High-yield D-pantothenic acid genetically engineered bacterium based on one-carbon unit supply and construction and application thereof

Abstract

The invention provides a high-yield D-pantothenic acid genetically engineered bacterium based on one-carbon unit supply as well as a construction method and application of the high-yield D-pantothenic acid genetically engineered bacterium. According to the invention, the supply of cofactors is enhanced mainly by enhancing a glycine splitting system and a folic acid synthesis route; the method comprises the following steps of: further moderately strengthening the key gene of the serine path, reasonably regulating and controlling the synthesis rate of the serine, enhancing the synthesis of the carbon flux flowing to D-pantothenic acid, and finally strengthening the key gene of the synthesis path of the D-pantothenic acid, so that the expression efficiency of the genetically engineered bacterium is improved, and the yield of the D-pantothenic acid is obviously increased. Finally, a plasmid-free and antibiotic-free high-yield strain for high yield of D-pantothenic acid is obtained. The shake-flask titer of the strain reaches 7.96 g / L and is improved by 16.3% compared with that of an original strain, finally, the D-pantothenic acid yield reaches 147.3 g / L when a 5-L fermentation tank is used for fermentation for 96 hours, and synthesis of D-pantothenic acid is greatly improved.

Description

Technical Field

[0001] The present invention belongs to the technical field of genetic engineering, and specifically relates to a genetically engineered bacterium with high yield of D-pantothenic acid based on one-carbon unit supply and a construction method thereof, as well as application of the genetically engineered bacterium with high yield of D-pantothenic acid in preparing D-pantothenic acid by microbial fermentation. Background Art

[0002] Pantothenic acid (PA) is an important member of the vitamin B family, also known as vitamin B5 or pantothenic acid. It is an essential vitamin for maintaining normal energy metabolism. Pantothenic acid was first isolated from yeast in 1933. It is widely present in various foods in nature, especially animal liver, vegetables and whole grains. As a component of coenzyme A (CoA) and acyl carrier protein (ACP), D-pantothenic acid participates in biochemical reactions such as fatty acid synthesis, protein metabolism, and energy metabolism. It has multiple biological functions and is essential for maintaining normal physiological functions. It is widely used in the pharmaceutical industry, food industry, feed processing, cosmetics and other industries. Its global market value is expected to continue to grow in the next few years.

[0003] Currently, the chemical enzymatic method is the mainstream production method of D-pantothenic acid, which has the advantages of substrate specificity and mild reaction conditions, but has low productivity, high cost, difficulty in industrialization, and the generation of toxic and harmful substances during the production process, which is contrary to the concept of green development. Compared with traditional chemical production methods, the products produced by microbial cell factories are more environmentally friendly and reduce pollution to the environment, which meets the urgent needs of modern society for green production. In addition, this production method can also achieve carbon neutrality, that is, the carbon emissions during the production process will reach zero or negative values, thereby reducing the negative impact on the carbon dioxide content in the atmosphere, which is conducive to meeting the challenges of climate change and provides a more environmentally friendly and economically efficient method for producing D-pantothenic acid.

[0004] However, microbial fermentation also faces challenges such as strain selection, fermentation scale-up, and downstream separation and purification difficulties. A new generation of fermentation engineering technology that is intelligent, economical, and efficient is an important development direction for the future. Summary of the invention

[0005] In order to solve the technical problem of low yield of D-pantothenic acid synthesized by microbial fermentation in the prior art, the present invention uses CRISPR-Cas9-mediated gene editing technology to strengthen the glycine cleavage system and the folate synthesis pathway in the chassis bacteria genome and enhance the supply of cofactors; further moderately strengthen the key genes of the serine pathway, reasonably regulate the serine synthesis rate, and enhance the carbon flux to the synthesis of D-pantothenic acid; finally, by strengthening the key genes of the D-pantothenic acid synthesis pathway, the expression efficiency of the genetically engineered bacteria is improved, and finally a genetically engineered bacterium with high yield of D-pantothenic acid is obtained, and the genetically engineered bacterium is applied to the preparation of D-pantothenic acid by microbial fermentation.

[0006] The technical solution adopted by the present invention is: a method for constructing a genetically engineered bacterium with high production of D-pantothenic acid, comprising: using CRISPR-Cas9-mediated gene editing technology to: strengthen the genome of the bottom plate bacteria; pbC Gene expression; increase gxDV Gene copy number and strengthen expression; weaken nac Gene expression; Enhancement serA Gene, glyA Gene expression is dynamically regulated using the Apt2#82 ribosomal switch serA Gene, glyA Gene expression; increase panB The gene copy number is increased and the expression is enhanced to obtain a genetically engineered bacterium with high production of D-pantothenic acid.

[0007] The present invention is based on the chassis bacteria DPAH8 ( E. coli W3110, Trc- EcilvD* / BspanB A* / CgpanC* / alsS* / BspanB * / nac GTG / ΔP 345ptsH / gltA GTG / gltA TTG / Trc -PpfkB / Trc -gcvTHP / U f :: fOI / yeeP::Trc-Apt2#82- serAglyA- P panB -panB / gapC ::Trc- alsS* ) based on the comprehensive application of system metabolic engineering strategy, using CRISPR / Cas9 gene editing technology to strengthen the genes related to the THF synthesis pathway. pbC The in situ promoter of the gene was replaced with the Trc promoter, which enhanced the pABA pathway of folate synthesis, promoted folate accumulation, and provided a methyl carrier for the one-carbon unit. yeej Pseudogene loci increase Trc -gcvTHP Gene copy number, cleaves intracellular glycine and produces 5,10-MTHF and NADH, eliminates glycine inhibition, and enhances cofactor supply; downregulates nac The start codon was replaced by promoter replacement to enhance the Apt2#82 glycine ribosomal switch, thereby relieving the transcriptional inhibition of the glycine cleavage system by nac and purR regulatory factors, eliminating glycine accumulation, and continuously and effectively providing one-carbon units for the synthesis of D-pantothenic acid. serA、glyA Real-time control of gene expression can achieve moderate enhancement of key genes in the serine pathway and rationally regulate the serine synthesis rate. tfad Pseudogene loci increase key genes in D-pantothenate biosynthesis pathway panB The copy number was increased to improve the expression efficiency of the genetically engineered bacteria and increase the production of D-pantothenic acid, and finally a plasmid-free, antibiotic-free engineered strain for high production of D-pantothenic acid was obtained.

[0008] Table 1. Genes and corresponding pathways involved in gene editing Gene Involved pathways Folate synthesis Glycine synthesis Glycine synthesis Serine synthesis Serine synthesis Pantoate synthesis Preferably, the strengthening pbC Methods of gene expression include: pbC The in situ promoter of the gene is replaced with the Trc promoter. The strong promoter enhances the pABA pathway of folate synthesis, promotes the combination of pABA and GTP pathway, strengthens folate synthesis, and provides a methyl carrier for one-carbon units.

[0009] Preferably, the increase gxDV Methods for increasing gene copy number and enhancing expression include: yeej Pseudogene loci increase regulated by the Trc promoter gxDV Gene copy number. Enhance the glycine cleavage system to cleave intracellular glycine and produce 5,10-MTHF and NADH, eliminate glycine inhibition, strengthen cofactor supply, and increase the synthesis of D-pantothenic acid.

[0010] Preferably, the weakening nac Methods of gene expression include: nac The gene start codon mutated to TTG, thereby relieving the transcriptional inhibition of the glycine cleavage system by nac and purR regulatory factors, eliminating glycine accumulation, and continuously and effectively providing one-carbon units for the synthesis of D-pantothenic acid.

[0011] Preferably, the strengthening serA Gene, glyA Gene expression is dynamically regulated using the Apt2#82 ribosomal switch serA Gene, glyA The method for expressing a gene comprises: serA The in situ promoters of the gene and glyA gene were replaced with the Trc promoter, and the Apt2#82 ribosomal switch was inserted after the Trc promoter. This achieved moderate enhancement of the key genes in the serine pathway. This strategy can reasonably regulate the serine synthesis rate, maintain intracellular glycine at a low level, and effectively promote the synthesis of D-pantothenic acid.

[0012] Preferably, the increase panB Methods for increasing gene copy number and enhancing expression include: tfad Increased pseudogene loci regulated by the PpanB promoter panB Gene copy number. Thereby improving the expression efficiency of the genetically engineered bacteria, better responding to methyl supply, and promoting the synthesis of D-pantothenic acid.

[0013] Preferably, the bottom plate bacteria is: E. coli W3110, Trc- EcilvD* / BspanB A* / CgpanC* / alsS* / BspanB * / nac GTG / ΔP 345ptsH / gltA GTG / gltA TTG / Trc -PpfkB / Trc -gcvTHP / U f :: fOI / yeeP::Trc-Apt2#82- serA / Apt2#82 glyA- P panB -panB / gapC ::Trc- alsS* Wherein, the method for constructing the bottom plate bacteria preferably includes: (1) Using engineered bacteria E. coli W3110, Trc- EcilvD* / BspanB A* / CgpanC* / alsS* / BspanB * / nac GTG / ΔP 345ptsH / gltA GTG / gltA TTG / Trc -PpfkB The starting strain was named DPAH2, and CRISPR-Cas9-mediated gene editing technology was used to modify the genome of the strain. gxDVThe in situ promoter of the gene was replaced with the Trc promoter, and the transcriptional regulatory region was deleted to obtain the engineered bacteria DPAH3 derivative, Trc- gxDV , denoted as engineered bacteria DPAH3; (2) Using the engineered bacterium DPAH3 as the starting strain, we used CRISPR-Cas9-mediated gene editing technology to U f Pseudogene site increases by one molecule fOI Gene copy, obtain the engineered bacteria DPAH6 derivative, U f :: fOI , denoted as engineered bacteria DPAH6; (3) Using the engineered bacterium DPAH6 as the starting strain, CRISPR / Cas9 gene editing technology was used to integrate serA and glyA Gene cluster, add another molecule after the gene cluster panB Gene copy, obtain engineered bacteria DPAH7derivative, yeeP::Trc-Apt2#82- serAglyA- P panB -panB , denoted as engineered bacteria DPAH7; (4) Using the engineered bacterium DPAH7 as the starting strain, CRISPR / Cas9 gene editing technology was used to add Bacillus subtilis regulated by the promoter pTrc into the genome by gene knock-in alsS Gene copy number, codon optimization, and engineered bacteria DPAH8 derivative were obtained. gapC ::Trc- alsS* , denoted as engineered bacteria DPAH8, i.e. the genetically engineered bacteria that produces high levels of D-pantothenic acid.

[0014] Preferably, the gene regulated by the Ptrc promoter pbC Gene 、gcvTHP Gene, serA Gene , glyA Gene, panB The gene nucleotide sequences are shown in SEQ ID NO. 1, SEQ ID NO. 2, SEQ ID NO. 3, SEQ ID NO. 4, and SEQ.ID.NO.5 respectively; nac The nucleotide sequence of the gene is shown in SEQ ID NO. 6.

[0015] More specifically, the method for constructing the genetically engineered bacteria that produces high levels of D-pantothenic acid comprises the following steps: (1) Using engineered bacteria E. coli W3110, Trc- EcilvD* / BspanB A* / CgpanC* / alsS* / BspanB * / nac GTG / ΔP 345ptsH / gltA GTG / gltA TTG / Trc -PpfkB / Trc -gcvTHP / U f :: fOI / yeeP::Trc-Apt2#82- serA / Apt2#82 glyA- P panB -panB / gapC ::Trc- alsS* The starting strain was named DPAH8, and CRISPR-Cas9-mediated gene editing technology was used to modify the genome of the strain. pbC The in situ promoter of the gene was replaced with the Trc promoter to obtain the engineered bacteria DPAH9 derivative, Trc- pbC , denoted as engineered bacteria DPAH9; (2) Using the engineered bacterium DPAH9 as the starting strain, we used CRISPR-Cas9-mediated gene editing technology to yeej Increased pseudogene loci trc-gcvTHP Gene copy number, obtain the engineered bacteria DPAH10 derivative, yeej :: trc- gxDV , denoted as engineered bacteria DPAH10; (3) Using the engineered bacterium DPAH10 as the starting strain, the CRISPR / Cas9 gene editing technology was used to modify the genome nac The start codon was mutated to TTG to obtain the engineered bacteria DPAH11 derivative. nac TTG , denoted as engineered bacteria DPAH11; (4) Using the engineered bacterium DPAH11 as the starting strain, CRISPR / Cas9 gene editing technology was used to modify serA The in situ promoter was replaced with the Trc promoter, and the ribosomal switch Apt2#82 was inserted after the promoter to obtain the engineered bacterial DPAH12 derivative, Trc-Apt2#82 serA , denoted as engineered bacteria DPAH12; (5) Using the engineered bacterium DPAH12 as the starting strain, CRISPR / Cas9 gene editing technology was used to modify glyAThe in situ promoter was replaced with the Trc promoter, and the ribosomal switch Apt2#82 was inserted after the promoter to obtain the engineered bacterial DPAH13 derivative, Trc-Apt2#82- glyA , denoted as engineered bacteria DPAH13; (6) Using the engineered bacterium DPAH13 as the starting strain, CRISPR / Cas9 gene editing technology was used to tfad Increased pseudogene loci panB Gene copy number, obtained engineered bacteria DPAH14 derivative, tfad ::trc- panB , denoted as engineered bacteria DPAH14, i.e. the genetically engineered bacteria that produces high levels of D-pantothenic acid.

[0016] The present invention also provides a genetically engineered bacterium with high yield of D-pantothenic acid obtained by the method. Through the above method, the present invention constructs a genetically engineered bacterium without plasmid and antibiotic addition during fermentation. Preferably, the genetically engineered bacterium with high yield of D-pantothenic acid is: E. coli W3110, Trc- EcilvD* / BspanB A* / CgpanC* / alsS* / BspanB * / nac GTG / ΔP 345ptsH / gltA GTG / gltA TTG / Trc -PpfkB / Trc -gcvTHP / U f :: fOI / yeeP::Trc-Apt2#82- serAglyA- P panB -panB / gapC ::Trc- alsS* / Trc- pabC / yeej :: trc- gcvTHP / nac TTG / Trc-Apt2#82- serA / Trc-Apt2#82 glyA / tfad ::Trc- panB The strain's shake flask titer reached 7.96 g / L, an increase of 16.3% compared to the starting strain. Finally, after 96 hours of fed-batch fermentation in a 5L fermenter, the D-pantothenic acid production reached 147.3 g / L, which greatly improved the synthesis of D-pantothenic acid and shortened the fermentation cycle.

[0017] The present invention also provides the use of the genetic engineering bacteria with high D-pantothenic acid production in the preparation of D-pantothenic acid by microbial fermentation.

[0018] Preferably, the application comprises: inoculating the genetically engineered bacteria with high D-pantothenic acid production into a fermentation medium, carrying out fed-batch fermentation culture for 72 to 96 hours at 28 to 37°C, 300 to 450 rpm, pH 6.7 to 6.9, and 10 to 30% dissolved oxygen, and separating and purifying the D-pantothenic acid after the fermentation is completed.

[0019] Preferably, the fermentation medium is composed of: 10-30 g / L glucose, 10-25 g / L ammonium sulfate, 1-5 g / L anhydrous betaine, 1-5 g / L yeast powder, 1-5 g / L potassium dihydrogen phosphate, 0.5-2 g / L anhydrous magnesium sulfate, 1-5 g / L β-alanine, 1-5 ml / L trace element solution, the solvent is deionized water, and the pH value is natural; the trace element solution is composed of: 10 g / L CuCl2, 10 g / L FeSO4·7H2O, 10 g / L ZnSO4·7H2O, 0.2 g / L CuSO4, 0.02 g / L NiCl2·7H2O, and the solvent is deionized water.

[0020] Preferably, the application comprises: loading a 5 L fermentation tank with a volume of 1-3 L fermentation medium, sterilizing at 115°C for 30 min, inoculating the genetically engineered bacterial strain into 1-3 L fermentation medium, and fermenting and culturing at 28-37°C, an initial ventilation volume of 3-6 L / min, and an initial stirring speed of 300-450 rpm, adjusting the pH with ammonia water, and adding IPTG with a final concentration of 0.1-0.4 mM, and a final concentration of 5 mg / L VB1, 2 mg / L VB 12 , and 10~40 g / L isoleucine 5~10 mL; during the fermentation process, the dissolved oxygen is maintained at 10%~30% by using dissolved oxygen serial speed, and ammonia water is used as a neutralizer to maintain pH 6.7~6.9, and the feed medium is added to the tank through pH linkage feeding, and the glucose concentration is controlled below 5g / L, and cultured at 28~37℃ for 72~96 hours to obtain the fermentation liquid, and the fermentation liquid supernatant is separated and purified to obtain the D-pantothenic acid. Wherein, the feed medium is composed of 500g / L glucose, 5~25g / L ammonium sulfate, 2~8g / L anhydrous betaine, 1~5g / L yeast powder, 10~20g / L potassium dihydrogen phosphate, 5~15g / L anhydrous magnesium sulfate, 40~100g / L β-alanine, 1~5 ml / L trace element solution, the solvent is deionized water, and the pH value is natural.

[0021] The present invention has the following beneficial effects: the present invention utilizes CRISPR / Cas9 gene editing technology to strengthen the glycine cleavage system and the folate synthesis pathway on the basis of the existing engineered bacteria DPAH8, and strengthens the supply of cofactors; further moderately strengthens the key genes of the serine pathway, reasonably regulates the serine synthesis rate, and enhances the carbon flux to the synthesis of D-pantothenic acid; finally, by strengthening the key genes of the D-pantothenic acid synthesis pathway, the expression efficiency of the genetically engineered bacteria is improved, and the yield of D-pantothenic acid is significantly increased, and finally a high-yield strain for high-yield D-pantothenic acid without plasmid and antibiotic addition is obtained; the shake flask titer of the strain of the present invention reaches 7.96 g / L, which is 16.3% higher than that of the starting strain; finally, a 5 L fermentation tank is used for fermentation for 96 hours, and the D-pantothenic acid yield reaches 147.3 g / L, which greatly improves the synthesis of D-pantothenic acid. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 The OD600 and D-pantothenic acid titer changes of DPAH9 in Example 1.

[0023] Figure 2 The OD600 and D-pantothenic acid titer changes of DPAH10 in Example 1.

[0024] Figure 3 The OD600 and D-pantothenic acid titer changes of DPAH11 in Example 1.

[0025] Figure 4 The OD600 and D-pantothenic acid titer changes of DPAH12 in Example 1.

[0026] Figure 5 The OD600 and D-pantothenic acid titer changes of DPAH13 in Example 1.

[0027] Figure 6 The OD600 and D-pantothenic acid titer changes of DPAH14 in Example 1.

[0028] Figure 7 This is a diagram showing the fermentation results of DPAH14 in a 5 L bioreactor in Example 2. DETAILED DESCRIPTION

[0029] The following is an explanation of the embodiments of the present invention by specific specific examples, and those skilled in the art can easily understand other advantages and effects of the present invention from the contents disclosed in this specification. The present invention can also be implemented or applied by other different specific embodiments, and the details in this specification can also be modified or changed in various ways based on different viewpoints and applications without departing from the spirit of the present invention. It should be noted that, in the absence of conflict, the features in the following embodiments and embodiments can be combined with each other. In the embodiments of the present invention, the methods used are all conventional methods unless otherwise specified, and the reagents used can be obtained from commercial sources.

[0030] In the following examples, the final concentration of spectinomycin in the culture medium is 0.05 mg / L, and the final concentration of kanamycin in the culture medium is 0.05 mg / L.

[0031] The parent strain of the present invention E. coli W3110 is from the Coli Genetic Stock Center of Yale University, with a deposit date of August 5, 1975 and a deposit number of CGSC#4474, and has been disclosed in patents US 2009 / 0298135A1 and US2010 / 0248311 A1.

[0032] The HPLC determination method for D-pantothenic acid content is as follows: chromatographic conditions: C18 column (250 × 4.6 mm, particle size 5 μm, Agilent Technologies Co., Santa Clara, CA, USA), detection wavelength: 200 nm, column temperature: 30°C; sample treatment: dilute the sample with ultrapure water to keep the D-pantothenic acid content between 0.05 g / L and 0.40 g / L; mobile phase: acetonitrile / water / phosphoric acid: (50 / 949 / 1); data acquisition time: 25 min.

[0033] Example 1: Construction of genetically engineered bacteria that produce high levels of D-pantothenic acid DPAH9 construction and shake flask fermentation Take ZJUTDPAH8( E. coli W3110, Trc- EcilvD* / BspanB A* / CgpanC* / alsS* / BspanB * / nac GTG / ΔP 345ptsH / gltA GTG / gltA TTG / Trc -PpfkB / Trc -gcvTHP / U f:: fOI / yeeP::Trc-Apt2#82- serAglyA- P panB -panB / gapC ::Trc- alsS* ) was used as the starting strain, and CRISPR-Cas9-mediated gene editing technology was used to modify the pbC The in situ promoter of the gene was replaced with the Trc promoter (nucleotide sequence as shown in SEQ ID NO. 1), and the pABA pathway of folate synthesis was enhanced by the strong promoter, which promoted the combination of pABA and GTP pathway, strengthened folate synthesis, and provided a methyl carrier for one-carbon units, thereby obtaining the strain DPAH9 (DPAH8 derivative, Trc- pbC ).

[0034] (1) Construction of pTarget-PAM- pbC Plasmid: pTarget plasmid (Addgene Plasmid #62226) was used as template and pT -pabC- PAM-F / R was used as primer for PCR amplification. The PCR product was verified by nucleic acid gel electrophoresis and then used Dpn I digestion enzyme was incubated at 37 ℃ for 3 h, pTarget- pabC- The PCR product of PAM was amplified by linear primers pTarget-XF and pTarget-XR, and the pTarget- pbC Linearize the vector for subsequent ligation with Donor DNA.

[0035] (2) Construction of pTD-donor- EcpabC Plasmid: First, E. coli The W3110 genome was used as a template. pabC-up -F / R is the upstream part (F1) of donor DNA obtained by primer amplification. pabC- The downstream part (F2) of the donor DNA was amplified using primers down-F / R. E. coli W3110 genome was used as template and pTrc- EcpabC -18F / R was used as primer to amplify the promoter pTrc pabC Gene fragment (F3), PCR fragments were purified by gel recovery to obtain F1, F2 and F3; plasmid pTarget- pabCAfter incubation at 37 °C for 8 h with Xba I and Pst I, the DNA fragments were recovered using the Clean up kit. The pTarget- pabC The vector, fragments F1, F2, and F3 were connected together and verified by sequencing to obtain pTD-donor -pabC Plasmid.

[0036] (3) The pCas plasmid (Addgene Plasmid #62225) was introduced into the ZJUTDPAH8 ( E.coli W3110,Trc- EcilvD* / BspanB A* / CgpanC* / alsS* / BspanB * / nac GTG / ΔP 345ptsH / gltA GTG / gltA TTG / Trc -PpfkB / Trc -gcvTHP / lafU :: folP / yeeP::Trc-Apt2#82- serAglyA- P panB -panB / gapC ::Trc- alsS* ), transfer the monoclonal colony to an LB tube containing 0.05 mg / L kanamycin and culture at 30°C overnight; then inoculate it into a 250 mL shake flask containing 50 mL LB medium at a volume concentration of 1%, add 500 μl 1 mol / L L-arabinose, and culture at 150 rpm and 30°C until OD 600 0.4~0.6; 4000 rpm, 4 ℃ centrifugation for 10 min to collect cells and prepare electroporation competent cells. For detailed procedures, see (Molecular Cloning: A Laboratory Manual, 3ed Edition, 99-102).

[0037] (4) Use a pipette to draw an appropriate amount of pTD-donor -pabC (about 200ng) plasmid was mixed with 100 μl electroporation competent cells prepared in advance and transferred into a pre-cooled 2 mm electroporation cup. After ice bathing for about 1-2 minutes, electroporation was performed using an electroporator (MicroPluser TMAfter electroporation, 800 μl of LB medium was added and gently aspirated immediately, and the cells were transferred to a 2 mL Eppendorf tube. After 3-4 h of recovery at 30°C, the cells were coated with LB solid plates containing 0.05 mg / L kanamycin and 0.05 mg / L spectinomycin, and incubated at 30°C for 12-16 h. pabC -VF / R were used as primers for colony PCR verification. If a fragment of about 3000 bp was successfully cloned, it was proved to be DPAH9 (DPAH8 derivative, Trc- pabC ) positive colonies.

[0038] (5) Plasmid elimination: Use an inoculation loop to pick up a positive single colony and inoculate it into a LB liquid test tube containing 1 mM IPTG and 0.05 mg / L kanamycin. Culture it at 30°C overnight. The next day, streak the bacterial liquid onto a LB solid plate containing 0.05 mg / L kanamycin. Culture it at 30°C for 24 h. When the bacteria grow to a certain size, pick some single colonies and streak them onto a LB plate containing 0.05 mg / L spectinomycin. Single colonies that cannot be streaked onto the LB plate containing 0.05 mg / L spectinomycin show that their pTarget- pabC The plasmid was successfully eliminated, and then pTarget- pabC The single colony with successful plasmid elimination was placed in an LB test tube and cultured overnight at 37°C to eliminate the pCas plasmid. The next day, the bacterial solution was streaked on an LB plate. After culturing at 37°C for 12 h, some single colonies were picked and streaked on an LB plate containing 0.05 mg / L kanamycin. The single colonies that could not be streaked on the LB plate containing 0.05 mg / L kanamycin had their pCas plasmid successfully eliminated. Finally, a plasmid-free strain was obtained. The starting strain H8 was used as the control group and inoculated into 10 mL of LB medium respectively, and cultured at 37°C and 200 rpm as a preculture; after 8-12 h, 1 mL of the preculture was inoculated into a 500 mL shake flask containing 50 mL of MS medium at a 2% inoculum, and then cultured in a constant temperature shaker at 30°C and 180 rpm for 48 h for strain fermentation; after the fermentation, 1 mL of the fermentation liquid was taken to measure the OD 600 At the same time, 1 mL of fermentation liquid was drawn with a pipette and centrifuged at 12000 rpm for 3 min at room temperature. The fermentation supernatant was diluted 5 times and the diluted sample was treated with a water filter membrane to remove impurities. The OD 600 and the D-pantothenic acid content in the fermentation supernatant. Figure 1 shown.

[0039] As can be seen from the figure, the genome pabCThe in situ promoter of the gene was replaced with the Trc promoter, and the D-pantothenic acid production of DPAH9 was 7.13 g / L after 48 hours of shake flask fermentation. The strong promoter enhanced the pABA pathway of folate synthesis, promoted the combination of pABA and GTP pathways, strengthened folate synthesis, provided a methyl carrier for one-carbon units, and successfully increased the production of D-pantothenic acid.

[0040] LB medium: 10 g / L peptone, 5 g / L yeast extract, 5 g / L NaCl, solvent is deionized water, pH value is natural.

[0041] MS culture medium: glucose 20 g / L, (NH4)2SO4 16 g / L, KH2PO4 2 g / L, MgSO4 0.5 g / L, yeast extract 2 g / L, CaCO3 10 g / L, 1 ml / L trace element solution, the solvent is deionized water, pH value is natural; 10 g / L calcium carbonate (sterilized separately); the composition of the trace element solution is: 10 g / L CuCl2, 10 g / L FeSO4·7H2O, 1 g / L ZnSO4·7H2O, 0.20 g / L CuSO4, 0.02 g / L NiCl2·7H2O, the solvent is deionized water.

[0042] Construction and shake flask fermentation Using ZJUTDPA H19 as the starting strain, CRISPR-Cas9-mediated gene editing technology was used to increase the trc- gcvTHP The gene copy number was increased (the nucleotide sequence is shown in SEQ ID NO. 2), the glycine cleavage system was enhanced, and the synthesis of D-pantothenic acid was promoted. The strain DPAH10 (DPAH9 derivative, yeej::trc-gcvTHP) was obtained.

[0043] (1) Build pTarget-X-yeej-trc- gcvTHP -Plasmid: pTarget plasmid (Addgene Plasmid #62226) was used as template, pT - yeej-trc- gcvTHP - XF / R were used as primers for PCR amplification. After the PCR product was verified by nucleic acid gel electrophoresis, it was used Dpn I digestion enzyme was incubated at 37 ℃ for 3 h, and pTarget-yeej-trc- gcvTHP Linearize the vector for subsequent ligation with Donor DNA.

[0044] (2) Construction of pTD-donor-yeej-trc- gcvTHP Plasmid: First, E. coliW3110 genome as a template, yeej-trc- gcvTHP -F / R is the primer to amplify donor DNA, and the PCR fragment is purified by gel recovery to obtain F1; plasmid pTarget- yeej-trc- gcvTHP After incubation at 37 °C for 8 h with Xba I and Pst I, the DNA fragments were recovered using the Clean up kit. The pTarget-yeej-trc- gcvTHP The linearized vector and fragment F1 were connected together and verified by sequencing to obtain pTD-donor - yeej-trc- EcgcvTHP Plasmid.

[0045] (3) Introduce the pCas plasmid (Addgene Plasmid #62225) into ZJUTDPAH9, transfer the monoclonal colony to an LB tube containing 0.05 mg / L kanamycin, and culture at 30°C overnight; then inoculate it into a 250 mL shake flask containing 50 mL LB medium at a volume concentration of 1%, add 500 μl 1 mol / L L-arabinose, and culture at 150 rpm and 30°C until the OD 600 0.4~0.6; 4000 rpm, 4 ℃ centrifugation for 10 min to collect cells and prepare electroporation competent cells. For detailed procedures, see (Molecular Cloning: A Laboratory Manual, 3ed Edition, 99-102).

[0046] (4) Use a pipette to draw an appropriate amount of pTD-donor - yeej-trc- EcgcvTHP (about 200ng) plasmid was mixed with 100 μl electroporation competent cells prepared in advance and transferred into a pre-cooled 2 mm electroporation cup. After ice bathing for about 1-2 minutes, electroporation was performed using an electroporator (MicroPluser TM , BIO-RAD) for electroporation transformation. After the electroporation, 800 μl of LB medium was immediately added and gently aspirated, transferred to a 2 mL Eppendorf tube, and thawed at 30°C for 3-4 h before coating on a LB solid plate containing 0.05 mg / L kanamycin and 0.05 mg / L spectinomycin. The plate was inverted and cultured at 30°C for 12-16 h. gcvTHP-VF / R as primers for colony PCR verification. If a fragment of about 3500 bp can be successfully cloned, it is proved to be DPAH10 (DPAH9 derivative, yeej-trc-- gcvTHP ) positive colonies.

[0047] (5) Plasmid elimination: The implementation method is the same as DPAH9 construction step (5) to obtain plasmid-free DPAH10 (DPAH9derivative, yeej-trc- gcvTHP ). The strain DPAH9 was used as the control group and cultured for 48 h for fermentation. After the fermentation, 1 mL of the fermentation liquid was taken to measure the OD 600 At the same time, 1 mL of fermentation liquid was drawn with a pipette and centrifuged at 12000 rpm for 3 min at room temperature. The fermentation supernatant was diluted 5 times and the diluted sample was treated with a water filter membrane to remove impurities. The OD 600 and the D-pantothenic acid content in the fermentation supernatant. Figure 2 shown.

[0048] As can be seen from the figure, using CRISPR / Cas9 gene editing technology, yeej Increased pseudogene loci trc-gcvTHP The gene copy number, D-pantothenic acid production of DPAH10 after 48h of shake flask fermentation was 7.37 g / L. The glycine cleavage system was activated by a strong promoter to cleave intracellular glycine and produce 5,10-MTHF and NADH, eliminating glycine inhibition, strengthening cofactor supply, and successfully increasing the synthesis of D-pantothenic acid.

[0049] Construction and shake flask fermentation Using DPAH10 as the starting strain, CRISPR-Cas9-mediated gene editing technology was used to downregulate the glycine cleavage system inhibitor nac ,Will nac The start codon was mutated to TTG (nucleotide sequence as shown in SEQ ID NO. 6), which relieved nac and purR The transcriptional inhibition of the glycine cleavage system by regulatory factors such as β-glycine can eliminate the accumulation of glycine and continuously and effectively provide one-carbon units for the synthesis of D-pantothenic acid to obtain DPAH11 (DPAH10 derivative, nac TTG ).

[0050] (1) Construction of pTarget-PAM- nac TTG Plasmid: pTarget F plasmid (Addgene Plasmid #62226) was used as template and pT- nac TTG- PAM-F / R was used as primer for PCR amplification. The PCR product was verified by nucleic acid gel electrophoresis and then used Dpn I digestion enzyme was incubated at 37 ℃ for 3 h, pTarget-PAM- nac TTG The PCR product was amplified with linearized primers pTarget-XF and pTarget-XR, and the pTarget-PAM- nac TTG Linearize the vector for subsequent ligation with DonorDNA.

[0051] (2) Construction of pTD-Donor- nac TTG Plasmid: First, E. coli The W3110 genome was used as a template. nac TTG -up-F / R is the primer used to amplify the upstream part of donor DNA (F1). nac TTG -down-F / R was used as primer to amplify the downstream part (F2) of donor DNA. F1 and F2 were obtained by gel recovery and purification of PCR fragments. According to the instructions of ClonExpress® (One stepclone kit, Vazyme Biotech, Nanjing, China), pTarget- nac TTG The linearized vector, fragments F1 and F2 were connected together and verified by sequencing to obtain pTD- nac TTG Plasmid.

[0052] (3) The pCas plasmid (Addgene Plasmid #62225) was introduced into the DPAH10 competent cell obtained in Example 2. The preparation method of the DPAH10 competent cell by electroporation was the same as that of the DPAH9 construction step (3).

[0053] (4) DPAH11 positive colonies were constructed using the same method as DPAH9 construction step (4).

[0054] (5) Plasmid elimination: The implementation method is the same as DPAH9 construction step (5) to obtain plasmid-free DPAH11 (DPAH10derivative, nac TTG ).

[0055] (6) The constructed DPAH11 production strain was used as a control group with the DPAH10 constructed in Example 2 for shake flask testing and detection. 600 and the D-pantothenic acid content in the fermentation supernatant. Figure 3shown.

[0056] As can be seen from the figure, we have nac The start codon was mutated to TTG, which reduced the transcriptional inhibition of the glycine cleavage system and increased the D-pantothenic acid production of DPAH11 to 7.44 g / L. nac The protein can reduce the transcriptional inhibition of the glycine cleavage system and regulate the ability of intracellular glycine synthesis, which is an effective strategy to continuously and effectively provide one-carbon units for the synthesis of D-pantothenic acid.

[0057] Construction and shake flask fermentation Using DPAH11 as the starting strain, CRISPR / Cas9 gene editing technology was used to modify the genome of strain DPAH11. serA The original promoter was replaced with the Trc promoter and the ribosomal switch Apt2#82 (nucleotide sequence as shown in SEQ ID NO. 3) was inserted after the promoter to obtain the strain DPAH12 (DPAH11derivative, Trc-Apt2#82serA).

[0058] (1) Construction of pTarget-PAM- Trc-Apt2#82 serA Plasmid: pTarget F plasmid (Addgene Plasmid #62226) was used as template, pT-PAM-Trc-Apt2#82 serA -F / R is primer PCR amplification, and the PCR product is Dpn I'm at 37 o C incubation for 3 h; pTarget-PAM-Trc-Apt2#82 serA The PCR product was amplified with linearized primers pTarget-XF and pTarget-XR, and purified by gel recovery to pTarget-PAM-Trc-Apt2#82 serA Linearize the vector for subsequent ligation with Donor DNA.

[0059] (2) Construction of pTD-Donor-Trc-Apt2#82 serA Plasmid: E. coli W3110 genome as template, Trc-Apt2#82 serA -up-F, Trc-Apt2#82 serA -up-R is the primer to amplify the upstream part of donorDNA (F1), Trc-Apt2#82 serA -down-F and Trc-Apt2#82 serA-down-R was used as primer to amplify the downstream part (F2) of donor DNA, and then E.coli W3110 genome was used as template and pTrc-Apt2#82 was used serA -18F / R was used as primer to amplify Apt2#82 with promoter pTrc serA Gene fragment (F3), PCR fragments were purified by gel recovery to obtain F1, F2 and F3, and the Clean up kit was used to recover DNA fragments; according to ClonExpress ® (One step cloning kit, Vazyme Biotech, Nanjing, China) instructions to pTarget-Trc-Apt2#82 serA The linearized vector, fragments F1 and F2 were connected together and verified by sequencing to obtain pTD-Trc-Apt2#82 serA Plasmid.

[0060] (3) The pCas plasmid (Addgene Plasmid #62225) was introduced into the DPAH11 competent cell obtained in Example 3. The preparation method of the DPAH11 competent cell by electroporation was the same as that of the DPAH9 construction step (3).

[0061] (4) DPAH12 positive colonies were constructed using the same method as DPAH9 construction step (4).

[0062] (5) Plasmid elimination: The implementation method is the same as DPAH9 construction step (5) to obtain plasmid-free DPAH12 (DPAH11 (derivative, Trc-Apt2#82serA) (6) The constructed DPA12 production strain was used as a control group with the DPAH11 constructed in Example 3 for shake flask testing and detection. 600 and the D-pantothenic acid content in the fermentation supernatant. Figure 4 shown.

[0063] Serine catabolism can produce toxic intermediates, namely, highly reactive and toxic β-hydroxypyruvate as a product of the transamination reaction, and α-amino acrylate formed as a byproduct of serine deamination. In the early stage, additional serine was added to the engineered bacteria to promote tetrahydrofolate synthesis, and it was found that it had a certain toxic effect on the bacteria. Apt2#82 was added to the DPA11 genome. serA The in situ promoter was replaced with the Trc promoter, and the D-pantothenic acid production of strain DPAH12 was successfully increased to 7.58 g / L. This strategy promoted the synthesis of D-pantothenic acid by inhibiting the serine synthesis pathway to a certain extent, rationally regulating the serine synthesis rate, reducing its toxicity.

[0064] Construction and shake flask fermentation Using DPAH12 as the starting strain, CRISPR / Cas9 gene editing technology was used to modify the genome of strain DPAH12. glyA The in situ promoter was replaced with the Trc promoter and the ribosomal switch Apt2#82 (nucleotide sequence as shown in SEQ ID NO. 4) was inserted after the promoter to obtain the engineered bacterium DPAH13 (DPAH12 derivative, Trc-Apt2#82- glyA ).

[0065] (1) Construction of pTarget-PAM - Trc-Apt2#82- glyA Plasmid: pTarget F plasmid (Addgene Plasmid #62226) was used as template, pT-PAM-Trc-Apt2#82- glyA -F / R were used as primers for PCR amplification. After the PCR product was verified by nucleic acid gel electrophoresis, it was used Dpn I digestion enzyme was incubated at 37 ℃ for 3 h, pTarget-PAM-Trc-Apt2#82 glyA The PCR product was amplified with linearized primers pTarget-XF and pTarget-XR, and purified by gel recovery to pTarget-PAM-Trc-Apt2#82 glyA Linearize the vector for subsequent ligation with Donor DNA.

[0066] (2) Construction of pTD-Donor-Trc-Apt2#82 glyA Plasmid: E. coli W3110 genome as template, Trc-Apt2#82 glyA -up-F, Trc-Apt2#82 glyA -up-R is the primer to amplify the upstream part of donor DNA (F1), Trc-Apt2#82 glyA -down-F and Trc-Apt2#82 glyA -down-R was used as primer to amplify the downstream part (F2) of donor DNA, and then E.coli W3110 genome was used as template and pTrc-Apt2#82 was used glyA -18F / R was used as primer to amplify Apt2#82 with promoter pTrc glyA Gene fragment (F3), PCR fragments were purified by gel recovery to obtain F1, F2 and F3, and the Clean up kit was used to recover DNA fragments; according to ClonExpress ®(One step cloning kit, Vazyme Biotech, Nanjing, China) instructions to pTarget-Trc-Apt2#82 glyA The linearized vector, fragments F1 and F2 were connected together and verified by sequencing to obtain pTD-Trc-Apt2#82 glyA Plasmid.

[0067] (3) The pCas plasmid (Addgene Plasmid #62225) was introduced into the DPAH12 competent cell obtained in Example 4. The preparation method of the DPAH12 competent cell by electroporation was the same as that of the DPAH9 construction step (3).

[0068] (4) DPAH13 positive colonies were constructed using the same method as DPAH9 construction step (4).

[0069] (5) Plasmid elimination: The implementation method is the same as DPAH9 construction step (5) to obtain plasmid-free DPAH13 (DPAH12 (derivative, Trc-Apt2#82 glyA ) (6) The constructed DPA13 production strain was used as a control group with DPAH12 constructed in Example 4 for shake flask testing and detection. 600 and the D-pantothenic acid content in the fermentation supernatant. Figure 5 shown.

[0070] To further enhance carbon flux to D-pantothenate synthesis, the Apt2#82 glycine ribosomal switch was enhanced by promoter replacement in the genome. glyA Real-time controlled expression of genes can achieve moderate enhancement of key genes in the serine pathway, rationally regulate the serine synthesis rate, and promote the increase of shake flask yield. As can be seen from the figure, the D-pantothenic acid production of the DPAH13 strain has increased to 7.84 g / L.

[0071] Construction and shake flask fermentation Using DPAH13 as the starting strain, CRISPR / Cas9 gene editing technology was used to modify the genome of strain DPAH13. tfad Pseudogene loci increase trc -panB The gene copy number (nucleotide sequence is shown in SEQ ID NO. 5) was obtained to obtain the engineered bacteria DPAH14 (DPAH13derivative, tfad:: trc -panB) .

[0072] (1) Build pTarget - tfad : : trc - panB-X plasmid: pTarget F plasmid (Addgene Plasmid #62226) was used as template and pT - tfad :: panB -XF / R were used as primers for PCR amplification. After the PCR product was verified by nucleic acid gel electrophoresis, it was used Dpn I digestion enzyme was incubated at 37 ℃ for 3 h, and pTarget-PAM- tfad :: panB Linearize the vector for subsequent ligation with Donor DNA.

[0073] (2) Construction of pTD-Donor-trc - tfad :: panB Plasmid: E. coli The W3110 genome was used as a template. tfad :: panB -F. tfad :: panB -R is the primer for amplification to obtain donor DNA (F1), and the PCR fragment is purified by gel recovery to obtain F1, and the DNA fragment is recovered by the Clean up kit; according to ClonExpress ® (One step cloning kit, VazymeBiotech, Nanjing, China) instructions to pTarget- tfad :: panB The linearized vector and fragment F1 were connected together and verified by sequencing to obtain pTD-trc- tfad :: panB Plasmid.

[0074] (3) The pCas plasmid (Addgene Plasmid #62225) was introduced into the DPAH13 competent cell obtained in Example 5. The preparation method of the DPAH13 competent cell by electroporation was the same as that of the DPAH9 construction step (3).

[0075] (4) DPAH14 positive colonies were constructed using the same method as DPAH9 construction step (4).

[0076] (5) Plasmid elimination: The implementation method is the same as DPAH9 construction step (5) to obtain plasmid-free DPAH14 (DPAH13 (derivative, tfad :: panB ) (6) The constructed DPA14 production strain was used as a control group with the DPAH13 constructed in Example 5 for shake flask testing and detection. 600 and the D-pantothenic acid content in the fermentation supernatant. Figure 6 shown.

[0077] Utilization in the DPAH13 genome tfad Pseudogene loci increase key genes in D-pantothenate biosynthesis pathway panB After the copy number was increased, the titer of D-pantothenic acid in the DPAH14 shake flask was increased to 7.96 g / L. By moderately strengthening the key genes of the pantothenic acid pathway, the expression efficiency of the genetically engineered bacteria was improved, which better responded to the methyl supply and promoted the synthesis of D-pantothenic acid.

[0078] Example 2: Application of D-pantothenic acid producing strain DPAH14 in 5 L microbial fermentation to produce D-pantothenic acid Fermentation was carried out in a 5 L fermenter (Shanghai Baoxing, BIOTECH-5BG) and included the following steps: (1) Seed culture: Inoculate DPAH8 into 10 mL LB medium on a plate and culture overnight at 37°C and 180 rpm on a shaker. Then inoculate into two bottles containing 100 mL LB medium at a volume concentration of 1% as the secondary seed solution and culture for 7 to 12 h.

[0079] (2) Inoculation and fermentation: The volume of the fermentation medium in the 5L fermenter is 2L, sterilized at 115℃ for 30min. 25~30℃, initial ventilation volume 3~6 L / min, initial stirring speed 300~450 rpm, and ammonia water to adjust the pH. Transfer 200mL of the two bottles of secondary seed liquid to the 5L fermenter containing 2L of non-resistant fermentation medium, and add IPTG with a final concentration of 0.2 mM, and the final concentrations of 5mg / L VB1, 2 mg / L VB 12 , and 5-10 mL of 10-40 g / L isoleucine, and fermentation began. During the fermentation process, the dissolved oxygen was maintained at 10%-30% using the dissolved oxygen serial speed, and the pH was maintained at 6.7-6.9 using ammonia water as a neutralizer. The glucose concentration in the tank was controlled below 5 g / L through pH linkage feeding, and the culture was carried out at 28-37°C for 3-4 days to obtain the fermentation broth. The fermentation broth is all the substances in the fermentation tank.

[0080] (3) After the fermentation supernatant was diluted 80 times, the diluted sample was treated with a water filter membrane to remove impurities, and then HPLC detection was performed according to Example 1. OD 600 and the D-pantothenic acid content in the fermentation supernatant. Figure 7 shown.

[0081] By strengthening the genes related to the THF synthesis pathway, providing methyl carriers for one-carbon units, releasing the transcriptional inhibition of the glycine cleavage system, eliminating glycine accumulation, and strengthening the supply of cofactors; further strengthening the key genes of the serine pathway, rationally regulating the serine synthesis rate to enhance the carbon flux to the synthesis of D-pantothenic acid, and finally strengthening the key genes of the D-pantothenic acid synthesis pathway, improving the expression efficiency of genetically engineered bacteria, significantly increasing the production of D-pantothenic acid, and finally obtaining a plasmid-free, antibiotic-free engineered strain DPAH14 for high-yield D-pantothenic acid. As can be seen from the figure, the D-pantothenic acid production of the engineered strain DPAH14 increased to 147.3 g / L after 96 hours of fermentation in a 5 L fermenter, which was 29.9% higher than the starting strain, greatly improving the synthesis of D-pantothenic acid.

[0082] The fermentation medium is composed of 20 g / L glucose, 16 g / L ammonium sulfate, 2 g / L anhydrous betaine, 2 g / L yeast powder, 2 g / L potassium dihydrogen phosphate, 0.5 g / L anhydrous magnesium sulfate, 1.5 g / L β-alanine, 1 ml / L trace element solution, the solvent is deionized water, and the pH value is natural. The trace element solution is composed of 10 g / L CuCl2, 10 g / L FeSO4·7H2O, 10 g / L ZnSO4·7H2O, 0.2 g / L CuSO4, 0.02 g / L NiCl2·7H2O, and the solvent is deionized water.

[0083] The feed medium is composed of 500 g / L glucose, 10 g / L ammonium sulfate, 4 g / L anhydrous betaine, 2 g / L yeast powder, 14 g / L potassium dihydrogen phosphate, 8 g / L anhydrous magnesium sulfate, 60 g / L β-alanine, 2 ml / L trace element solution, the solvent is deionized water, and the pH value is natural.

[0084] The primer sequence information used in Example 1 is shown in Table 2.

[0085] Table 2: Primer sequences Primer Name Sequence (5’-3’) pabC-pam-F TAATACTAGTTAAGAAAAAAGGCCCGCAAGGTTTTAGAGCTAGAAATAGC pabC-pam-R GCTCTAAAACCTTGCGGGCCTTTTTTCTTAACTAGTATTATACCTAGGAC pabC-UP-F ATTCTCTAGAGTCGACCTGCAAAAAACGCGGTGCGAAAATTTAC pabC -UP-R CACACATTATACGAGCCGGATGATTAATTGTCAATAGATCTTTTTAAAGATCAAAGAAC pabC-DOWN-F TCGTATAATGTGTGGAATTTCACACAGGAAACAGACCATGTTCTTAATTAACGGTCATA pabC-DOWN-R GGGTAATAGATCTAAGCTTCCTGTCAAGGACCAGCGCCTC pabC-VF GCACGTGCATTATCTACCCGC pabC-VR CTGCCTGATCCAGTCGCGGCG yee-trc-gcvTHP -XF CTCTAATTTTCCGTTATAATTTCTTAAAGAGTGTT yee-trc-gcvTHP -XF / R CATGGTCTGTTTCCTGTGTGAAATTCCACACATTATACGAGCCG yee-trc-gcvTHP-F GAATTTCACACAGGAAACAGACCATGGCACAACAGACTCCTTTG yee-trc-gcvTHP- R CTTTAAGAAATTATAACGGAAAATTACTGGTATTCGCTAATCGGTAC Yes-VF CCCCTCTTGCAACTCACACCCC Jee-VR CGCGATTCTGGCGGTGCCGC <![CDATA[PAM-nac TTG -F]]> TAATACTAGTAGATATTGGTAGCCTGACCCGTTTTAGAGCTAGAAATAGC <![CDATA[PAM-nac TTG -R]]> GCTCTAAAACGGGTCAGGCTACCAATATCTACTAGTATTATACCTAGGAC <![CDATA[nac TTG -UP-F]]> CTTTTTTTGAATTCTCTAGAAACGGGCAAGAAGTTGATGTAAAT <![CDATA[nac TTG -UP-R]]> CTGAAGTTCAAGTTGCCTCCGGTTTTTAAGAAT <![CDATA[nac TTG -DOWN-F]]> TACTTTGTAAAAATTGTCGACATCGGATCCCTGACGCAGGCTGCTGAAGTAT <![CDATA[nac TTG -DOWN-R]]> ATAGATCTAAGCTTCTGCAGTTAGCTCACCAATTGCCACTG <![CDATA[nac TTG -VF]]> CGCAATCGTGCAGAATATGAG <![CDATA[nac TTG -VR]]> CCGCATCTTATTCCATCCCG PAM- Trc-Apt2#82serA-F TAATACTAGTCCACACAACATTTCAAAAGACGTTTTAGAGCTAGAAATAGC PAM- Trc-Apt2#82serA-R GCTCTAAAACGTCTTTTGAAATGTTGTGTGACTAGTATTATACCTAGGAC Trc-Apt2#82serA-UP-F ATTCTCTAGAGTCGACCTGCCGTTGATGGCGCAGATGAAATC Trc-Apt2#82serA-UP-R CGAGCCGGATGATTAATTGTCAACTGGTTTAGAGGATTTATTTAG Trc-Apt2#82serA-DOWN-F CTAAATAATCCTCTAAACCAGTTGACAATTAATCATCCGGCTCG Trc-Apt2#82serA-DOWN-R GGGTAATAGATCTAAGCTTCCCCAATTGCGTACCAATATGACC Apt2#82serA-VF GCCTCGGCATTCACGTTTTTG Apt2#82serA-VF GCAGGTCAGAAAGATGCTGTAC PAM-Trc-Apt2#82-glyA-F TAATACTAGTACTGTTCGCCGTTGTCCAACGTTTTAGAGCTAGAAATAGC PAM-Trc-Apt2#82-glyA-R GCTCTAAAACGTTGGACAACGGCGAACAGTACTAGTATTATACCTAGGAC Trc-Apt2#82glyA-UP-F ATTCTCTAGAGTCGACCTGCTTTCAATATTACTGGCGTAGGCG Trc-Apt2#82glyA-UP-R CCACACATTATACGAGCCGGATGATTAATTGTCAACAGGCTACGCAAGGCTTTGG Trc-Apt2#82glyA-DOWN-F CCGGCTCGTATAATGTGTGGAACCTTGGAGAGACTCTTGATGAG Trc-Apt2#82glyA-DOWN-R GGGTAATAGATCTAAGCTTCGGCTTGTGTTCTTTGGCTTG Trc-Apt2#82glyA-VF GAACATTTCGTCCAGCGTTGC Trc-Apt2#82glyA-VR GTAAGCACCGATGCTGTCAGC tfad::trc- panB-XF CGGCTTGTACGGGGGAAAATAATCATTGGGATTATGCCGCAG tfad::trc- panB-XR GAAAATCCAGTTTTGTTTTCATGGTCTGTTTCCTGTGTGAAA tfad:: panB -F CGGCTTGTACGGGGGAAAATAATTGACAATTAATCATCCGGCTCG tfad:: panB -R TTATTTTCCCCCGTACAAGC tfad:: panB -VF CCCGTTCTGCGAGGCGGTGG tfad:: panB -VR CGGCTTGCATGGGGATGTCC The embodiments described above are merely descriptions of preferred implementations of the present invention and are not intended to limit the scope of the present invention. Without departing from the design spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by ordinary technicians in this field should all fall within the protection scope of the present invention.

Claims

1. A method for constructing a genetically engineered bacterium that produces high levels of D-pantothenic acid, characterized in that: Including: Using CRISPR-Cas9-mediated gene editing technology to: Strengthen the genome of chassis bacteria pbC Gene expression; increase gxDV Gene copy number and strengthen expression; weaken nac Gene expression; Enhancement serA Gene, glyA Gene expression is dynamically regulated using the Apt2#82 ribosomal switch serA Gene, glyA Gene expression; increase panB The gene copy number is increased and the expression is enhanced to obtain a genetically engineered bacterium with high production of D-pantothenic acid.

2. The method according to claim 1, characterized in that The strengthening PbC Methods of gene expression include: PbC The original promoter of the gene was replaced with the Trc promoter.

3. The method according to claim 1, characterized in that The increase gxDV Methods for increasing gene copy number and enhancing expression include: yeej Pseudogene loci increase regulated by the Trc promoter gxDV Gene copy number.

4. The method according to claim 1, characterized in that The weakening nac Methods of gene expression include: nac The gene start codon was mutated to TTG.

5. The method according to claim 1, characterized in that The strengthening serA Gene, glyA Gene expression is dynamically regulated using the Apt2#82 ribosomal switch serA Gene, glyA The method for expressing a gene comprises: serA The original promoters of the gene and glyA gene were replaced with the Trc promoter, and the Apt2#82 ribosomal switch was inserted after the Trc promoter.

6. The method according to claim 1, characterized in that The increase panB Methods for increasing gene copy number and enhancing expression include: tfad Increased pseudogene loci regulated by the PpanB promoter panB Gene copy number.

7. The method according to claim 1, characterized in that The bottom plate bacteria are: E. coli W3110, Trc- EcilvD* / BspanB A* / CgpanC* / alsS* / BspanB * / nac GTG / ΔP 345ptsH / gltA GTG / gltA TTG / Trc -PpfkB / Trc -gcvTHP / U :: fOI / yeeP::Trc-Apt2#82- serA / Apt2#82 glyA- P panB -panB / gapC ::Trc- alsS* .

8. A genetically engineered bacterium with high production of D-pantothenic acid obtained by the method according to any one of claims 1 to 7.

9. The genetically engineered bacterium for high production of D-pantothenic acid as claimed in claim 8, characterized in that: The genetically engineered bacteria that produces high levels of D-pantothenic acid are: E. coli W3110, Trc- EcilvD* / BspanB A* / CgpanC* / alsS* / BspanB * / nac GTG / ΔP 345ptsH / gltA GTG / gltA TTG / Trc -PpfkB / Trc -gcvTHP / U :: fOI / yeeP::Trc-Apt2#82- serAglyA- P panB -panB / gapC ::Trc- alsS* / Trc- pabC / yeej :: trc-gcvTHP / nac TTG / Trc-Apt2#82- serA / Trc-Apt2#82 glyA / tfad ::Trc- panB .

10. Use of the genetically engineered bacteria with high D-pantothenic acid production as claimed in claim 8 in the preparation of D-pantothenic acid by microbial fermentation.

Images