Application of ApDFR variable spliceosome in flower color regulation and anthocyanin synthesis
By cloning and expressing the ApDFR variable shear bodies ApDFR-s85 and ApDFR-s11 found in Baizilian and verifying their role in tobacco, the problem of insufficient research on DFR gene regulation in the prior art was solved, and the color regulation and color regulation were achieved. The negative regulation of anthocyanin synthesis provides a theoretical basis for genetic engineering technology.
Patent Information
- Application Number
- CN202411645639.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-11-18
- Publication Date
- 2024-12-31
AI Technical Summary
In the prior art, there are few researches on dihydroflavonol-4-reductase (DFR) in gene regulation, especially the insufficient reports on variable shear bodies, which affects the understanding of color regulation and anthocyanin synthesis and application.
The variable shear bodies ApDFR-s85 and ApDFR-s11 of dihydroflavonol 4-reductase ApDFR found in Baizilian were cloned and expressed, and converted into tobacco. They were studied in the color regulation and anthocyanin synthesis. The physiological effects and expression patterns of gene expression provide theoretical basis for the regulation of spatiotemporal and spatial characteristics of gene expression.
By overexpressing ApDFR-s85 and ApDFR-s11, negative regulation of suits and reduction of total anthocyanin synthesis is achieved, providing a theoretical basis for genetic engineering technology in color regulation, and showing methods for negative regulation of suits and colors.
Smart Images
Figure CN119220588A_ABST
Abstract
Description
Technical Field
[0001] The invention belongs to the technical field of genetic engineering, and specifically relates to an application of a variable splice form of ApDFR in flower color regulation and anthocyanin synthesis. Background Art
[0002] Dihydroflavonol 4-reductase (DFR) is a node enzyme that switches from the flavonoid synthesis pathway to the anthocyanin synthesis branch pathway and is the most critical enzyme for regulating anthocyanin synthesis. With the participation of NADPH, DFR can reduce three dihydroflavonols, dihydrokaempferol (DHK), dihydroquercetin (DHQ) and dihydromyricetin (DHM), to the corresponding colorless anthocyanins, which are then catalyzed by colorless anthocyanin dioxygenase / anthocyanidin synthase to colored anthocyanins.
[0003] DFRs of different species have different catalytic activities for three dihydroflavonol substrates, and the final catalytic products have different colors, which makes the plants present different flower colors. In addition to the catalytic selectivity of substrates, the regulation and tissue specificity of DFR gene expression are also the main reasons affecting petal coloring. Moreover, DFR not only determines whether anthocyanins are synthesized, but also the sequence, transcriptional activity, and translation process of its key sites are crucial to the final activity. Current research mainly focuses on exploring DFR genes and their functions in different species, but there is little research on DFR in gene regulation, especially reports on variable splicing. Summary of the invention
[0004] In view of the defects in the prior art, the purpose of the present invention is to fill the gaps in the cloning and expression patterns of different splice forms of Agapanthus dihydroflavonol 4-reductase ApDFRs genes, and provide an application of a variable splice form of dihydroflavonol 4-reductase ApDFR in flower color regulation and anthocyanin synthesis; the present invention discloses the physiological effects and expression patterns of the variable splice forms of Agapanthus ApDFR, including ApDFR-s85 and ApDFR-s11, after being transformed into tobacco, thereby providing a theoretical basis for regulating the spatiotemporal characteristics of ApDFR gene expression using genetic engineering technology in the future, and having great application value.
[0005] The technical solution provided by the present invention is as follows:
[0006] <First aspect>
[0007] Application of variable splicing forms of dihydroflavonol 4-reductase ApDFR in flower color regulation and anthocyanin synthesis; the variable splicing forms of ApDFR include ApDFR-s85 and ApDFR-s11; the amino acid sequence of the ApDFR is shown in SEQ ID No.2; the amino acid sequence of the ApDFR-s85 is shown in SEQ ID No.4; the amino acid sequence of the ApDFR-s11 is shown in SEQ ID No.6.
[0008] The nucleotide sequence of ApDFR is shown in SEQ ID No.1;
[0009] and / or, the nucleotide sequence of ApDFR-s85 is shown in SEQ ID No.3;
[0010] And / or, the nucleotide sequence of ApDFR-s11 is shown as SEQ ID No.5.
[0011] The flower color regulation is negative regulation.
[0012] The dihydroflavonol 4-reductase ApDFR, ApDFR-s85 and ApDFR-s11 are derived from Agapanthus nymphaeaceae.
[0013] The amplification primers of ApDFR-s85 are shown as SEQ ID NO.7 and SEQ ID NO.8.
[0014] The amplification primers of ApDFR-s11 are shown in SEQ ID NO.9 and SEQ ID NO.10.
[0015] <Second Aspect>
[0016] A recombinant expression vector, comprising ApDFR-s85 or ApDFR-s11; the amino acid sequence of ApDFR-s85 is shown as SEQ ID No.4; the amino acid sequence of ApDFR-s11 is shown as SEQ ID No.6.
[0017] <Third Aspect>
[0018] A method for negatively regulating flower color, which achieves negative regulation of flower color by overexpressing ApDFR-s85 and ApDFR-s11.
[0019] <Fourth Aspect>
[0020] A variable splice form of dihydroflavonol 4-reductase ApDFR for regulating flower color and anthocyanin synthesis, wherein the variable splice form of ApDFR comprises ApDFR-s85 and ApDFR-s11; the amino acid sequence of the ApDFR is shown in SEQ ID No.2; the amino acid sequence of the ApDFR-s85 is shown in SEQ ID No.4; and the amino acid sequence of the ApDFR-s11 is shown in SEQ ID No.6.
[0021] The nucleotide sequence of ApDFR is shown in SEQ ID No.1;
[0022] and / or, the nucleotide sequence of ApDFR-s85 is shown in SEQ ID No.3;
[0023] And / or, the nucleotide sequence of ApDFR-s11 is shown as SEQ ID No.5.
[0024] Application of variable splicing forms of dihydroflavonol 4-reductase ApDFR in negatively regulating the synthesis and accumulation of total anthocyanins; the variable splicing forms of ApDFR include ApDFR-s85 and ApDFR-s11; the amino acid sequence of the ApDFR is shown in SEQ ID No.2; the amino acid sequence of the ApDFR-s85 is shown in SEQ ID No.4; the amino acid sequence of the ApDFR-s11 is shown in SEQ ID No.6.
[0025] Compared with the prior art, the present invention has the following beneficial effects:
[0026] 1) The present invention discovered and cloned for the first time two alternative splicing forms of Agapanthus nymphaeaceus ApDFR, ApDFR-s11 and ApDFR-s85, and identified them as truncated alternative splicing forms.
[0027] 2) When it was transformed into tobacco, it was found that the flower color of the two transgenic tobaccos was lighter than that of the wild type, and the anthocyanin content was lower, which provided a theoretical basis for the use of genetic engineering technology to regulate flower color in the future. BRIEF DESCRIPTION OF THE DRAWINGS
[0028] Other features, objects and advantages of the present invention will become more apparent from the detailed description of non-limiting embodiments made with reference to the following drawings:
[0029] Figure 1 The present invention is a comparison of the gene structures of the Agapanthus nymphaeaceae ApDFR and its alternative splicing forms ApDFR-s85 and ApDFR-s11;
[0030] Figure 2The phylogenetic tree analysis of the Agapanthus nymphaeaceae ApDFR and its alternative splicing forms ApDFR-s85 and ApDFR-s11 and other DFR proteins of the present invention;
[0031] Figure 3 The expression changes of Agapanthus nymphaeaceus ApDFR and its alternative splicing forms ApDFR-s85 and ApDFR-s11 during the flower color formation process of blue and white varieties;
[0032] Figure 4 The flower color phenotype of wild-type and transgenic tobacco with ApDFR and its alternative splicing forms, ApDFR-s85 and ApDFR-s11, was observed.
[0033] Figure 5 Comparison of anthocyanin content in wild-type and transgenic tobacco expressing ApDFR and its alternative splicing forms ApDFR-s85 and ApDFR-s11. DETAILED DESCRIPTION
[0034] The present invention is described in detail below in conjunction with specific embodiments. The following embodiments will help those skilled in the art to further understand the present invention, but are not intended to limit the present invention in any form. It should be noted that, for those of ordinary skill in the art, several changes and improvements can also be made without departing from the concept of the present invention. These all belong to the protection scope of the present invention.
[0035] The experimental methods in the following examples without specifying specific conditions are usually based on conventional conditions.
[0036] Example 1: Gene cloning and sequence analysis of Agapanthus nymphaeaceae ApDFR-s85 and ApDFR-s11
[0037] 1. Acquisition of plant materials
[0038] Petal tissues of Agapanthus praecox ssp. orientalis 'Big Blue' variety at full flowering stage were used for RNA extraction.
[0039] 2. Total RNA Extraction and cDNA Synthesis
[0040] Total RNA was extracted using a column-based RNA extraction kit (TaKaRa MiniBEST Universal RNA Extraction Kit), the integrity of RNA was identified by agarose gel electrophoresis, and the purity and concentration of RNA were determined on a spectrophotometer (Thermo Scientific NanoDrop1000 spectrophotometer). TMII 1stStrand cDNA Synthesis Kit synthesizes cDNA.
[0041] 3. Cloning of ApDFR-s85 and ApDFR-s11
[0042] Blastx analysis was performed using the full-length transcript ApDFR of dihydroflavonol-4-reductase from Agapanthus nymphaeaceae (the amino acid sequence is shown in SEQ ID NO.2, and the nucleotide sequence is shown in SEQ ID NO.1), and two alternatively spliced transcripts of Agapanthus nymphaeaceae ApDFR, ApDFR-s85 and ApDFR-s11, were screened. Amplification primer pairs for ApDFR-s85 and ApDFR-s11 were designed, respectively, and PCR cloning was performed. The gene sequence was confirmed by DNA sequencing.
[0043] in:
[0044] The amino acid sequence of ApDFR-s85 is shown in SEQ ID NO.4; the nucleotide sequence is shown in SEQ ID NO.3;
[0045] The amino acid sequence of ApDFR-s11 is shown in SEQ ID NO.6; the nucleotide sequence is shown in SEQ ID NO.5;
[0046] The primer pair sequences are as follows:
[0047] ApDFR-s85-s (SEQ ID NO.7): ATGCAGATGTATTTTGTATC;
[0048] ApDFR-s85-a (SEQ ID NO. 8): CTAGTGTGTAGCGATAGGAACC;
[0049] ApDFR-s11-s (SEQ ID NO.9): ATGCAGATGTATTTTGTATC;
[0050] ApDFR-s11-a (SEQ ID NO. 10): TCAATTGCCTTTCAGACTTTCT.
[0051] 4. Sequence Analysis of ApDFR-s85 and ApDFR-s11
[0052] The gene sequences of ApDFR, ApDFR-s85 and ApDFR-s11 were compared and analyzed. The sequence relationships among the three are as follows: Figure 1ApDFR contains 6 exons, while ApDFR-s85 and ApDFR-s11 only contain 3 and 1 exons, respectively, indicating that the dihydroflavonol-4-reductase encoded by ApDFR-s85 and ApDFR-s11 has an incomplete structure and lacks enzyme activity.
[0053] An evolutionary tree was constructed by combining the amino acid sequences of ApDFR, ApDFR-s85 and ApDFR-s11 with the DFR sequences of multiple other species. It was found that the ApDFRs of Agapanthus nymphaeaceae were more closely related in evolution to the DFR genes of monocots and formed two branches with the DFRs of dicots.
[0054] Figure 2 This is an evolutionary tree analysis of the ApDFR of the present invention and its variable splicing forms ApDFR-s85 and ApDFR-s11 and other DFR proteins.
[0055] Example 2: Expression analysis of Agapanthus nigra ApDFR-s85 and ApDFR-s11
[0056] 1. Acquisition of plant materials
[0057] Petal tissues of two varieties of Agapanthus praecox ssp.orientalis, 'BigBlue' with blue flowers and 'Bridal Bouquet' with white flowers, were taken at the bud stage (S1), bud elongation stage (S2) and pre-opening stage (S3) for RNA extraction;
[0058] 2. Total RNA Extraction and cDNA Synthesis
[0059] Same as Example 1.
[0060] 3. Real-time fluorescence quantitative PCR (qPCR)
[0061] The reaction was performed using an Applied BiosystemsTM 7500 real-time fluorescence quantitative PCR instrument. The reaction system consisted of 10 μL of ChamQ Universal SYBR qPCR Master Mix (Q711-02, Nanjing Novozyme Biotechnology Co., Ltd.), 2 μL of cDNA template (reverse transcription cDNA diluted 5 times), 0.5 μL of each forward and reverse primer, and ddH 2O was added to 20 μL. The PCR reaction procedure was a two-step method: 95℃ pre-denaturation for 30 s, 95℃ denaturation for 5 s, 60℃ renaturation for 30 s, for a total of 40 cycles; then 95℃ reaction for 15 s, 60℃ reaction for 1 min, 95℃ reaction for 30 s, and 60℃ reaction for 15 s were used to prepare the melting curve analysis. Each system was repeated 3 times, and the system without template was used as a blank control. The expression level of the target gene was measured with 2 -ΔΔCT Method calculation.
[0062] 4. Expression Analysis
[0063] ApDFR-s85 and ApDFR-s11 were expressed at higher levels in white petals than in blue petals; while ApDFR in Agapanthus was continuously upregulated during the development of both blue and white petals, and its expression in blue petals was significantly higher than that in white petals. This indicates that the expression levels of these two genes and ApDFR in petals of different colors show obvious differences and opposite trends, which can preliminarily suggest that these genes have different roles in related physiological processes such as petal color formation, and may even have opposite roles.
[0064] Figure 3 The expression level changes of Agapanthus nigra ApDFR and its alternative splicing forms ApDFR-s85 and ApDFR-s11 during the flower color formation process of blue and white varieties.
[0065] Example 3: Functional identification of Agapanthus nymphaeaceae ApDFR-s85 and ApDFR-s11 in transgenic tobacco
[0066] 1. Construction of expression vector containing target gene
[0067] According to the full-length coding sequences of Agapanthus nymphaeaceus ApDFR-s85 (SEQ ID NO.3) and ApDFR-s11 (SEQ ID NO.5), primers for amplifying the complete coding reading frame were designed, and restriction endonuclease sites were introduced into the upstream and downstream primers, respectively, so as to construct an expression vector; the specific steps are as follows:
[0068] The ApDFR-s85 (SEQ ID NO.3) and ApDFR-s11 (SEQ ID NO.5) genes of Agapanthus nymphaeaceus were connected to the plant binary expression vector pHB (CN 116334109 A) respectively. After the correct reading frame was identified, it was transferred into Agrobacterium tumefaciens (such as GV3101), and the transformed Agrobacterium was identified by PCR (Pei Lin. The role of Agapanthus nymphaeaceus ApSBT cut in ultra-low temperature storage-induced PCD [D]. Shanghai Jiaotong University, 2020. DOI: 10.27307 / d.cnki.gsjtu.2020.001195.) to ensure that the plant expression vector containing the ApDFR-s85 and ApDFR-s11 genes of Agapanthus nymphaeaceus were successfully transformed into Agrobacterium tumefaciens.
[0069] 2. Agrobacterium tumefaciens-mediated transformation of tobacco
[0070] Referring to the method of Zhang Ning and Wang Di (2004) (Study on the efficient genetic transformation system of tobacco mediated by Agrobacterium. Gansu Agricultural Science and Technology, (9): 11–13.), the leaf disc method was used to infect tobacco leaves, and hygromycin was used as a screening pressure to select transformation-positive cells, which were further cultivated into seedlings.
[0071] 3. Phenotypic detection of transgenic tobacco
[0072] like Figure 4 and Figure 5 As shown, the flower color of tobacco overexpressing ApDFR-s85 and ApDFR-s11 was lighter than that of wild-type WT, and the total anthocyanin content was also reduced by 37.5% and 53.4% compared with that of wild-type WT, indicating that ApDFR-s85 and ApDFR-s11 have a negative regulatory effect on the synthesis and accumulation of total anthocyanins.
[0073] Example 4: Functional differences between the full-length gene ApDFR and the alternative splicing forms ApDFR-s85 and ApDFR-s11
[0074] 1. Acquisition of plant materials
[0075] Same as Example 1.
[0076] 2. Total RNA Extraction and cDNA Synthesis
[0077] Same as Example 1.
[0078] 3. Cloning and expression vector construction of ApDFR
[0079] According to the coding gene of ApDFR (SEQ ID NO.2), a primer pair (ApDFR-s (SEQ ID NO.10): ATGCAGAATGAAGTGATA; ApDFR-a (SEQ ID NO.12): CTAGTGTGTAGCGATAGG) was designed to clone ApDFR by PCR, and the gene sequence was confirmed by DNA sequencing. The overexpression vector pHB-ApDFR was constructed using a one-step cloning kit (C112-01, Nanjing Novogene Biotech Co., Ltd.). It was transformed into Agrobacterium tumefaciens GV3101, and the transformed Agrobacterium was identified by PCR to ensure that the plant expression vector containing the Agapanthus ApDFR gene was successfully transformed into Agrobacterium tumefaciens.
[0080] 4. Agrobacterium tumefaciens-mediated transformation of tobacco
[0081] Same as Example 3.
[0082] 5. Phenotypic Detection of Transgenic Tobacco
[0083] like Figure 4 and Figure 5 As shown, the flower color of tobacco overexpressing ApDFR is darker than that of wild-type WT, and darker than that of tobacco overexpressing ApDFR-s85 and ApDFR-s11. The total anthocyanin content of tobacco petals of different genotypes was detected, and it was found that the total anthocyanin content in tobacco petals overexpressing ApDFR was the highest, which was 42% higher than that of wild-type WT, and 1.3 times and 1.7 times that of tobacco petals overexpressing ApDFR-s85 and ApDFR-s11, respectively. This indicates that ApDFR and its alternative splicing variants ApDFR-s85 and ApDFR-s11 have opposite functions in regulating the synthesis of total anthocyanins.
[0084] The present invention discloses an application of an alternative splice form of ApDFR in flower color regulation and anthocyanin synthesis; the alternative splice form of ApDFR includes ApDFR-s85 and ApDFR-s11; the amino acid sequence of the ApDFR is shown in SEQ ID No.2; the amino acid sequence of the ApDFR-s85 is shown in SEQ ID No 4.; the amino acid sequence of the ApDFR-s11 is shown in SEQ ID No.6. 1) The present invention first discovered and cloned two alternative splice forms of Agapanthus nymphaeaceae ApDFR, ApDFR-s11 and ApDFR-s85, and identified them as truncated alternative splice forms. 2) After transforming them into tobacco, it was found that the flower colors of the two transgenic tobaccos were lighter than those of the wild type, and the anthocyanin content was reduced, which provided a theoretical basis for regulating flower color using genetic engineering technology in the future.
[0085] The above describes the specific embodiments of the present invention. It should be understood that the present invention is not limited to the above specific embodiments, and those skilled in the art may make various modifications or variations within the scope of the claims, which do not affect the essence of the present invention.
Claims
1. Application of the alternative splicing form of dihydroflavonol 4-reductase ApDFR in flower color regulation and anthocyanin synthesis; characterized in that, The variable splice forms of the ApDFR include ApDFR-s85 and ApDFR-s11; the amino acid sequence of the ApDFR is shown in SEQ ID No.2; the amino acid sequence of the ApDFR-s85 is shown in SEQ ID No.4; and the amino acid sequence of the ApDFR-s11 is shown in SEQ ID No.
6.
2. The use according to claim 1, characterized in that: The nucleotide sequence of ApDFR is shown in SEQ ID No. 1; and / or, the nucleotide sequence of ApDFR-s85 is shown in SEQ ID No.3; And / or, the nucleotide sequence of ApDFR-s11 is shown as SEQ ID No.
5.
3. The use according to claim 1, characterized in that: The flower color regulation is negative regulation.
4. The use according to claim 1, characterized in that: The dihydroflavonol 4-reductase ApDFR, ApDFR-s85 and ApDFR-s11 are derived from Agapanthus nymphaeaceae.
5. The use according to claim 1, characterized in that: The amplification primers of ApDFR-s85 are shown as SEQ ID NO.7 and SEQ ID NO.
8.
6. The use according to claim 1, characterized in that: The amplification primers of ApDFR-s11 are shown in SEQ ID NO.9 and SEQ ID NO.
10.
7. A recombinant expression vector, characterized in that: The recombinant expression vector comprises ApDFR-s85 or ApDFR-s11; the amino acid sequence of ApDFR-s85 is shown as SEQ ID No.4; the amino acid sequence of ApDFR-s11 is shown as SEQ ID No.
6.
8. A method for negatively regulating flower color, characterized in that: Negative regulation of flower color is achieved by overexpressing ApDFR-s85 and ApDFR-s11; the amino acid sequence of ApDFR-s85 is shown in SEQ ID No.4; the amino acid sequence of ApDFR-s11 is shown in SEQ ID No.
6.
9. An alternative splice form of dihydroflavonol 4-reductase ApDFR that regulates flower color and anthocyanin synthesis, characterized in that: The variable splice forms of the ApDFR include ApDFR-s85 and ApDFR-s11; the amino acid sequence of the ApDFR is shown as SEQ ID No.2; the amino acid sequence of the ApDFR-s85 is shown as SEQ ID No.4; and the amino acid sequence of the ApDFR-s11 is shown as SEQ ID No.
6.
10. Application of the alternative splicing form of dihydroflavonol 4-reductase ApDFR in negatively regulating the synthesis and accumulation of total anthocyanins; characterized in that: The variable splice forms of the ApDFR include ApDFR-s85 and ApDFR-s11; the amino acid sequence of the ApDFR is shown in SEQ ID No.2; the amino acid sequence of the ApDFR-s85 is shown in SEQ ID No.4; and the amino acid sequence of the ApDFR-s11 is shown in SEQ ID No.6.