Wheat blue light receptor taphot2 gene and application thereof

Abstract

The application discloses a wheat blue light receptor TaPHOT2 gene and application thereof, and belongs to the technical field of genetic engineering.The application studies the function of the wheat blue light receptor TaPHOT2 gene as shown in SEQ ID NO:1 by means of reverse genetics, finds that knocking out the TaPHOT2 gene improves the resistance of wheat to stem rust, and indicates that the TaPHOT2 gene plays a negative regulation role in the resistance of wheat to stem rust.Therefore, the resistance of wheat to stem rust can be improved by knocking out the TaPHOT2 gene through a gene editing method, so as to provide a new material for the cultivation of a stem rust resistant wheat variety.

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering technology and relates to a wheat blue light receptor. TaPHOT2 Genes and their applications. Background Technology

[0002] Wheat is a major food crop, and three types of wheat rust—stripe rust, leaf rust, and stem rust—are important fungal diseases threatening wheat production. Among them, the wheat-specific form of *Striga styracifolium* is the most serious. Puccinia striiformis f. sp tritici, Pst Wheat stripe rust, caused by the fungus *Clarias rubescens*, is one of the most serious fungal diseases affecting wheat production. The frequent outbreaks of stripe rust are fundamentally due to the frequent mutations in the virulence of the stripe rust fungus, making it easy to overcome the resistance of existing varieties, thus leading to large-scale outbreaks. Therefore, creating broad-spectrum, long-lasting resistant materials is an important way to control wheat stripe rust.

[0003] Blue light receptor proteins are an important class of photosensitizing proteins in plant cells, capable of sensing blue light signals in the environment and regulating physiological responses in plants. These include cryptochromes and phototropins, which influence plant growth, development, and photomorphogenesis by modulating light signal transduction pathways. Recent studies have also revealed that blue light receptor proteins play a crucial role in plant immunity. Therefore, researching the function and mechanisms of blue light receptor proteins is of significant practical value for improving plant disease resistance, contributing to the development of new plant protection strategies and crop variety improvement, and enhancing the stability and efficiency of agricultural production. Summary of the Invention

[0004] In view of the above-mentioned prior art, the present invention provides a wheat blue light receptor. TaPHOT2 Gene and its application. Knocking out this gene can improve wheat resistance to stripe rust, and it has important application value in the breeding of wheat varieties resistant to stripe rust.

[0005] In a first aspect, the present invention provides a wheat blue light receptor TaPHOT2 Gene, the wheat blue light receptor TaPHOT2 The nucleotide sequence of the gene is shown in SEQ ID NO: 1.

[0006] Furthermore, the wheat blue light receptor described in this invention TaPHOT2 Gene expression was induced by stripe rust fungus, and the wheat blue light receptor described in this invention was knocked out. TaPHOT2 Genes that enhance wheat's resistance to stripe rust.

[0007] Secondly, the present invention provides a wheat blue light receptor TaPHOT2 protein, wherein the wheat blue light receptor TaPHOT2 protein is derived from the wheat blue light receptor...TaPHOT2 The gene encodes an amino acid sequence as shown in SEQ ID NO: 2.

[0008] Thirdly, the present invention provides a method for cultivating wheat stripe rust resistant plants, wherein the wheat blue light receptor is described herein. TaPHOT2 Genes were used as editing targets; gene editing recombinant vectors targeting the editing targets were constructed to edit the wheat blue light receptors. TaPHOT2 The protein encoded by the gene is not expressed; wheat mutant plants are constructed using the gene-editing recombinant vector; the wheat mutant plants are screened and identified to obtain wheat plants resistant to stripe rust.

[0009] Furthermore, the recombinant vector is selected from CRISPR / Cas9 vectors.

[0010] Furthermore, the nucleotide sequence of the sgRNA target edited by the recombinant vector is shown in SEQ ID NO: 3~4.

[0011] Furthermore, the wheat mutant plant was constructed by transferring the gene-editing recombinant vector into Agrobacterium, and then transfecting wheat with the resulting Agrobacterium.

[0012] Furthermore, the background material for the wheat mutant plant is wild-type wheat Fielder.

[0013] Fourthly, this invention provides a wheat blue light receptor. TaPHOT2 Application of genes and their encoded proteins in the breeding of wheat resistant to stripe rust.

[0014] Furthermore, the wheat blue light receptor provided by this invention TaPHOT2 The application of the gene and its encoded protein in the breeding of wheat resistant to stripe rust involves knocking out the wheat blue light receptor. TaPHOT2 Genes that enhance wheat's resistance to stripe rust.

[0015] Compared with the prior art, the technical solution provided by the present invention has at least the following beneficial effects or advantages:

[0016] (1) This invention, through the application of... TaPHOT2 Analyze gene expression patterns to determine TaPHOT2 The gene is induced to express by stripe rust infection during the interaction between wheat and stripe rust.

[0017] (2) This invention creates TaPHOT2 Gene-edited materials, clearly defining knockout TaPHOT2 Gene-enhanced wheat resistance to stripe rust indicates TaPHOT2 Genes play a negative regulatory role in the wheat's defense response against stripe rust.

[0018] (3) Compared with traditional disease-resistant breeding techniques, plant disease-resistant genetic engineering technology based on molecular biology has opened up new avenues for plant disease-resistant breeding. It has made certain breakthroughs in reproductive isolation and incompatibility between species and distant hybridization, and can efficiently achieve targeted improvement of target traits in a short period of time, providing theoretical guidance for the cultivation of stable genetically resistant materials. Attached Figure Description

[0019] Figure 1 for TaPHOT2 Gene expression profiles in wheat-striped rust interaction. * indicates P < 0.05, ** indicates P < 0.01, incompatible with striped rust CYR23, and compatible with striped rust CYR32.

[0020] Figure 2 for TaPHOT2 Image of gene editing vectors. Target1 and Target2 are... TaPHOT2 Two target sites for the gene; TaU6 is the promoter of sgRNA; Cas9 is the core component of the gene editing system, the Cas9 protein; ZmUbi is the maize ubiquitin promoter that initiates Cas9 expression.

[0021] Figure 3 Genetically modified wheat TaPHOT2 PCR test results for KO. Among them, L1, L2, L3, L4, L5, L6, and L7 are genetically modified wheat. TaPHOT2 KO strains are Line 1, Line 2, Line 3, Line 4, Line 5, Line 6, and Line 7; M stands for DNA Marker.

[0022] Figure 4 Genetically modified wheat TaPHOT2 Detection results of the KO gene editing site. Among them, Target2 is... TaPHOT2 Gene target sequence; WT-2A, WT-2B, and WT-2D are three copy sequence fragments from wild-type wheat Fielder; L8-2A, L8-2B, and L8-2D are mutant plants. TaPHOT2 Three copy sequence fragments from KO-L8, L20-2A, L20-2B, and L20-2D, represent mutant plants. TaPHOT2 Three copy sequence fragments on KO-L20; 1I indicates a 1bp base insertion in the target region.

[0023] Figure 5 Genetically modified wheat TaPHOT2 A schematic diagram showing the phenotypic results of KO inoculation with stripe rust fungus CYR32. Among them, TaPHOT2 KO-L8 and TaPHOT2 KO-L20 is a genetically modified wheat. TaPHOT2 KO,Pst CYR32 is a strain of stripe rust fungus CYR32, and Fielder is a wild-type wheat variety. Detailed Implementation

[0024] The technical solution of the present invention will be described below with reference to embodiments. However, the present invention is not limited to the following embodiments. Unless otherwise specified, the experimental methods and detection methods described in each embodiment are conventional methods; unless otherwise specified, the reagents and materials can be purchased commercially.

[0025] To ensure a complete and unambiguous understanding of the technical solution of this invention, it should be noted that in this invention, the non-slanted font "TaPHOT2" represents the TaPHOT2 protein, and the slanted font "..." represents the TaPHOT2 protein. TaPHOT2 "express TaPHOT2 Genes. Of course, those skilled in the art can clearly and completely understand the meaning of the descriptions of the relevant genes and their encoded proteins based on the present invention.

[0026] Example 1

[0027] This embodiment provides a wheat blue light receptor. TaPHOT2 Gene isolation and cloning.

[0028] Total RNA was extracted from wheat leaves using the Huayueyang Plant RNA Extraction Kit, and cDNA was synthesized using the Thermo Reverse Transcription Kit. The cDNA was then used as a template for gene sequence amplification. The amplified product was validated and sequenced, and the obtained nucleotide sequence is shown in SEQ ID NO: 1, named as follows: TaPHOT2 Wheat blue light receptors TaPHOT2 The amino acid sequence encoded by the gene is shown in SEQ ID NO: 2.

[0029] According to wheat TaPHOT2 Primers for amplifying the target gene were designed using Primer Premier 5.0 software based on the gene sequence. The amplification system for the target gene is shown in Table 1.

[0030] Table 1. Amplification system of target gene

[0031]

[0032] Amplification program: 95 ℃ for 5 min; 95 ℃ for 30 s, 56 ℃ for 30 s, 72 ℃ for 1 min, this process was repeated for 35 cycles; 72 ℃ for 10 min.

[0033] Prepare a 1% agarose gel and examine the PCR products by agarose gel electrophoresis. Cut the gel band corresponding to the size of the target gene under a gel imaging system, place it in a 2 mL centrifuge tube, and recover it using the agarose gel recovery kit according to the instructions provided.

[0034] Example 2

[0035] This embodiment provides a wheat blue light receptor. TaPHOT2 Gene expression induced by stripe rust fungi.

[0036] Stripe rust fungus race CYR32 was inoculated into wild-type wheat Fielder at the two-leaf stage, and samples were collected at 0, 6, 12, 24, 36, 48, and 72 h post-inoculation. The samples were then placed in liquid nitrogen and stored at -80°C.

[0037] Plant leaf samples were removed from a -80 ℃ freezer and ground using a homogenizer. RNA was extracted according to the instructions of the Huayueyang Plant RNA Extraction Kit, and the sample was left to stand for 30 min after the DNA digestion step. 2 μL of the extracted RNA sample was added to 18 μL of DEPC water, and the concentration was determined using a nucleic acid OD detector. After concentration determination, 6× loading buffer was added, and agarose gel electrophoresis was performed to check for degradation. After confirming no degradation, real-time quantitative PCR was used to detect wheat blue light receptors. TaPHOT2 Gene expression induced by stripe rust fungi.

[0038] qRT-PCR using the elongation factor gene TaEF1-α as an internal control and utilizing wheat blue light receptors TaPHOT2 Real-time quantitative PCR was performed using gene-specific primers. The quantitative primers and internal control primers are as follows:

[0039] Quantitative primers:

[0040] Forward primer: TaPHOT2 -qRT-F:CGGAGAACACTGAGATACAAA;

[0041] Reverse primer: TaPHOT2 -qRT-R:TGCCTTCATCGCAAATAA.

[0042] Internal reference primer:

[0043] Forward primer: TaEF1α -F:TGGTGTCATCAAGCCTGGTATGGT;

[0044] Reverse primer: TaEF1α -R:ACTCATGGTGCATCTCAACGGACT.

[0045] Using a reverse transcription kit (Thermo Fisher Scientific), the reverse transcription reagents were prepared according to the reaction system described in Table 2, and reverse transcription was performed according to the PCR program described in Table 3. The product was diluted 10 times with ddH2O and stored at -20 °C for qRT-PCR detection.

[0046] Table 2 Reverse transcription reaction system

[0047]

[0048] Table 3 Reverse Transcription PCR Program Settings

[0049]

[0050] Designed using Primer Premier 5.0 software. TaPHOT2 Specific quantitative primers. The real-time quantitative PCR reaction system is shown in Table 4, and the program settings are shown in Table 5.

[0051] Table 4 qRT-PCR reaction system

[0052]

[0053] Table 5 qRT-PCR program settings

[0054]

[0055] The denaturation-annealing step requires 35 cycles.

[0056] Each of the above reactions was performed in triplicate, and the average Ct value was used. Furthermore, a 2-1 method was employed. –ΔΔCt Relative quantification algorithm. The result is the mean of three independent biological replicates.

[0057] qRT-PCR detection TaPHOT2 The results of gene induction at different time points (0 h, 6 h, 12 h, 24 h, 48 h, and 72 h after infection) in *Fielder* wheat of wild-type wheat inoculated with stripe rust fungus CYR23 (incompatible) and CYR32 (compatible) are as follows: Figure 1 As shown. Whether it's the compatible race CYR32 or the incompatible race CYR23 of stripe rust, within 24 hours after inoculation, compared to uninoculated wild-type wheat Fielder, its... TaPHOT2 The relative expression levels of all genes were reduced. After inoculation with the incompatible race CYR23, up to 48 hours later, TaPHOT2 The relative expression level of the gene continued to decline; however, by 72 hours post-inoculation, TaPHOT2 The relative expression levels of the gene began to rise. In contrast, after inoculation with the compatible race CYR32, TaPHOT2The relative expression level of the gene increased sharply at 48 h; although it decreased at 72 h post-inoculation, TaPHOT2 The relative expression level of the gene decreased, but remained higher than that of uninoculated wild-type wheat Fielder.

[0058] Example 3

[0059] This example provides genetically modified wheat. TaPHOT2 Preparation method of KO.

[0060] 1. Construction of recombinant vectors

[0061] Gene editing target design. Gene editing targets were designed using the CRISPR-P 2.0 gene editing target design website. The selected target was then aligned with the CDS sequence of the target gene to determine its location. Target sgRNA was synthesized using OTC purification. 1×TE (50 μL), 10 μL each of forward and reverse primers, and 30 μL of ddH2O were added to a PCR tube and mixed thoroughly. The mixture was incubated in a water bath at 100 °C for 5 min. After the reaction, the mixture was allowed to cool naturally to room temperature and stored at -20 °C for later use.

[0062] The intermediate vector was digested with BtgZI restriction endonuclease. 3 μL of 10×Cut SmartBuffer, 2 μL of pENTR:gRNA (SgA+Vector), and 2 μg of BtgZI were added, and the volume was brought to 5 μL with ddH2O. Digestion was carried out at 60 ℃ for 4 h to obtain the linearized pENTR:sgRNA vector. After the intermediate vector was digested with enzymes, the intermediate vector was ligated. The ligation system consisted of 4 μL Annealed oligo duplex (sgRNA2), 2 μL Linearized pENTR:gRNA (linearized vector), 1 μL 10×T4 Buffer, and 1 μL T4 DNA ligase. The volume was brought up to 10 μL with ddH2O and ligated overnight at 16°C. The ligation was then performed by transformation into DH5α, plated with Amp antibody, and positive bacterial plaques were picked, cultured, and sequenced (sequencing primers were ENTR4-R:TGGGTCTAGATATCTCGAGTG). The sequencing results were compared and returned to the positive bacterial solution, and the plasmid was extracted.

[0063] The intermediate vector was digested with Bsal restriction endonuclease. 3 μL of 10×Cut Smart Buffer, 2 μg pENTR:gRNA (SgA+Vector), and 2 μL of Bsal were added, and the volume was brought to 5 μL with ddH2O. Digestion was carried out at 37 ℃ for 4 h to obtain the linearized vector pENTR:sgRNA. After digestion, the intermediate vector was ligated. The ligation system consisted of 4 μL Annealed oligo duplex (sgRNA1), 2 μL Linearized pENTR:gRNA (linearized vector), 1 μL 10×T4 Buffer, and 1 μL T4 DNA ligase. The volume was brought to 10 μL with ddH2O and ligated overnight at 16 ℃. The ligation was then performed on DH5α cells, plated with Amp antibody, and positive bacterial plaques were picked, cultured, and sequenced (sequencing primers: ENTR4-F:GCGTTTCTACAACTCTTCCTG). Sequencing results were compared, and positive bacterial cultures were returned for plasmid extraction.

[0064] The intermediate vector plasmid was constructed into the final vector Cas9-PCL1 using the LR reaction. 1.5 μL of SgA+Vector, 1 ng of the final Cas9 vector, 0.5 μL of LR Clonase TMII enzyme, and 1×TE were added to bring the volume to 2.5 μL. Ligation was performed overnight at 25 °C. The mixture was transformed into DH5α, plated for Kans resistant assay, and positive plaques were picked. PCR amplification and detection were performed (NOS-F: AAGCACATACGTCAGAAACCATTAT; NOS-R: TGGGTGAGATTCCTTGAAGTTGAGTA). Annealing and extension were performed at 58 °C for 1 min. The PCR product was directly sequenced, and the sequencing results were compared. Positive plaques were picked, cultured, and the plasmid was extracted. Wheat gene-editing materials were created using the Agrobacterium infection method. The gene-editing plaque ligated to the final vector was transformed into Agrobacterium strain EHA105. PCR detection of positive plaques was used for transgenic analysis.

[0065] like Figure 2 As shown, using Target1 and Target2 for targeting TaPHOT2 Genes, to achieve TaPHOT2 Gene knockout. Specifically, the TaU6 promoter is used to transcribe sgRNA1 and sgRNA2, which match Target1 and Target2. The Cas9 protein, as the core component of the gene editing system, precisely locates the sgRNA1 and sgRNA2 transcribed from TaU6 upon receiving them. TaPHOT2 Knockout of Target1 and Target2 gene targets TaPHOT2In addition, the maize ubiquitin promoter ZmUbi possesses strong transcriptional activation capabilities, ensuring sufficient expression levels of the Cas9 protein in plant cells, thereby effectively supporting the gene editing process. The sequence of sgRNA2 is GTGTCGCTCATCCGCTACGA (SEQ ID NO: 3); the sequence of sgRNA1 is ACTCTCGGAGAACACTGAGA (SEQ ID NO: 4).

[0066] 2. Obtaining genetically modified wheat

[0067] Take 100 μL of Agrobacterium competent cells EHA105 and place them on ice until completely thawed. Add the constructed TaPHOT2-PCL1-Cas9 vector to the Agrobacterium competent cells and gently shake to mix thoroughly. Preheat the water bath to 37°C and perform transformation as follows: incubate on ice for 5 min; incubate in liquid nitrogen for 5 min; incubate in a 37°C water bath for 5 min; incubate on ice for 5 min. Add 800 μL of antibiotic-free LB liquid medium, mix gently, and incubate at 28°C and 160 rpm for 2–3 h with shaking; then incubate at 5000 rpm for 5 min and collect the cells. Discard the supernatant in an ultra-clean workbench, reserving approximately 100 μL of supernatant. Transfer this supernatant to a petri dish containing Kan (50 mg / L) and Rif (25 mg / L), spread evenly, and let stand for 2–3 minutes to air dry. Seal the petri dish with sealing film and invert it in a 28 ℃ incubator for 2–3 days in the dark. Using Agrobacterium-mediated genetic transformation, the recombinant vector TaPHOT2-PCL1-Cas9 was transformed into wheat callus tissue to obtain transgenic wheat. TaPHOT2 KO.

[0068] 3. PCR verification

[0069] Extracts of transgenic wheat using the CTAB method TaPHOT2 Genomic DNA of KO and control wheat (Fielder).

[0070] Stripe rust physiological race CYR32 was inoculated into transgenic wheat. TaPHOT2After inoculation identification of KO and control wheat at the two-leaf stage, appropriate leaf samples were collected from gene-specific lines and placed in 2.0 mL centrifuge tubes. After labeling, the samples were quickly placed in liquid nitrogen. The samples were then homogenized using a homogenizer, with 1-2 steel balls added to each sample before homogenization. Homogenization took 30-60 seconds, and the samples were immediately placed on ice. 800 μL of preheated CTAB (containing 0.2% thiol reducing agent) was added to each sample, and the mixture was vigorously shaken and placed in a 65 °C water bath for 1 h. The samples were then removed and placed on ice to cool to room temperature. 800 μL of DNA extraction buffer was added and mixed thoroughly. The mixture was shaken vigorously for 5 min, allowed to stand for 3 min, and then centrifuged at 12000 rpm for 10 min. The supernatant was transferred to a 2.0 mL centrifuge tube, and chloroform (supernatant:chloroform = 1:1, v / v) was added. The mixture was then allowed to stand for 2 min and centrifuged at 12000 rpm for 10 min. Transfer the supernatant to a 1.5 mL centrifuge tube, add pre-cooled isopropanol and sodium acetate (supernatant; isopropanol; sodium acetate = 10:10:1, v / v), mix gently to obtain DNA precipitate, and then store overnight in a -20 ℃ ultra-low temperature freezer.

[0071] Centrifuge at 12000 rpm for 10 min, discard the supernatant, add 500 μL of 75% ethanol, and resuspend and wash the DNA precipitate. Centrifuge at 12000 rpm for 5 min, discard the supernatant, add 500 μL of anhydrous ethanol, and resuspend and wash the DNA precipitate. Centrifuge at 12000 rpm for 5 min, discard the supernatant, and let stand at room temperature for 10–30 min (to allow the anhydrous ethanol to evaporate completely). Add 100 μL of preheated sterile ddH2O to the DNA precipitate and dissolve it completely. Take 1–5 μL of DNA sample, add loading buffer according to the ratio, mix thoroughly, and perform agarose gel electrophoresis (1% agarose gel, 160 V, 20 min) to detect the presence of tailing and degradation in the extracted DNA sample. After confirming the absence of tailing and degradation, take 1 μL of DNA sample and use a Nanodrop 2000 spectrophotometer to detect the concentration and mass of the DNA. If the measured OD... 260nm / 280nm Values ​​between 1.8 and 2.0 indicate OD. 260nm / 230nm A value greater than 2.0 indicates good DNA sample purity. DNA samples with verified concentration and quality should be stored in an ultra-low temperature freezer at -20°C.

[0072] Primers were designed using Primer5 software to detect the Cas9 element in the extracted DNA samples, determining whether the Cas9 element was successfully introduced into the wheat mutant material. The reaction samples and reagents were added sequentially to the PCR tubes according to the reaction system described in Table 6.

[0073] Table 6 PCR Reaction System

[0074]

[0075] Add the above samples and reagents to the PCR tubes in sequence, centrifuge briefly to mix, and then set the PCR reaction program as shown in Table 7:

[0076] Table 7 PCR reaction procedure

[0077]

[0078] The reaction consisted of 35 denaturation-annealing-extension cycles. After the reaction was complete, 5-10 μL of PCR product was taken for agarose gel electrophoresis (1% agarose gel, 160 V, 20 min). The gel running was observed using a gel imaging system. If the band size matched the target location, the remaining PCR product was sent to a biotechnology company for sequencing. The results were then analyzed to determine the editing status.

[0079] Figure 3 Genetically modified wheat TaPHOT2 KO PCR validation results. M: DL2000 DNA Marker, with 2000bp, 1000bp, 750bp, 500bp, 250bp, and 100bp; L1, L2, L3, L4, L5, L6, and L7 are respectively... TaPHOT2 The amplification product of DNA from the T2 generation plants; the amplification length is 710 bp.

[0080] 4. Detection of gene editing sites in transgenic wheat

[0081] Based on the gene sequence and target sgRNA sequence, specific detection primers were designed using Primer5 software. Using extracted DNA samples as templates, gene editing at the ABD site in wheat mutant materials was detected. The PCR reaction system, reaction procedure, and agarose gel electrophoresis detection are shown in Tables 6 and 7. If the band size matched the target location, the remaining PCR products were sent to a biotechnology company for Hi-Tom deep sequencing. The sequencing results were analyzed to determine the editing status, and fully edited positive mutant materials were screened.

[0082] Figure 4 Genetically modified wheat TaPHOT2 The detection results of KO editing sites, Target2 is TaPHOT2 Gene target sequence; WT-2A, WT-2B, and WT-2D are three copy sequence fragments from wild-type wheat Fielder; L8-2A, L8-2B, and L8-2D are transgenic wheat. TaPHOT2The three copy sequence fragments on KO-L8, L20-2A, L20-2B, and L20-2D, represent transgenic wheat. TaPHOT2 Three copy sequence fragments on KO-L20; the mutation type is 1I, indicating a 1bp base insertion in the target region.

[0083] Example 4

[0084] This example provides genetically modified wheat. TaPHOT2 KO resistance analysis.

[0085] Identification by artificial inoculation during the seedling stage TaPHOT2 Resistance of gene-edited plants to stripe rust fungus, where the target gene... TaPHOT2 The amplification primers are as follows:

[0086] Forward primer: TaPHOT2 -ORF-F: ATGGCGGGCGCGGGC;

[0087] Reverse primer: TaPHOT2 -ORF-R:AAATGTATCGATAACACCTTCCTCG.

[0088] Artificial inoculation identification during the seedling stage was mainly conducted in the culture room of the State Key Laboratory of Arid Zone Crop Stress Biology at Northwest A&F University and the Southeast Warehouse. Four lines of wheat mutant material were selected, with 6-10 plump seeds from each line, and they were numbered; the wild-type Fielder wheat variety was used as a control. Before planting, the seeds were soaked in 0.2% hydrogen peroxide solution for 18-24 hours to promote germination. After the seeds showed signs of germination, they were transplanted into 10×10 cm plastic pots, planted separately by line, with one line of one gene planted in each pot, and the numbers were recorded. They were then placed in a culture room at 16 ℃ with a 16 / 8 light-dark cycle for 12-14 days. During planting, the seeds were arranged as evenly and dispersed as possible to facilitate subsequent inoculation identification. When the wheat mutant material grew to the two-leaf stage, stripe rust fungus CYR32 was inoculated on the fully expanded two leaves. Before inoculation, the leaves to be inoculated were marked. Fresh stripe rust fungus CYR32 urediniospores were poured into electronic incubation solution and gently mixed to prepare a spore suspension of 4 mg / mL. 20–30 μL of the spore suspension was pipetted and slowly and evenly spread onto the inoculated leaves. After inoculation, a small amount of water was sprayed onto the wheat leaves, and the inoculated wheat seedlings were placed in an incubator at 14 ℃ and 100% relative humidity in the dark and humidified environment. After 24 hours, the seedlings were removed and transferred to a culture room at 16 ℃ with a 16 / 8 light / dark cycle for further cultivation. During cultivation, a small amount of water could be sprayed daily to maintain humidity. Approximately 14 days after inoculation, when the wild-type Fielder showed full disease development (the percentage of lesions on the leaves reaching more than 80% of the total leaf area), the disease development of inoculated leaves of other mutant materials was observed. Disease development was recorded by photographing the different strains, and their reactive types were identified according to the selected grading criteria.

[0089] Using L8 and L20 lines as test plants and wild-type Fielder wheat plants as controls, stripe rust resistance was assessed in the test plants. (Transgenic wheat) TaPHOT2 KO-L8 and TaPHOT2 The phenotypic results of KO-L20 after inoculation with stripe rust virus race CYR3214 days are as follows: Figure 5 As shown, wild-type Fielder wheat plants produce a large number of spores on the surface of their leaves, while genetically modified wheat... TaPHOT2 KO-L8 and TaPHOT2 KO-L20 leaves produce almost no spores, indicating that it is a genetically modified wheat. TaPHOT2 KO-L8 and TaPHOT2 KO-L20 exhibits resistance to the stripe rust virus race CYR32. These results indicate that knocking out... TaPHOT2 Genes help improve wheat's resistance to stripe rust.

[0090] The embodiments described above are some, but not all, of the embodiments of the present invention. The detailed description of the embodiments of the present invention is not intended to limit the scope of the claimed invention, but merely to illustrate selected embodiments of the invention. All other embodiments obtained by those skilled in the art through related deductions and substitutions based on the inventive concept, without inventive effort, are within the scope of protection of the present invention.

Claims

1. A method for cultivating wheat stripe rust resistant plants, characterized in that, wheat blue light receptor TaPHOT2 Genes were used as editing targets; gene editing recombinant vectors targeting the editing targets were constructed to edit the wheat blue light receptors. TaPHOT2 The protein encoded by the gene is not expressed; Wheat mutant plants were constructed using the gene-editing recombinant vector described above; The wheat mutant plants were screened and identified to obtain wheat plants resistant to stripe rust; wheat blue light receptor TaPHOT2 The nucleotide sequence of the gene is shown in SEQ ID NO:

1.

2. The method according to claim 1, characterized in that, The recombinant vector is selected from CRISPR / Cas9 vectors.

3. The method according to claim 1, characterized in that, The sgRNA edited by the recombinant vector consists of sgRNA1 and sgRNA2, the nucleotide sequence of sgRNA1 is shown in SEQ ID NO:3, and the nucleotide sequence of sgRNA2 is shown in SEQ ID NO:

4.

4. The method according to claim 1, characterized in that, The wheat mutant plant was constructed by transferring the gene-editing recombinant vector into Agrobacterium, and then transfecting wheat with the resulting Agrobacterium.

5. The method according to claim 1, characterized in that, The background material for the wheat mutant plants was wild-type wheat Fielder.

6. Wheat blue light receptors TaPHOT2 The application of genes in the breeding of wheat resistant to stripe rust is characterized by, Knockout of wheat blue light receptors TaPHOT2 Genes that enhance wheat's resistance to stripe rust; wheat blue light receptor TaPHOT2 The nucleotide sequence of the gene is shown in SEQ ID NO: 1.

Images