Description

Technical Field

[0001] The invention belongs to the field of plant molecular biology and plant genetic engineering, and particularly relates to a gene for positively regulating cabbage leaf margin fissures and an application thereof. Background Art

[0002] Cabbage crops belong to the genus Brassica in the family Cruciferae. They have rich genetic resources and include many important vegetables and oil crops. They are the crops with the widest distribution area, the largest cultivated area and important economic value in my country.

[0003] Leaves are one of the most important organs of plants. They have functions such as photosynthesis, transpiration, nutrient supply and water transport, which affect the physiological characteristics and even yield of crops. Changes in leaf morphology affect the plant's leaf surface temperature, water use efficiency and photosynthesis intensity. It is an adaptive manifestation of plants to the environment and is formed by long-term natural selection. The split leaf trait helps to effectively utilize light energy through dense planting. Appropriate dense planting is an important measure to increase crop yields. In addition, some studies have also shown that leaf shape is related to plant stress resistance, such as drought resistance, cold resistance and salt tolerance. Therefore, the exploration and functional verification of genes related to leaf margin fissures is not only of great significance for the study of the molecular mechanism of leaf margin fissure formation in cabbage crops, but will also provide a reference for the genetic improvement of leaf margin traits in other related crops.

[0004] In Brassica plants, genetic analysis and gene localization of leaf margin lobation traits have been the focus of research. RCO is a tandem repeat gene of the HD-Zip transcription factor Arabidopsis homologous meristem IDENTITY1 (LMI1), which is homologous to Arabidopsis AT5G03790. It has been shown to regulate the formation of plant compound leaves in model crops Cardamine and Brassica napus. Expression of RCO in Arabidopsis thaliana increases leaf complexity. Analysis of the upstream sequence of RCO shows that a specific enhancer element in RCO changes leaf shape by changing the distal expression of the gene.

[0005] Compared with traditional breeding methods, the biggest advantage of CRISPR / Cas9 editing technology lies in its precision. Traditional breeding often changes species characteristics through hybridization, selection and mutation, but these methods are often time-consuming and labor-intensive and can lead to some unexpected mutations. Gene editing uses precise gene modification to achieve operations such as deletion, replacement or transcriptional regulation of specific genes, thereby achieving precise quality improvement. At the same time, gene editing technology also greatly saves time and reduces costs. By selecting appropriate gene editing tools, the editing time of target genes can be shortened from several years to several months or weeks. Through gene editing technology, cumbersome screening steps are reduced, breeding costs are reduced, and the rapid development of research in the agricultural field is possible. Summary of the invention

[0006] In view of the shortcomings of the prior art, the present invention provides a nucleotide sequence of a gene BrRCO that positively regulates cabbage leaf margin notching and an amino acid sequence encoded by the same, constructs a CRISPR / Cas9 knockout vector of the BrRCO gene, infects wild-type cabbage cotyledons through an Agrobacterium-mediated method, knocks out the gene in the cabbage, and thereby performs functional verification on the cabbage BrRCO gene, proving that the gene plays a positive regulatory role in the formation of cabbage leaf margin notching. The application of the present invention to the gene BrRCO that positively regulates cabbage leaf margin notching can enrich the genetic regulatory network of cabbage crops for leaf margin notching, and provide technical support for molecular breeding and improving the adaptability of such crop varieties.

[0007] To achieve the above object, the technical solution of the present invention is:

[0008] In a first aspect, the present invention provides a gene BrRCO that positively regulates cabbage leaf margin notching, and the nucleotide sequence of the gene BrRCO is shown in SEQ ID NO.1.

[0009] In a second aspect, the present invention provides a protein encoded by the gene BrRCO that positively regulates cabbage leaf margin notching, wherein the amino acid sequence of the protein is shown in SEQ ID NO.2.

[0010] The third aspect of the present invention provides a recombinant plasmid comprising the gene BrRCO.

[0011] In a fourth aspect, the present invention provides a recombinant expression vector comprising the gene BrRCO; or an engineered bacterium or host cell containing the recombinant expression vector.

[0012] In a fifth aspect, the present invention provides the use of the gene BrRCO in positively regulating cabbage leaf margin notching; or in breeding cabbage with notched leaf margins; or in identifying cabbage with notched leaf margins.

[0013] The sixth aspect of the present invention provides the use of the above protein in positively regulating the formation of cabbage leaf margin punctures; or the use of the above protein in breeding cabbage with punctured leaf margins; or the use of the above protein in identifying cabbage with punctured leaf margins.

[0014] In the above technical solution, further, the method for positively regulating the leaf margin fissure of cabbage includes any one of the following (1) or (2):

[0015] (1) making Chinese cabbage contain the aforementioned gene;

[0016] (2) causing Chinese cabbage to express the aforementioned protein.

[0017] The present invention constructs a CRISPR / Cas9 editing vector for a gene BrRCO that positively regulates cabbage leaf margin notching, named CRISPR-BrRCO, and uses the constructed CRISPR / Cas9 knockout vector of the gene BrRCO to infect wild-type cabbage cotyledons through an Agrobacterium-mediated method to knock out the gene in the cabbage, thereby functionally verifying the cabbage BrRCO gene, and proving that the gene plays a positive regulatory role in the formation of cabbage leaf margin notching.

[0018] In the above technical solution, further, the method for breeding Brassica rapa includes any one of the following (1) or (2):

[0019] (1) Overexpression of the aforementioned gene in Brassica rapa;

[0020] (2) Overexpressing the gene expressing the aforementioned protein contained in Brassica rapa.

[0021] In the above technical solution, further, the method for identifying Brassica rapa with split leaf margins comprises any one of the following (1) or (2):

[0022] (1) detecting whether the cabbage contains the aforementioned gene, and if the cabbage contains the aforementioned gene, identifying it as Brassica rapa;

[0023] (2) detecting whether the cabbage contains a gene expressing the aforementioned protein, and if the cabbage contains a gene expressing the aforementioned protein, identifying the cabbage as Brassica rapa.

[0024] In the above technical solution, further, the cabbage is Brassica rapa.

[0025] Compared with the existing technology, the beneficial effect of the present invention is that the present invention proposes for the first time that the BrRCO gene and the protein encoded by it have the function of positively regulating the formation of cabbage leaf margin fissures, laying a foundation for in-depth understanding of the formation mechanism of cabbage leaf margin fissures, and genetic breeding and germplasm resource improvement of cabbage crops. The present invention verifies the transgenic function of the key gene BrRCO of cabbage leaf margin fissures by CRISPR / Cas9 gene editing, and the leaf margin fissures of BrRCO knockout positive plants disappear. Further experimental studies have found that the BrRCO gene positively regulates the cabbage leaf margin fissures, and the BrRCO gene has important application value in screening or cultivating cabbage with leaf margin fissures. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] Figure 1 NIL for leaf margin entire material RcBr The phenotype of the recurrent parent RcBr with leaf margin lobes.

[0027] Figure 2 Fine mapping of the QTL lob10.1 for leaf margin incision in Chinese cabbage; A is the preliminary mapping result of the NIL-F2 population, B is the F2:3 Results of population fine positioning, C is the candidate gene included in the positioning interval, and the target gene BrRCO is marked in red.

[0028] Figure 3 is the map-based cloning result of the coding region sequence of the BrRCO gene; RCO-V3.0 is the reference genome sequence, and P1 is the round-leaf parent NIL RcBr Cloned sequence, P2 is the cloned sequence of the split leaf parent RcBr.

[0029] Figure 4 The results of localization of the BrRCO gene expression in subcellular locations; A is the expression result of the BrRCO gene, and B is the empty positive control of GFP green fluorescent protein. Bars = 20 μm

[0030] Figure 5 This is the genetic transformation process after knocking out the BrRCO gene in split-leaf cabbage; a is co-cultivation, b is resistance screening, c is callus induction, d is subculture, and eh is rooting culture.

[0031] Figure 6 These are the partial positive test results of T0 generation single plants; N is the negative control and P is the positive control.

[0032] Figure 7 Schematic diagram of CRISPR-BrRCO knockout vector and target sequence comparison results of T0 generation single plants; A is a schematic diagram of CRISPPR-BrRCO vector structure, B is a schematic diagram of BrRCO gene structure, the red vertical line indicates the target position, C is the target sequence and T O Generation 1 is the rco-1 mutant type, and D is the mutant rco-1 phenotype.

[0033] Figure 8 Phenotypic identification of T1 generation gene-edited plants; ab is the wild type (RcBr) and ch is the T1 generation mutant plant.

[0034] Fig. 9 This is the target site sequence alignment result of T1 generation gene-edited plants rco-1-1~rco-1-7.

[0035] Fig.10 is the phenotypic identification and qRT-PCR results of overexpressed plants; A is RCO RcBr Phenotypes of overexpressing plants OE-1 and OE-2, B is NIL RcBr As control, the relative expression levels of overexpressing plants. DETAILED DESCRIPTION

[0036] The present invention is described in detail below in conjunction with the examples, but the embodiments of the present invention are not limited thereto. Obviously, the examples described below are only partial embodiments of the present invention. For those skilled in the art, other similar embodiments obtained without creative labor fall within the scope of protection of the present invention. The reagents used in the examples are purchased from the market unless otherwise specified, and the conventional operating methods used are referred to the reference method unless otherwise specified.

[0037] Example 1: Mining of the Brassica rapa BrRCO gene, the specific steps are as follows:

[0038] In order to explore the leaf margin fissure genes of Chinese cabbage, a NIL-F2 population was constructed with the Brassica rapa inbred line RcBr with deeply fissured leaves and the Chinese cabbage high-generation homozygous inbred line 08A061 with entire leaf margins as parents. Figure 1 ), and developed two InDel markers BrID10909 and BrID10233 that are closely linked to the leaf lobes trait (Wang Y, Liu X, Ji X, Zhang L, Liu Y, Lv X, Feng H. Identification and validation of a major QTL controlling the presence / absence of leaf lobes in Brassica rapa L. Euphytica, 2015, 205: 761-771). RcBr The two parents were resequenced three times, and DNA was extracted by CTAB method. The DNA quality was tested by agarose gel electrophoresis, and the qualified ones were sent for resequencing. According to the resequencing results, InDel and SNP markers were developed, and primer polymorphisms were screened by polyacrylamide gel electrophoresis and KASP typing for fine positioning of QTL lob10.1.

[0039] The NIL-F2 population was used as the material. After germination in a 25°C incubator for 24 hours, the seeds were sown in 4×8 plug trays to facilitate later sampling. A total of 700 seeds were sown, and field management was performed during the period. Due to the large number of samples and the fact that gel electrophoresis does not have strict requirements on DNA quality, the modified alkaline boiling method was used to extract sample DNA. The specific operations are as follows:

[0040] (1) Sampling: When the seedlings are in the 2-3 true leaf stage, take young leaves, about 1 cm 2 Size, in a deep well plate, three holes make up one plate, mark the order so that the plants correspond to the samples in the wells;

[0041] (2) Grinding: Add steel beads to a deep-well plate, cover with a plastic cover, place in a -80°C refrigerator for 12 h, and then quickly grind in a high-throughput tissue grinder for 2 min.

[0042] (3) Add 400 μL DNA buffer, invert and mix, and place in a 65°C water bath for 30 min;

[0043] (4) Add 400 μL of isopropanol and mix thoroughly for 5 min;

[0044] (5) Centrifugation: After balancing the two, centrifuge at 3700 r / min for 15 min and discard the supernatant;

[0045] (6) Add 1000 μL of 75% alcohol, balance again, centrifuge at 3700 rpm for 10 min, and discard the supernatant;

[0046] (7) Drying: Remove the plastic cover and place the deep-well plate in a fume hood for 12 h;

[0047] (8) Add 200 μL ddH2O, balance, centrifuge at 3700 rpm for 2 min, place in a 4°C refrigerator, and allow to dissolve for 4 h.

[0048] This method of extracting DNA is convenient and quick, and the bands are clear when used for polyacrylamide gel electrophoresis, but it cannot be used for long-term storage.

[0049] Twenty-two recombinant plants were screened, of which 19 were split-leaf plants. The split-leaf plants were self-pollinated to obtain F 2:3 Segregating populations, combined genotypes and F 2:3 Phenotypic segregation analysis located lob10.1 between markers BrID10909 and WXInDel-48, with a physical distance of 139.7 kb ( Figure 2 A).

[0050] Sowing F 2:3 A population of 5000 plants was collected by deep-well plate sampling after the first true leaf unfolded, and DNA was extracted. The population was subjected to KASP typing using the previously developed SNP primers BraA10-F1, BraA10-F2, and BraA10-R. Round-leaf recombinant plants were selected, and encrypted markers were further developed. Combined with the genotype and phenotypic analysis of the recombinant plants, the candidate interval of QTL lob10.1 was finally determined ( Figure 2 B). This interval contains 9 candidate genes in total. Combined with the functional analysis of homologous genes in Arabidopsis, BrRCO was predicted as the target gene regulating leaf fissure formation in cabbage ( Figure 2 C).

[0051] Example 2 Cloning of BrRCO gene

[0052] The nucleotide sequence (SEQ ID NO.1) of the gene BrRCO that positively regulates cabbage leaf margin fissure in the present invention is as follows:

[0053] atggaatggtcaacgacgagcaatgttgaaaacacgagagttgcttttatgccacttcagtggctggagtctaactcatccaactcgctccaaaacttcagctatgatccttatgcagttttaccaggaaattcgtctacgcccgtccttacgcaaaccggaccggttatttctgtaccggaatcatcagaaaagatcaccaatgcgtgccaatatccaagtaacgacgacgagatgataaagaagaagcagaaactaacgactgaacaattagcttcacttgaacagagttttcaagaagatatcaaacttgattcagacaggaaggtgaagctgtcgaaggagcttcgtctgcagccacgtcaggtagctgtttggttccagaaccgccgtgcacggtggagggtgaagcatctcgaggagtcgtacaactcgctaaggaaagagtacgacgtggtttcaagacagaatcaaatgctacacgatgaggtgatgaatctgagaggtgtaatactaaaagaccatttgatgaagaggcaaatgaatctgaacaacaatcaaatagccggagggagtcaaatttacggtactgcagatcaatataataatccaatgtgtgttgcttcaacttgttggcccccgttatcatcgcaacagccttacccatggtag

[0054] The amino acid sequence (SEQ ID NO.2) of the protein encoded by the gene BrRCO that positively regulates the leaf margin incisions of Chinese cabbage in the present invention is as follows:

[0055] MEWSTTSNVENTRVAFMPLQWLESNSSNSLQNFSYDPYAVLPGNSSTPVLTQTGPVISVPESSEKITNACQYPSNDDEMIKKKQKLTTEQLASLEQSFQEDIKLDSDRKVKLSKELRLQPRQVAVWFQNRRARWRVKHLEESYNSLRKEYDVVSRQNQMLHDEVMNLRGVILKDHLMKRQMNLNNNQIAGGSQIYGTADQYNNPMCVASTCWPPLSSQQPYPW*

[0056] The BrRCO reference genome sequence information was obtained using the Chinese cabbage database (http: / / www.brassicadb.cn / ), and the CDS full-length sequence amplification primers were designed using Premier 5.0: BrRCO (CDS) -F:

[0057] ATGGAATGGTCAACGACGAGC and BrRCO(CDS)-R:TCTCCAAGATCCGAAACACCT. The reverse transcribed cDNA was used as a template and a high-fidelity enzyme was used for PCR amplification. The amplification system is as follows:

[0058]

[0059] The amplification reaction procedure is 95℃ pre-denaturation for 3min; 95℃15sec, 56℃15sec, 72℃1min, 35 cycles; 72℃ extension for 5min, and storage at 4℃. Then, agarose gel electrophoresis is performed to observe the bands. If the target band is clear and single, the PCR products can be directly combined and purified for recovery; if multiple bands appear, 2% agarose gel is re-made for gel recovery. The present invention uses the agarose gel DNA recovery kit provided by Kangwei Century (Kangwei Century, Beijing, China).

[0060] Then, ligation transformation was performed. The present invention used Blunt Simple Cloning Kit (Quanshijin Biotechnology, Beijing, China). 3 μL of PCR gel recovery product and 1 μL of Blunt Simple Cloning Vector were mixed and reacted at room temperature for 15 minutes. The ligation product was stored on ice or at -30°C.

[0061] Transformation: Thaw the competent E. coli Top 10 (Weidi, Shanghai, China) on ice. After the competent cells are thawed, add 5 μL of the ligation product, ice bath for 25 minutes, heat shock at 42℃ for 45 seconds, and ice bath for 2 minutes immediately after the water bath. Then add 200 μL of LB liquid culture medium to the centrifuge tube, and culture at 200 rpm / min at 37℃ for 1 hour. Centrifuge the cultured bacterial solution at 6000 rpm / min for 2 minutes, discard 150 μL of supernatant, flick the suspended bacteria, and evenly apply the bacterial solution on the kanamycin-resistant LB plate, and culture it in a 37℃ incubator for 12 hours. Afterwards, perform a positive test, pick up a single white colony on the plate with a 10 μL pipette tip, and pipette the tip into a 2 ml centrifuge tube containing 1 ml of liquid LB culture medium with kanamycin added in advance. Culture at 200 rpm / min at 37℃ for 12 hours. After the culture was completed, PCR was performed on the bacterial solution using primers BrRCO(CDS)-F:ATGGAATGGTCAACGACGAGC and BrRCO(CDS)-R:

[0062] TCTCCAAGATCCGAAACACCT. Agarose gel electrophoresis was then performed, and the bacterial solution containing the target band (672 bp) was selected for sequencing (Shanghai, China). The CDS sequence of BrRCO is 672 bp in length, with three coding sequences, encoding a total of 223 amino acid sequences. The CDS sequence of the BrRCO gene was compared with the corresponding sequence of the gene in the reference genome downloaded from the Chinese cabbage database (http: / / www.brassicadb.cn / ) (Zhang, L.; Cai, X.; Wu, J.; Liu, M.; Grob, S.; Cheng, F.; Liang, J.; Cai, C.; Liu, Z.; Liu, B.; et al. Improved Brassica rapa reference genome by single-molecule sequencing and chromo-some conformation capture technologies. Hortic Res, 2018, 5:50), and the Sequencher software was used for comparison ( Figure 3 ). Sequence alignment results showed that BrRCO in wild-type RcBr RcBr Compared with the reference genome gene in the database, the gene has a 1 base insertion in the second exon. RcBr The premature termination of translation in the BrRCO gene may cause loss of function. RcBrThe full-length CDS sequence of the gene is used for target selection, as well as the subsequent localization of the expression position of the BrRCO gene in subcellular regions, selection of vectors, and construction of vectors.

[0063] Example 3 Localization of the expression position of gene BrRCO in subcellular

[0064] Subcellular localization vector construction and cloned BrRCO RcBr The full-length coding region plasmid of the gene was digested with BsmBI / Esp3I; then the pBWA(V)HS-ccdb-GLosgfp vector modified from the pCAMBIA1301 vector was digested with BsaI / Eco31I, the vector digestion products and plasmid digestion products were purified using a purification kit, and ligated with T4 ligase; finally, the constructed vector pBWA(V)HS-BrRCO-GLosgfp was sequenced for verification.

[0065] The specific steps of tobacco transient transformation are as follows:

[0066] (1) Evenly sow tobacco seeds in sterile moist matrix soil (the volume ratio of peat: vermiculite: perlite is 3:2:1) and place them in an artificial climate incubator for cultivation. After one month, they can be used for tobacco injection;

[0067] (2) The constructed subcellular localization recombinant plasmid was transformed into Agrobacterium competent GV3101 and cultured in a 30°C incubator for 48 h;

[0068] (3) Scrape the colonies on the solid culture medium and place them in 10 mL of YEB liquid culture medium at 170 rpm / min for 1 h;

[0069] (4) Centrifuge at 4000 rpm / min for 4 min and discard the supernatant;

[0070] (5) Resuspend the cells in 10 mM MgCl2 suspension and measure the OD600 value using a spectrophotometer, and continue to adjust it to about 0.6;

[0071] (6) Inject the Agrobacterium bacterial solution into the tobacco leaves from the lower epidermis using a 1 mL syringe and culture in the dark for 2 days;

[0072] (7) The tobacco leaves were made into glass slides, observed under a laser confocal microscope (Leica, Germany), and photographed and preserved. Figure 4 ). From left to right in the figure are fluorescence channel, nuclear marker channel, chloroplast channel, bright field, and overlay image.

[0073] Figure 4 A is the expression result of gene BrRCO, Figure 4B is the positive control of GFP green fluorescent protein.

[0074] The results showed that the location of the BrRCO gene in tobacco leaves overlapped with the nuclear marker, indicating that the BrRCO gene had the general characteristics of a transcription factor, that is, BrRCO was a nuclear gene.

[0075] Example 4 Construction of CRISPR-BrRCO knockout vector

[0076] Gene target sites were selected using the CRISPR-P (http: / / cbi.hzau.edu.cn / cgi-bin / CRISPR) online tool, and the CRISPR / Cas9 editing vector was constructed according to the method described by Ma et al. (2015) (Ma X, Zhang Q, Zhu Q, Liu W, Chen Y, Qiu R, Wang B, Yang Z, Li H, Lin YA robust CRISPR / Cas9 system for convenient, high-efficiency multiplex genome editing in monocot and dicot plants. Mol Plant, 2015, 8: 1274-1284). The backbone vector used was pYLCRISPR / Cas9 35S-H, which was derived from the research group of Professor Liu Yaoguang of South China Agricultural University (The binary pYLCRIPSR / Cas9 multiplex genome targeting vector system was utilized for gene editing (Ma et al. 2015)). The main steps include: 1) digesting the backbone vector with Bsa I and recovering the backbone fragment; 2) constructing the sgRNA cassette and performing two rounds of nested PCR. The first round of PCR is performed in two reactions, using UF / adapter reverse primer and adaptor forward primer / gR-R respectively; the second round is Overlapping PCR, using position-specific primers to amplify the expression cassette product; the required primers are as follows:

[0077]

[0078] 3) The restriction endonuclease digestion-ligation reaction between the binary vector and the sgRNA expression cassette was performed according to the following table.

[0079]

[0080] The enzyme digestion and ligation were performed using a variable temperature cycle for about 10-15 cycles: 37°C for 5 min; 10°C for 5 min, 20°C for 5 min; and finally 37°C for 5 min.

[0081] The recombinant plasmid was transformed into E. coli Top10 cells, and the specific operation steps were the same as above. The constructed CRISPR-BrRCO recombinant plasmid was sent to Sangon Biotech Co., Ltd. for sequencing, and after the sequence alignment was correct, it was transferred into Agrobacterium for subsequent cabbage genetic transformation.

[0082] Example 5 Genetic transformation of Brassica rapa after knocking out the BrRCO gene

[0083] 1) Seed cleaning: Select full RcBr seeds and place them in a 10 ml centrifuge tube, add an appropriate amount of 75% ethanol, sterilize for 2 minutes, aspirate the ethanol, add an appropriate amount of 50% hypochlorous acid solution, sterilize for 4 minutes, and then wash three times with SDW to ensure that there is no ethanol and hypochlorous acid residue. All the above operations are completed in a clean bench.

[0084] 2) Sowing: The cleaned seeds were transferred to the prepared sowing medium M0, and the sowing medium was kept in a growth room at 23°C with 16 h of light per day for 4 days.

[0085] 3) Shaking: 3 days after sowing, add 4 ml of LB culture medium to a sterilized 10 ml centrifuge tube, then add 15 μL of activated Agrobacterium strain containing CRISPR-BrRCO vector, and add antibiotics, and culture at 200 r / min in a shaker at 28°C for 12 h to 14 h.

[0086] 4) Explant separation: Separate the cotyledon petioles from 4-day-old seedlings. Cut the cotyledons with a sharp scalpel to maximize the length of the petiole extending from the cotyledons and ensure that a single incision is used to separate the two cotyledons.

[0087] 5) Inoculation: Immediately transfer the explants to M1 plates, keeping 10 explants on each plate.

[0088] 6) Co-cultivation: Move to a growth chamber at 23°C, with 16 hours of light per day for 72 hours, transfer to M1-2 medium, and continue culturing under the same growth conditions for 48 hours ( Figure 5 a).

[0089] 7) Bud induction: After 48 h, the explants were transferred to bud induction medium (M2) supplemented with antibiotics ( Figure 5 b) On day 11 after explant isolation, the explants were transferred to shoot elongation selection medium.

[0090] 8) Shoot elongation: After a further 10-14 days of culture, the explants were transferred to fresh shoot elongation selection medium (M3). A small amount of browning between 14 and 21 days is normal ( Figure 5 c,d).

[0091] 9) Rooting: Transgenic shoots can be seen starting from 3 weeks on the selection plate. At this point, transgenic shoots can be isolated into rooting medium (M4). Most transgenic shoots are likely to appear between 21 days and 1 month after inoculation ( Figure 5 eh).

[0092] 10) Planting: After the roots had elongated to approximately 2 cm in length, the plantlets were transferred to sterile peat pots to allow further root growth and then transferred to a greenhouse.

[0093] Example 6 Identification of gene-edited plants

[0094] After obtaining the transgenic seedlings, samples were taken, DNA was extracted, and transgenic positive identification was performed using vector-specific primers ( Figure 6 ) to ensure that the knockout vector was successfully transferred into the cabbage receptor. The vector-specific primers are as follows:

[0095]

[0096]

[0097] The obtained T0 generation transgenic positive plants were further sequenced by Hi-TOM high-throughput sequencing. The specific primers containing the target sites were designed as follows:

[0098]

[0099] The sequencing method was referred to Liu et al. (2019). (Liu Q, Wang C, Jiao X, Zhang H, Song L, Li Y, Gao C, Wang K. Hi-TOM: a platform for high-throughput tracking of mutations induced by CRISPR / Cas systems. Sci China Life Sci, 2019, 62: 1-7). The PCR product was gel-recovered and purified and then sequenced by Annoroad Gene Technology (Beijing) Co., Ltd. Sequence comparison of the two target sites of the BrRCO gene revealed that no plant had base mutations in Target 1, while one plant had base insertions in Target 2. The plant was named rco-1, and the phenotype was observed to reveal that the leaf margin notches of the mutant disappeared ( Figure 7 ).

[0100] rco-1 was self-pollinated to obtain the T1 generation, and Hi-Tom sequencing was performed on 6 T1 generation plants. The results showed that all 6 T1 generation plants had different types of base mutations at the Target 2 target site, and all showed entire leaf margins. Figures 8-9 .

[0101] Example 7: Introduction of BrRCO into Brassica rapa RcBr After the gene was added, the cabbage leaf margin fissures were formed

[0102] Design of adapter primer pair BrRCO RcBr The full length is amplified with high fidelity enzymes, and the amplification procedure is the same as above. Then, perform agarose gel electrophoresis to observe the bands. If the target band is clear and single, the PCR products can be directly merged, purified and recovered; if multiple bands appear, re-make 2% agarose gel and perform gel recovery. Use KpnI / SalI to perform enzyme digestion reaction on the pCAMBIA1300 vector, and purify the vector enzyme digestion product purification kit. The purified enzyme digestion product and gel recovery product are ligated with T4 ligase. The adapter primers are as follows:

[0103]

[0104] The recombinant plasmid was transformed into E. coli Top10 cells, and the specific operation steps were the same as above. The constructed 1300-BrRCO recombinant plasmid was sent to Sangon Biotech Co., Ltd. for sequencing. After the sequence alignment was correct, it was transferred into Agrobacterium for subsequent genetic transformation of cabbage. RcBr As the receptor, the conversion process is the same as above.

[0105] After obtaining transgenic plants, select the individual plants with phenotypic mutation, i.e., those with split leaves ( Fig.10 A), sampling, RNA extraction, and qRT-PCR to identify the expression of BrRCO, the results showed that the expression of this gene was significantly upregulated in the lobed leaf mutant ( Fig.10 B) demonstrated that BrRCO can positively regulate the formation of leaf margin fissures in cabbage.

[0106] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or replace some or all of the technical features therein with equivalents. However, these modifications or replacements do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention.

Claims

1. A method for positively regulating the cabbage leaf margin notching gene BrRCO, characterized in that: The nucleotide sequence of the positively regulating cabbage leaf margin notching gene BrRCO is shown in SEQ ID NO.

1.

2. A protein that positively regulates the cabbage leaf margin notching gene BrRCO, characterized in that: The amino acid sequence of the protein encoded by the positively regulating cabbage leaf margin notching gene BrRCO is shown in SEQ ID NO.

2.

3. A recombinant plasmid comprising the positively regulating cabbage leaf margin notching gene BrRCO as claimed in claim 1.

4. A recombinant expression vector comprising the positively regulating cabbage leaf margin notching gene BrRCO as claimed in claim 1, or an engineered bacterium or host cell containing the recombinant expression vector.

5. Use of the gene BrRCO according to claim 1 in positively regulating cabbage leaf margin notching; or in breeding cabbage with notched leaf margins; or in identifying cabbage with notched leaf margins.

6. Use of the protein according to claim 2 in positively regulating the formation of leaf margin nicks in cabbage; or in breeding cabbage with leaf margin nicks; or in identifying cabbage with leaf margin nicks.

7. The use according to claim 5 or 6, characterized in that: The method for positively regulating the leaf margin fissure of cabbage comprises any one of the following (1) or (2): (1) making Chinese cabbage contain the gene according to claim 1; (2) causing Chinese cabbage to express the protein according to claim 2.

8. The use according to claim 5 or 6, characterized in that: The method for breeding Chinese cabbage with split leaf margins comprises any one of the following (1) or (2): (1) overexpressing the gene of claim 1 contained in Chinese cabbage; (2) Overexpressing a gene that expresses the protein according to claim 2 contained in Chinese cabbage.

9. The use according to claim 5 or 6, characterized in that: The method for identifying Brassica rapa L. comprises any one of the following (1) or (2): (1) detecting whether the cabbage contains the gene described in claim 1, and if the cabbage contains the gene described in claim 1, identifying the cabbage as Brassica rapa; (2) detecting whether the cabbage contains a gene expressing the protein according to claim 2, and if the cabbage contains a gene expressing the protein according to claim 2, identifying the cabbage as Brassica rapa.

10. The use according to claim 5 or 6, characterized in that: The cabbage is Brassica rapa.

Images