Use of dspckA gene in regulating pathogenicity of D. segeticola and as a fungicide target
By regulating the pathogenicity and ningnanmycin sensitivity of D. segeticola through the DspckA gene, a DspckA gene knockout mutant was constructed. The DspckA protein was used as a drug target to screen for fungicides, which solved the problem of unclear pathogenic mechanism of D. segeticola and achieved effective control of plant diseases.
Patent Information
- Application Number
- CN202411339082.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-09-25
- Publication Date
- 2026-02-13
- Estimated Expiration
- 2044-09-25
AI Technical Summary
The existing technology does not understand the pathogenic and infection mechanisms of Didymella segeticola, which limits the development and application of fungicides. There is a lack of effective models for regulating the pathogenicity of pathogens and screening fungicide targets.
By identifying and utilizing the DspckA gene, the pathogenicity and sensitivity to ningnanmycin of D. segeticola were regulated. A DspckA gene knockout mutant was constructed to reduce its pathogenicity and sensitivity. The expression of the DspckA gene was knocked out or inhibited in D. segeticola through homologous recombination. The DspckA protein was used as a drug target to screen for bactericides. Ningnanmycin binds to the DspckA protein to inhibit the harm of the pathogen.
Significantly reducing the pathogenicity of D. segeticola and its sensitivity to ningnanmycin provides a new approach for fungicide target screening and enhances the control effect on plant diseases.
Smart Images

Figure CN119220567B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application belongs to the field of biotechnology, and particularly relates to the application of DspckA gene in regulating the pathogenicity of D. segregicola and as a fungicide target. BACKGROUND
[0002] Didymella is a genus of Ascomycota Dothideomycetes Pleosporales Didymellaceae. The fungi of this genus have certain pathogenicity to some plants. Didymella segeticola is a plant pathogen in this genus, which can cause various plant diseases, especially can cause harm to various economic crops and other important plant species, causing huge economic losses. For example, it can cause Zanthoxylum bungeanum leaf spot disease (Yang, J. Z., Chen, C. X., et al. Didymella segeticola is a new pathogen causing leaf spot disease on Zanthoxylum bungeanum. New Zealand Journal of Crop and Horticultural Science, 2022, 51: 694-703), tobacco leaf spot disease (Guo, Z. N., Xie, H. L., et al. Leaf spot caused by Didymella segeticola on tobacco in China. Plant Disease, 2019, 104: 1559-1560), and tea leaf spot disease (Deng, X. Y., Yang, J., et al. Characteristics of leaf spot disease caused by Didymella species and the influence of infection on tea quality. Phytopathology, 2023, 113: 516-527). D. segregicola strain GZSQ-4 (China General Microbiological Culture Collection Center, strain preservation number CGMCC 3.20152) was isolated and identified from tea leaf spot disease in Shiqian County, Guizhou Province by the research group of the present inventors. This pathogen can infect tea tree shoots, tender leaves and mature leaves, and has a serious impact on the quality and yield of tea.
[0003] However, the pathogenic biology of D. segiticola is still weak, especially the lack of pathogenic mechanism and host defense response mechanism.Although there are some studies on the pathogen D. segeticola and some fungicides such as zhongshengmycin, shenqinmycin, griseofulvin, and carvacrol have been screened to prevent and control D. segeticola in production (Ren, Y. F., Li, D. X., et al. Integration of transcriptomic and proteomic data reveals the possible action mechanism of the antimicrobial zhongshengmycin against Didymella segeticola, the causal agent of tea leaf spot. Phytopathology, 2021, 111: 2238-2249; Zhao, X. Z., Chen, Z., et al. Investigating the antifungal activity and mechanism of a microbial pesticide shenqinmycin against Phoma sp. Pesticide Biochemistry and Physiology, 2018, 147: 46-50; Huang, H. K., Li, D. X., et al. Integrated transcriptome and proteome analysis reveals that the antimicrobial griseofulvin targets Didymella segeticola beta-tubulin to control tea leaf spot. Phytopathology, 2023, 113: 194-205; Yin, J. Y., Wu, S., et al. In addition to damaging the plasma membrane, phenolic monoterpenoid carvacrol can bind to minor groove of DNA of Phytopathogenic fungi to potentially control tea leaf spot caused by Lasiodiplodia theobromae. Phytopathology, 2023, 114: 700-716).However, the pathogenic mechanism and infection mechanism of D. segiticola are unclear, which limits the development and application of fungicides, so it is very important to construct a D. segiticola insecticide target screening model and study the mechanism of fungicides.
[0004] Phosphoenolpyruvate carboxykinase gene family widely exists in various organisms, including bacteria, protozoa and yeast. Some play a role in gluconeogenesis, especially in organisms in which fatty acids are the main carbon source (Liu, K., Yu, J., Russell, D.G. pckA-deficient Mycobacterium bovis BCG shows attenuated virulence in mice and in macrophages. Microbiology, 2003, 149, 1829-1835). Some catalyze the conversion of oxaloacetate to phosphoenolpyruvate, which is the first step in the gluconeogenesis pathway and is a key link between the tricarboxylic acid cycle and the glycolysis pathway. The present application obtains a phosphoenolpyruvate carboxykinase family gene (named DspckA) from D. segiticola, which is related to the pathogenicity of D. segiticola, and provides important data for understanding the pathogenic mechanism of D. segiticola, preventing and controlling the disease caused by D. segiticola, and breeding plant disease-resistant varieties. SUMMARY
[0005] Therefore, the present application provides a phosphoenolpyruvate carboxykinase family gene, which is derived from D. segiticola and is named DspckA in the present application. The nucleotide sequence of the gene is as shown in SEQ ID NO. 1 or SEQ ID NO. 2, and the encoded amino acid sequence is as shown in SEQ ID NO. 3. The gene can solve the problem of preventing and controlling the pathogenic bacteria D. segiticola. Therefore, the purposes of the present application are specifically:
[0006] In a first aspect, the present application provides the application of DspckA gene in regulating the pathogenicity of D. segiticola, or the sensitivity to ningnanmycin, or designing and screening antifungal drugs.
[0007] Further, the regulation of the pathogenicity of D. segiticola and the sensitivity to ningnanmycin is to reduce. For example, after knocking out the DspckA gene in D. segiticola, the pathogenicity of D. segiticola is reduced, and the sensitivity to ningnanmycin is also reduced.
[0008] In the second aspect, the application provides an application of the DspckA gene in cultivating the transgenic D. segetalis with reduced pathogenicity and / or sensitivity to ningnanmycin. For example, the transgenic D. segetalis with reduced pathogenicity and sensitivity to ningnanmycin can be obtained by constructing a knock-out mutant of the DspckA gene.
[0009] In the third aspect, the application provides a method for cultivating the transgenic D. segetalis with reduced pathogenicity and / or sensitivity to ningnanmycin, which comprises the step of reducing the expression amount or / and activity of the mRNA or protein of the DspckA gene in the recipient D. segetalis to obtain the transgenic D. segetalis.
[0010] Further, the reduction of the expression amount or / and activity of the mRNA or protein of the DspckA gene is achieved by knocking out or inhibiting or silencing the expression of the DspckA gene in the recipient D. segetalis. For example, the DspckA gene in the recipient D. segetalis is knocked out by introducing a homologous recombination fragment for homologous recombination into the protoplast of the recipient.
[0011] In the fourth aspect, the application provides an application of the above method in preventing and treating the disease caused by D. segetalis. After the expression amount or / and activity of the mRNA or protein of the DspckA gene in the recipient D. segetalis is reduced, the pathogenicity of D. segetalis is reduced, thereby preventing and treating the disease caused by D. segetalis.
[0012] In the fifth aspect, the application provides an application of the DspckA protein as a drug target in screening fungicides. The DspckA protein is encoded by the DspckA gene.
[0013] Further, the amino acids at positions T264, T265 and E306 in the DspckA protein are used as a drug target to screen fungicides.
[0014] In the sixth aspect, the application provides an application of ningnanmycin as a fungicide component in preventing and treating the disease caused by D. segetalis. Ningnanmycin interacts with the DspckA protein, and the two have strong binding affinity. The binding of ningnanmycin and the DspckA protein changes the structure of the DspckA protein, reduces the activity of the DspckA protein or inhibits the activity of the DspckA protein, thereby inhibiting the damage of the pathogenic bacteria to the plants.
[0015] In the seventh aspect, the application provides an application of ningnanmycin in regulating the structure or activity of the DspckA protein.
[0016] The application provides application of a phosphoenolpyruvate carboxykinase family gene DspckA derived from D.segeticola in regulating pathogenicity and sensitivity of D.segeticola to ningnanmycin. After knocking out the DspckA gene in wild type D.segeticola, it is found that the pathogenicity and sensitivity of the knocked out D.segeticola to ningnanmycin are significantly reduced. The DspckA protein encoded by the DspckA gene can be used as a drug target for screening fungicides, and has interaction with ningnanmycin, a fungicide ingredient, and the two have strong binding affinity. The combination of ningnanmycin and the DspckA protein can change the structure of the DspckA protein, reduce the activity or inhibit the DspckA protein, so as to inhibit the harm of pathogenic bacteria to plants. Therefore, the DspckA can be used as a fungicide target and a key protein in the pathogenic mechanism of diseases, and the amino acids at positions T264, T265 and E306 are key binding sites, and have wide application prospects in the prevention and treatment of plant pathogenic fungal diseases. BRIEF DESCRIPTION OF DRAWINGS
[0017] Figure 1 It is a schematic diagram of DspckA gene knockout and mutant screening strategy of D.segeticola in the application;
[0018] Figure 2 It is a map of plasmid pCT74 in the application;
[0019] Figure 3 It is a PCR electrophoresis map in the knockout detection in the application;
[0020] Figure 4 It is a pathogenicity determination result of mycelium of wild type D.segeticola and ΔDspckA mutant on tea in the application;
[0021] Figure 5 It is a sensitivity colony map of wild type D.segeticola and ΔDspckA mutant to ningnanmycin in the application;
[0022] Figure 6 It is an inhibition rate analysis map of ningnanmycin on wild type D.segeticola and ΔDspckA mutant in the application;
[0023] Figure 7 It is a result map of interaction between DspckA and ningnanmycin analyzed by molecular docking technology in the application;
[0024] Figure 8 It is a schematic diagram of CDS sequence point mutation strategy of D.segeticola;
[0025] Figure 9Figure 1 is a SDS-PAGE analysis chart of purified DspckA and three site-mutated proteins of the present application;
[0026] Figure 10 Figure 4 is a result chart of in vitro interaction between DspckA and three site-mutated proteins of the present application and ningnanmycin by MST. DETAILED DESCRIPTION
[0027] The present application will be described in detail below with reference to the embodiments, which are only illustrative and not limited to the scope of the present application. The present application is not limited to the following embodiments or examples, and any modification and variation made without departing from the spirit of the present application shall be included in the scope of the present application. The experimental materials used in the following examples are commercially available unless otherwise specified.
[0028] In the following examples, the wild strain GZSQ-4 of D. segeticola was isolated and identified from tea leaf spot in Shiqian County, Guizhou Province, and was sent to China General Microbiological Culture Collection Center for preservation, with the strain preservation number of CGMCC3.20152. The genomic DNA sequence of DspckA gene in the strain is shown in SEQ ID NO. 1, the CDS sequence is shown in SEQ ID NO. 2, and the amino acid sequence of DspckA protein encoded by the gene is shown in SEQ ID NO. 3. Through sequence alignment, the gene should belong to the phosphoenolpyruvate carboxykinase (PCK) family gene.
[0029] Experimental Example I, Construction of D. segeticola gene knockout mutant ΔDspckA
[0030] The schematic diagram of knockout and mutation screening strategy of DspckA gene of D. segeticola is shown in Figure 1 The specific construction and screening method is as follows:
[0031] 1. Construction of knockout gene fragment
[0032] 1) Amplification of upstream and downstream homologous sequences of target gene: the genomic DNA of D. segeticola wild type strain CGMCC3.20152 was used as a template, and primer 1F and 2R were used to amplify upstream A fragment, and primer 3F and 4R were used to amplify downstream B fragment. The 5' end of primer 2R has a reverse complementary sequence of primer HYGF, and the 5' end of primer 3F has a reverse complementary sequence of primer HYGR. The sequences (5' end to 3' end) of primers 1F, 2R, 3F, 4R, HYGF and HYGR are as follows:
[0033] 1F: ACGATTGCGAGGTACTTTCTG
[0034] 2R:ACCTCCACTAGCTCCAGCCAAGATGGAAATGTGATCGCTGC
[0035] 3F:GAATAGAGTAGATGCCGACCGGGTCCTGACGTCAGCATAATCG
[0036] 4R: TTCAACGTCGGATTGTTCAAC
[0037] HYGF: CTTGGCTGGAGCTAGTGGAGGT
[0038] HYGR:CCCGGTCGGCATCTACTCTATTC
[0039] 2) Amplification of the hygromycin resistance gene hph: using plasmid pct74 (map shown in figure) Figure 2 Using the template shown, the first half (H1, 1094 bp) of the hygromycin resistance gene was amplified using primers HYGF and HYG-1R; the second half (H2, 748 bp) was amplified using primers HYG-1F and HYGR. The sequences (5' to 3') of primers HYG-1F and HYG-1R are as follows:
[0040] HYG-1F: CGTTGCAAGACCTGCCTGAA
[0041] HYG-1R: GGATGCCTCCGCTCGAAGTA
[0042] 3) Fusion of upstream and downstream fragments of the target gene with the hygromycin resistance gene: Overlapping PCR was used to overlap the recovered A and B fragments with the H1 and H2 fragments, respectively, to obtain the A-H1 and H2-B ligation fragments. The A-H1 and H2-B fragments were amplified using primers 1F / HYG-1R and HYG-1F / 4R, respectively, and the knockout fragments were purified to achieve a concentration of 500 ng / μL.
[0043] 2. Preparation of D. segeticola protoplasts
[0044] 1) Inoculate D. segeticola into potato dextrose broth (PDB) medium and culture at 25°C for 36 h. Collect the mycelium into 2 mL centrifuge tubes, break the mycelium with a grinder, transfer the mycelial suspension to CM liquid medium and shake for 36 h. Filter and collect the fresh mycelium of D. segeticola.
[0045] 2) 10 mL 0.8 mol / L potassium chloride solution as osmotic pressure stabilizer, configuration of disintegration enzyme (Drislase), lysozyme and snailase mixed enzyme solution, lysis of suspended mycelium 5 g, 30 ℃, 100 rpm enzymolysis 4 h;
[0046] 3) sterilized 2-3 layers of mirror paper (fiber mesh size 45 ± 12 μm) filtration, 0.8 mol / L potassium chloride rinse, collect the filtrate, the resulting filtrate at 4 ℃, 4000 rpm centrifugation 6 min. Resuspended with 15 mL 1.2 mol / L sorbitol buffer (STC) solution;
[0047] 4) discard the supernatant, resuspend the protoplast with 1 mL STC buffer, make a concentration of 1 × 10 7 Protoplast suspension, ice for standby.
[0048] 3、D. segiticola protoplast transformation
[0049] 1) take 200 μL of protoplast suspension into a 50 mL centrifuge tube, add 10-20 μg of A-H1 and H2-B knock-out transformation fragment, mix gently, and stand on ice for 20 min.
[0050] 2) Add 1.4 mL of 40% polyethylene glycol 4000 buffer (PTC) in two times, mix gently, stand at room temperature for 20 min, add 5 mL of TB3 liquid medium, mix, 25 ℃, 120 rpm for 12-16 h.
[0051] 3) room temperature, 4000 rpm / min centrifugation 6 min, discard the supernatant, the remaining 1 mL resuspension and resuspended protoplast.
[0052] 4) add 50 mL of warm TB3 regeneration solid medium, mix well to prepare a plate. After 24 h of inverted culture at 25 ℃, cover with PDA medium containing 30 μg / mL hygromycin B, and culture at 25 ℃ for 2-4 days until the transformants grow, and then subculture and select for 3 generations.
[0053] 4、Transformant PCR verification
[0054] After subculturing for 3 generations on PDA medium containing hygromycin, ΔDspckA transformants can be obtained. CTAB method is used to extract DNA from the transformant colonies, and PCR amplification is performed with primers to amplify the hph gene with primer pair HYGF / HYGR, and to detect whether the target gene is knocked out with primer pair 5F / 6R. The sequence of primers 5F, 6R (5' end to 3' end) is:
[0055] 5F: CGTCGCTATCAACTTTGCCG
[0056] 6R: TGCTGGAATGGCTTCTCGTT
[0057] The gene knockout fragment was introduced into the protoplast of D. segicola by homologous recombination method, and hygromycin positive transformants were obtained. The positive transformants were analyzed by PCR using specific primers of hph gene, and the results are shown in Figure 3 The hph gene, the occurrence of homologous recombination upstream and the occurrence of homologous recombination downstream were detected in the transformants, and the DspckA gene was not amplified in the transformants, so the corresponding positive transformants were screened, i.e. the ΔDspckA knockout mutant was obtained.
[0058] Example 2, property analysis of D. segicola wild type WT and mutant ΔDspckA
[0059] 1. Analysis of pathogenicity of WT and ΔDspckA
[0060] The wild type and knockout mutant ΔDspckA of D. segicola were inoculated on PDA medium, and incubated in an incubator at 25°C for 7 days. A sterile puncher with a diameter of 4 mm was used to take several pieces of the fungus cake at the edge of the colony, and then the pieces were inoculated on the surface of tea leaves. The tea leaves were investigated for disease after 3 days.
[0061] The results of pathogenicity determination of ΔDspckA gene knockout mutant ΔDspckA of D. segicola on tea leaves are shown in Figure 4 , wherein, Figure 4 A is the lesion map of D. segicola wild type strain and mutant strain ΔDspckA inoculated on tea leaves for 3 days (the left lesion is WT, and the right lesion is ΔDspckA); Figure 4 B is the lesion area measurement results of D. segicola wild type strain and mutant strain ΔDspckA inoculated on tea leaves for 3 days. The vertical coordinate is the lesion area measurement, the value is the mean value based on 20 independent experiments, and the data is analyzed by Duncan new multiple range method (p<0.05). It can be seen from Figure 4 that compared with the wild type, the lesion area of the knockout mutant ΔDspckA on tea leaves is greatly reduced, indicating that the pathogenicity of D. segicola is inhibited after knocking out the DspckA gene.
[0062] 2. Analysis of the difference in sensitivity of WT and ΔDspckA to ningnanmycin
[0063] D. segiticola wild type WT and knockout mutant ADspckA were inoculated on PDA medium with different concentrations (0, 50, 100, 200 U / mL) of ningnanmycin respectively, and cultured at 25°C in the dark. The colony diameter was measured by cross method at 7d, and the colony morphology was observed. Each treatment was set with 5 replicates. The results are shown in Figure 5 Figure 6 The inhibition rate statistics of the colony morphology and(Deep color in the column chart is WT, light color is mutant) showed that the inhibition rate of D. segiticola wild type by ningnanmycin significantly increased with the increase of the concentration of ningnanmycin, while the knockout mutant ADspckA was almost not affected, indicating that the knockout of DspckA gene reduced the sensitivity of the strain to ningnanmycin.
[0064] Example three, molecular docking experiment of ningnanmycin and candidate target protein involved in energy metabolism
[0065] The DNA sequence of the candidate target protein was converted into protein sequence by using BLAST, and screened in UniProt database (http: / / www.uniprot.org). The target sequence search was performed by using BLAST with the primary amino acid sequence contained in SWISS-MODEL template library (Bienert, S., Waterhouse, A., De, Beer. T. A., Tauriello, G., Studer, G., Bordoli, L., Schwede, T. The SWISS-MODEL Repository—new features and functionality. Nucleic Acids Research, 2017, 45 (D1): D313-D319; Camacho, C., Coulouris, G., Avagyan, V., Ma, N., Papadopoulos, J., Bealer, K., Madden, T. L. BLAST +The crystal structure of phosphoenolpyruvate carboxykinase (PEPCK) of T. cruzi (1ii2.1) was chosen as a homology model to build the three-dimensional structure of DspckA (Schmidtke, C, Findeis, S., Sharma, C. M., Kuhfuβ, J., Hoffmann, S., Vogel, J., Stadler, P. F., Bonas, U. Genome-wide transcriptome analysis of the plant pathogen Xanthomonas identifies sRNAs with putative virulence functions. Nucleic Acids Research, 2012, 40(5): 2020-2031). The molecular docking program AutoDock Tools and AutoDock vina were used to perform automatic molecular docking simulations between ningnanmycin and each candidate target protein (Morris, G. M., Huey, R., Lindstrom, W., Sanner, M. F., Belew, R. K., Goodsell, D. S., Olson, A. J. AutoDock4 and AutoDock Tools4: Automated docking with selective receptor flexibility. Journal of Computational Chemistry, 2009, 30(16): 2785-2791; Trott, O., Olson, A. J. AutoDock Vina: improving the speed and accuracy of docking with a new scoring function, efficient optimization, and multithreading. Journal of Computational Chemistry, 2010, 31(2): 455-461). PyMOL was used for visual analysis. Water molecules and ligands were removed from the protein structure and hydrogens and Gasteiger were added before the molecular docking calculation. Ten docking poses were calculated for molecular docking with the lowest binding energy being chosen.Figure 7 Figure 7 A: The molecular docking result of ningnanmycin and DspckA; Figure 7 B: The docking binding site of ningnanmycin and DspckA) shows the result that the binding energy is -7.4 Kcal / mol, which reveals that ningnanmycin has interaction with DspckA, forms stable hydrogen bonds with the amino acids T264, T265 and E306 of DspckA, and thus indicates that DspckA can be used as a target for screening fungicides, and ningnanmycin is a candidate fungicide.
[0066] Experimental Example Four, Prokaryotic Expression and Protein Purification
[0067] 1. Construction of Prokaryotic Expression Vector
[0068] 1) Point mutation fragment and DspckA CDS sequence amplification: total RNA of D. segiticola was extracted (kit: Quanshijin ER501), and reverse transcription PCR (kit: Quanshijin AE311) was used to obtain cDNA of D. segiticola. The amplification primers of amino acid 264 (T264A), 265 (T265A), 306 (E306A) mutation and DspckA gene CDS sequence SEQ ID NO. 2 were designed. With D. segiticola cDNA as template, primers 13-F / 8R, 13F / 10R and 13F / 12R were used to amplify the first half of the point mutation fragment P1, and primers 7F / 14R, 9F / 14R and 11F / 14R were used to amplify the second half of the point mutation P2 (as shown in Figure 8 ); DspckA CDS sequence was amplified with primers 13F and 14R. The sequences (5' end to 3' end) of primers 7F, 8R, 9F, 10R, 11F, 12R, 13F and 14R are as follows:
[0069] 7F: CTCTCCGGTACTGGCAAGGCCACTCTCTCCGCCGACCC
[0070] 8R: GGGTCGGCGGAGAGAGTGGCCTTGCCAGTACCGGAGAG
[0071] 9F: TCCGGTACTGGCAAGACCGCTCTCTCCGCCGACCC
[0072] 10R: GGGTCGGCGGAGAGAGCGGTCTTGCCAGTACCGGA
[0073] 11F: GGTCTCTCCGCCGAGAAGGCGCCCGATATCTTCAACG
[0074] 12R: CGTTGAAGATATCGGGCGCCTTCTCGGCGGAGAGACC
[0075] 13F: cagcaaatgggtcgcggatccATGGTTCCCCAAGTCAACAAGA
[0076] 14R: ttgtcgacggagctcgaattcTTATGCCTTGGTCTGTGGCC
[0077] 2) Fusion of point mutation fragment gene: Overlapping PCR was used to overlap the recovered P1 fragment and P2 fragment to obtain a DNA fragment of T264A, T265A, and E306A point mutation.
[0078] 3) Homologous recombination to construct a vector: the amplified DspckA gene CDS sequence and the DNA fragment of three site point mutations were respectively introduced into the pET-28a(+) vector by homologous recombination to obtain a recombinant plasmid.
[0079] 2, Prokaryotic expression of protein
[0080] Transformation: the four recombinant plasmids were transformed into competent E. coli Rosetta DE3 cells, which were then plated on plates containing 50 μg / mL kanamycin after heat shock at 42°C, and cultured at 37°C;
[0081] Activation: single colonies were picked into liquid culture medium containing antibiotics and cultured at 37°C;
[0082] Induction: when the OD value reached 0.6, 0.8 mM inducer IPTG was added, and the culture was continued, and the culture was incubated at 16°C overnight, and the culture without the addition of inducer was the negative control;
[0083] Collection of bacterial cells: centrifugation at 6000 rpm for 20 min, discard the supernatant, and collect the bacterial cells;
[0084] Expression detection: buffer A (0.2M PBS, 19mL NaH2PO4, 81mL Na2HPO4, sterilized water to 1L) was added to the collected bacterial cells to suspend them, and an ultrasonic disrupter was used to fully dissolve them. The supernatant crude protein was collected by centrifugation, and the supernatant crude protein was prepared for sample preparation and gel detection.
[0085] 3, Protein purification
[0086] The supernatant crude protein was subjected to affinity purification;
[0087] Equilibration: equilibrate the column with Ni-NTA packing, wash the column with buffer B (150 mL PBS, 0.2 M mercaptoethanol, 100 mL glycerol, 17.4 g sodium chloride, 1.36 g imidazole, sterilized water to 1 L) ;
[0088] Column loading: incubate the crude protein with the equilibrated column packing, collect the effluent;
[0089] Equilibration: wash the column with buffer B;
[0090] Washing: wash the column with buffer B;
[0091] Elution: elute with buffer C (50 mL PBS, 0.2 M mercaptoethanol, 100 mL glycerol, 17.4 g sodium chloride, 27.2 g imidazole, sterilized water to 1 L), collect the effluent;
[0092] Purification detection: prepare samples from the crude protein, effluent component and purified protein, respectively, and prepare SDS-PAGE (10% separation gel, 5% concentration gel) for detection.
[0093] Collection and treatment: desalt the purified component into protein storage buffer D (150 mL PBS, 300 mM NaCl, pH 7.4), concentrate, filter sterilize, 1 mL / tube, store at -80°C.
[0094] The results of the gel detection are shown in Figure 9 Figure 9 A is the DspckA expressed and purified protein, wherein M: protein standard molecular weight, 1 lane: crude protein in supernatant, 2 lane: effluent after protein column, 3-11 lane: multiple tubes of protein after purification; Figure 9 B is the T264A mutant protein, wherein M: protein standard molecular weight, 1 lane: crude protein in supernatant, 2, 3 lane: effluent after protein column, 4-11 lane: multiple tubes of protein after purification; Figure 9 C is the T265A mutant protein, wherein M: protein standard molecular weight, 1 lane: crude protein in supernatant, 2 lane: effluent after protein column, 3-9 lane: multiple tubes of protein after purification; Figure 9 D is the E306A mutant protein, wherein M: protein standard molecular weight, 1 lane: crude protein in supernatant, 2 lane: effluent after protein column, 3-8 lane: multiple tubes of protein after purification), it can be seen that the DspckA and T264A, T265A and E306A mutant proteins have been successfully purified.
[0095] Example Five, Microcalorimetric Mobility Experiment
[0096] The interaction of DspckA, T264A, T265A and E306A proteins with candidate bactericidal molecules was studied by microscale thermophoresis (MST)
[0097] Preparation of protein sample: 5 μL of RED-NHS dye and NHS labeling buffer were mixed by gently blowing, 10 μL of purified desalted protein (obtained in Example Four) and 90 μL of the above RED-NHS solution were added to a de-enzyme 1.5 mL centrifuge tube, mixed on ice, and incubated at room temperature for 30 min in a dark light-proof environment; 10 μL of protein fluorescent labeling solution was taken by capillary blood vessel and placed on the microscale thermophoresis instrument for determination, and the protein labeling solution with a fluorescence value of 400-1200 was reserved for subsequent experiments;
[0098] Setting of microscale thermophoresis instrument parameters: the interaction of DspckA, T264A, T265A and E306A proteins with ningnanmycin was studied by Monolith NT.115 microscale thermophoresis instrument, and the instrument parameters were LED power 40%, Laserpower 30% and Red excitation;
[0099] Analysis of the interaction of proteins with ningnanmycin: as shown in Figure 10 , DspckA has interaction with ningnanmycin, and the dissociation constant K d = 4.51 ± 1.76, which reveals that DspckA can be used as a target for screening bactericides; and it is found that T264A, T265A and E306A do not have interaction with ningnanmycin, and the dissociation constant increases, K d = 80.61 ± 30.59, K d = 22.87 ± 8.50 and K d = 14.03 ± 2.73. It is shown that amino acid substitution weakens the binding affinity, and it is revealed that the amino acids at positions 264, 265 and 306 of DspckA protein are important binding sites.
[0100] The conventional techniques and schemes not described in detail in the above examples are well known in the art, and therefore will not be described in detail here. The above examples and / or experimental examples describe the preferred embodiments of the present application in detail, however, the present application is not limited to the specific details in the above embodiments, and within the technical concept of the present application, various simple modifications can be made to the technical solutions of the present application, and these simple modifications all belong to the protection scope of the present application.
Claims
1. DspckA application of genes in reducing the virulence of Didymella segeticola pathogenicity, characterized in that, The DspckA The nucleotide sequence of the gene is as shown in SEQ ID NO.1 or SEQ ID NO.2, or DspckA The amino acid sequence of the protein encoded by the gene is shown in SEQ ID NO.3; the application is to reduce... DspckA This is achieved through gene expression.
2. DspckA The use of genes in the design and screening of antifungal agents, characterized in that, The DspckA The nucleotide sequence of the gene is as shown in SEQ ID NO.1 or SEQ ID NO.2, or DspckA The amino acid sequence of the protein encoded by the gene is shown in SEQ ID NO.3; the fungus is Didymella segeticola .
3. DspckA Use of genes in breeding transgenic plants with reduced pathogenicity Didymella segeticola characterized in that The application relates to a method for improving the yield of a plant, comprising the step of introducing into the plant a nucleic acid molecule encoding a polypeptide having the amino acid sequence as shown in SEQ ID NO. 3, or a functional variant thereof, wherein the nucleic acid molecule is operably linked to at least one regulatory sequence. DspckA The nucleotide sequence of the gene is as shown in SEQ ID NO. 1 or SEQ ID NO. 2, or DspckA The amino acid sequence of the protein encoded by the gene is as shown in SEQ ID NO. 3; and the application is achieved by reducing DspckA The expression of the gene.
4. A method of breeding a transgenic plant having reduced pathogenicity, characterized in that, Didymella segeticola Including reducing receptors Didymella segeticola In DspckA The expression level of gene mRNA, or the expression level of DspckA protein, or the activity of DspckA protein, determines the transgene. Didymella segeticola The steps; the DspckA The nucleotide sequence of the gene is shown in SEQ ID NO.1 or SEQ ID NO.2, or DspckA The amino acid sequence of the protein encoded by the gene is shown in SEQ ID NO.
3. 5. The method of claim 4, wherein, The reduction of receptors Didymella segeticola In DspckA The expression level of the gene's mRNA, or the expression level of the DspckA protein, or the activity of the DspckA protein, is determined by means of the receptor... DspckA This is achieved by knocking out genes.
6. The method of claim 4, wherein, The reduction of receptors Didymella segeticola In DspckA The expression level of the gene's mRNA, or the expression level of the DspckA protein, or the activity of the DspckA protein, is determined by means of the receptor... DspckA This is achieved through the silencing of gene expression.
7. The method of claim 4, wherein, The reduction of receptors Didymella segeticola In DspckA The expression level of the gene's mRNA, or the expression level of the DspckA protein, or the activity of the DspckA protein, is determined by means of the receptor... DspckA This is achieved by suppressing gene expression.
8. Use of a method according to any one of claims 4 to 7 for the control of plant diseases caused by Didymella segeticola Phytophthora infestans.
9. Use of the DspckA protein as a drug target for the screening of bactericidal agents, characterized in that, The amino acid sequence of the DspckA protein is shown as SEQ ID NO. 3, and the bactericide inhibits Didymella segeticola .
10. Use according to claim 9, wherein T264, T265 and E306 amino acids in DspckA protein as drug targets.
Citation Information
Patent Citations
Application of threonine dehydratase in regulation and control of growth of Didymeria segeticola and application of threonine dehydratase as bactericide target
CN119570832A